Nanobodies against adeno-associated virus different serotypes and uses thereof

Abstract

The application belongs to the technical field of antibody preparation, and particularly relates to anti-adenovirus associated virus (AAV) nanobodies of different serotypes and application thereof. The nanobodies are selected from one of Nb1 to Nb24; amino acid sequences of heavy chain variable regions of the nanobodies Nb1 to Nb24 are respectively shown as SEQ ID NO. 1-24. The nanobodies provided by the application can be combined with AAV sensitively and specifically, have excellent broad-spectrum recognition and combination capacity for various serotypes such as AAV2, AAV5, AAV8 and AAV9, and have good application prospects in the fields of AAV immune detection and affinity purification.

Description

Technical Field

[0001] This invention relates to the field of antibody preparation technology, and in particular to nanobodies against different serotypes of adeno-associated virus and their applications. Background Technology

[0002] Adeno-associated virus (AAV) belongs to the parvoviridae family. It is a non-replicating, non-enveloped, single-stranded DNA virus that is infectious to both dividing and non-dividing cells. The AAV genomic DNA consists of two open reading frames (ORFs): Rep and Cap, located between two inverted terminal repeats (ITRs). The ITRs act as the origin of viral replication and packaging signals. The Rep gene participates in viral replication and integration, encoding viral replication proteins, while the Cap gene encodes the three capsid proteins VP1, VP2, and VP3. AAV viruses are well-suited for use as vectors for in vivo gene transfer due to their ability to infect a wide variety of tissues and cells, their low or no pathogenicity and immunogenicity during host cell proliferation, and their ability to stably express their carried genes over long periods. AAV vectors are recombinant adeno-associated viruses (rAAV) obtained by artificially modifying wild-type AAV by replacing the Rep and Cap genes between the two ITRs with the target gene, maximizing the capacity to carry the target gene, and reducing its immunogenicity and cytotoxicity. AAV vectors have high transduction efficiency, high targeting, a wide range of host cells (infecting both dividing and non-dividing cells), long-term expression, and good biocompatibility, and have been widely used in gene therapy and molecular biology research, and are considered "the most promising gene therapy vectors".

[0003] As the number of experiments using AAV vectors for in vivo gene transfer steadily increases, the demand for AAV vector production, purification, identification, and titer and purity testing is also steadily increasing. However, adeno-associated viruses (AAVs) have multiple serotypes, each with different capsid protein spatial structures, tissue specificities, and sequences. Consequently, the cell surface receptors they recognize and bind to vary significantly, leading to differences in the tissue and cell types transfected and the infection efficiencies. Therefore, when applying AAV viruses, it is necessary to select the appropriate serotype based on the specific tissue or organ. Traditionally, different antibodies are required for different AAV serotypes to achieve immunoassay and affinity purification for specific serotypes, which undoubtedly increases detection and purification costs significantly.

[0004] Nanobodies, also known as single-domain antibodies, are naturally occurring antibodies found in camels (such as alpacas and dromedaries) and cartilaginous fish (such as sharks). They are composed solely of the variable region of the heavy chain and lack the light chain. They are currently the smallest known antigen-binding antibody molecules, with a molecular weight only one-tenth that of traditional monoclonal antibodies. They possess advantages such as small molecular weight, high stability, low immunogenicity, and strong tissue penetration, and are widely used in the development of therapeutic antibody drugs, diagnostic reagents, affinity purification matrices, and scientific research. Therefore, developing nanobodies with broad-spectrum anti-AAV virus serotypes has significant application value. Summary of the Invention

[0005] To address the lack of broad-spectrum anti-adeno-associated virus (AAV) nanobodies in existing technologies, this invention provides multiple nanobodies capable of specifically and sensitively binding to different serotypes of AAV virus, showing promising application prospects in AAV immunoassay and affinity purification.

[0006] To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:

[0007] The first aspect of this invention provides nanobodies against different serotypes of adeno-associated virus (AAV), wherein the nanobodies are selected from at least one of Nb1 to Nb24; wherein: the amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb1-Nb8 are as shown in positions 26-33, 51-57, and 96-112 of SEQ ID NO. 1-8, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb9-Nb14 are as shown in positions 26-33, 51-57, and 96-113 of SEQ ID NO. 9-14, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb15-Nb22 are as shown in positions 26-33, 51-58, and 97-114 of SEQ ID NO. 15-22, respectively; and the amino acid sequences of CDR1, CDR2, and CDR3 of nanobodies Nb23 are as shown in SEQ ID NO. 1-24, respectively. The amino acid sequences of CDR1, CDR2 and CDR3 of nanobody Nb24 are shown in positions 26-32, 50-57 and 96-113 of SEQ ID NO.20.

[0008] Furthermore, the amino acid sequences of the heavy chain variable regions of nanobodies Nb1 to Nb24 are shown in SEQ ID NO.1-24, respectively.

[0009] Furthermore, the nanobody is selected from at least one of Nb1 to Nb14.

[0010] Furthermore, the nanobody is selected from at least one of Nb15 to Nb24.

[0011] Furthermore, the nanobody is selected from Nb10.

[0012] A second aspect of the present invention provides a nucleic acid molecule that encodes the nanobody.

[0013] A third aspect of the present invention provides a recombinant vector comprising the nucleic acid molecules described above.

[0014] A fourth aspect of the present invention provides a host cell comprising the recombinant vector as described above.

[0015] The fifth aspect of the present invention provides the application of the nanobodies against different serotypes of adeno-associated virus as described above in the preparation of adeno-associated virus detection kits or purification kits.

[0016] Furthermore, the adeno-associated virus is AAV2, AAV5, AVV8, or AAV9.

[0017] The sixth aspect of the present invention provides an adeno-associated virus (AAV) detection kit, comprising nanobodies against different serotypes of AAV as described above.

[0018] A seventh aspect of the present invention provides an adeno-associated virus purification kit, comprising nanobodies and solid-phase carriers for different serotypes of adeno-associated virus as described above.

[0019] The advantages and positive effects of this invention are as follows:

[0020] The nanobodies provided by this invention can sensitively and specifically bind to AAV, exhibiting excellent broad-spectrum recognition and binding ability for multiple serotypes such as AAV2, AAV5, AAV8, and AAV9. They can be used in the field of AAV immunoassay, achieving sensitive and efficient detection of viral titers. Furthermore, using the nanobodies coupled to a solid-phase carrier as an affinity packing material, they demonstrate good adsorption capacity for AAV and excellent resolution under elution conditions, showing promise for application in AAV affinity chromatography to improve virus purification and recovery. This invention provides a superior antibody tool for the large-scale production and development of AAV viruses and vectors, enabling the separation, purification, identification, and titer detection of antibodies. When producing products of different AAV serotypes, it can reduce the frequency of changing detection and / or purification antibodies, improving the versatility, flexibility, and efficiency of the production process, significantly reducing production costs, and possessing significant market potential in large-scale AAV vector production and gene therapy. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 This is a chromatography image of the AAV2 virus loading solution purified by Nb10 nanobody coupled with affinity packing material in Example 3 of the present invention.

[0023] Figure 2 This is a chromatography image of the AAV5 virus loading solution purified by Nb10 nanobody coupled with affinity packing material in Example 3 of the present invention.

[0024] Figure 3 This is a chromatography image of the AAV8 virus loading solution purified by Nb10 nanobody coupled with affinity packing material in Example 3 of the present invention.

[0025] Figure 4 This is a chromatography image of the AAV9 virus loading solution purified by Nb10 nanobody coupled with affinity packing material in Example 3 of this invention;

[0026] Figure 5 The results of SDS-PAGE silver staining detection of AAV2, AAV5, AAV8, and AAV9 viruses purified by Nb10 nanobody-conjugated affinity packing material in Example 3 of this invention are shown. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are merely illustrative and not intended to limit the invention. Based on the information contained in this invention, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims; it should be understood that various changes to the embodiments of this invention that are readily apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0028] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0029] In addition, unless otherwise defined, the scientific and technical terms used in this invention have the meanings commonly understood by those skilled in the art.

[0030] The terms “including,” “comprising,” “containing,” “having,” and similar words are non-restrictive and can include other steps and components that do not affect the result. The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B. The terms “Nb1,” “Nb2,” “Nb3,” etc., are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence; it should be understood that such use is interchangeable where appropriate.

[0031] The terms "adeno-associated virus," "AAV," and "AAV vector," etc., have the same meaning in this invention. Adeno-associated virus (AAV) is widely found in nature. Its genome is a single-stranded linear DNA with an inverted terminal repeat (ITR) at each end. The coding region of the genome has two open reading frames (ORFs), upstream and downstream, encoding the Rep and Cap proteins, respectively, which play roles in genome replication, viral assembly, and packaging. AAV viruses are non-enveloped. Their surface is composed of capsid proteins VP1, VP2, and VP3 aggregated in an icosahedral configuration in a 1:1:10 ratio, forming spiky projections. These projections mediate the recognition of glycosylated receptors on the target cell surface. Therefore, the AAV capsid proteins determine the tissue-targeting specificity and cell-penetrating ability of different types of AAV. Different mutants of the capsid protein produce different AAV subtypes, which can be classified into different serotypes based on serological test results. Currently, there are 13 AAV serotypes (AAV1-AAV13); AAV2, AAV5, AAV8, and AAV9 are widely used serotypes in research. Serotype determination is usually based on the reactivity between an antibody and an AAV, while lacking cross-reactivity with other AAVs. This difference in cross-reactivity is usually due to differences in the capsid protein sequence / antigenic epitopes. Due to its advantages such as wide host range, high safety, low immunogenicity, stable expression, and high transduction efficiency, adeno-associated virus (AAV) has been widely used in basic research and gene therapy, becoming one of the most commonly used gene delivery vectors. AAV vectors are artificially modified from wild-type AAV, replacing the coding region gene sequence with the target gene and related functional fragments, retaining only the two ITR sequences; therefore, they are also called recombinant adeno-associated virus (rAAV). After AAV vectors infect cells, their capsid proteins first bind to specific receptors on the cell surface and enter the cell through receptor-mediated endocytosis. Subsequently, the capsid proteins are degraded by the proteasome, the AAV virus uncoats and releases its single-stranded genome, which is then converted into a double-stranded DNA template. Transcription and translation of transgenes occur on the double-stranded DNA template, thereby achieving the expression of the target gene.

[0032] In recent years, gene delivery technology using AAV vectors has made significant progress, leading to a continuously increasing demand for AAV production. The detection and purification of AAV viruses are crucial processes in AAV production. Furthermore, in the field of gene therapy, accurate determination of AAV titers and improvement of AAV purity are important components of quality control for gene therapy drugs. Currently, these processes are mostly achieved through antibody-based immunoassay techniques and affinity chromatography purification techniques. However, current research on anti-AAV antibodies is limited, and most antibodies can only recognize a single serotype, requiring different antibodies for different AAV serotypes, which significantly increases production and application costs. Therefore, developing new, specific antibodies targeting adeno-associated viruses that can bind to multiple AAV serotypes, especially broad-spectrum antibodies such as clinically commonly used serotypes AAV2, AAV5, AAV8, and AAV9, particularly nanobodies, is of great significance for large-scale AAV vector production and clinical application.

[0033] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, unless otherwise specified, the term "antibody" shall be interpreted in the broadest sense and shall include various antibody structures, including but not limited to so-called full-length antibodies, antigen-binding fragments of full-length antibodies, or nanobodies, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity.

[0034] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts are relatively constant. The regions with significant amino acid sequence variation near the N-terminus in both the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0035] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the IMGT numbering system.

[0036] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as involvement in antibody-dependent cytotoxicity. The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art and can be obtained by searching the IMGT database.

[0037] An "antigen-binding fragment" of an antibody molecule is one or more parts or fragments of a full-length antibody that retain substantially the same biological function or activity as the full-length antibody. Specifically, the antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen, especially the same epitope, as the full-length antibody. Typical examples of antibody fragments include: Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art. For example, IgG can be degraded into two Fab fragments and one Fc fragment by papain; IgG can be degraded into one F(ab')2 fragment and one pFc' fragment by pepsin. The F(ab')2 fragment is further reduced to form two Fab' fragments. The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It is a dimer (VH-VL dimer) formed by the non-covalent binding of the variable regions of one light chain and one heavy chain. An antigen-binding site is formed on the surface of the VH-VL dimer, enabling it to recognize and bind antigens. Single-chain variable fragments (scFv) are composed of one VH and one VL linked by a flexible linker. They can better retain their affinity activity for antigens, and compared with full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.

[0038] The terms "single-domain antibody," "VHH," and "nanobody" have the same meaning in this invention, referring to an antibody composed of only one heavy chain variable region, capable of specifically recognizing and binding to antigens (AAVs). During long-term evolution, the immune systems of some camels have developed heavy-chain antibodies (HCAbs) that lack the light chain and heavy chain CH1 structure but fully retain antigen-binding activity. The region where HCAbs specifically bind to antigens is their variable domain of heavy chain (VHH). The VHH has a molecular weight of approximately 15 kDa, only 1 / 10 the mass of a full-length antibody molecule. Therefore, this antibody containing only one VHH is also called a nanobody (Nb), which is the smallest antigen-binding fragment with complete function. Nb contains four FR regions and three CDR regions, and its interaction with the antigen is mediated by the three CDR loops. Compared to traditional antibodies, Nb has advantages such as small molecular weight, simple structure, low immunogenicity, small size, strong tissue penetration, good hydrophilicity, and high stability. In addition, Nb is relatively easy to produce and purify, and can be produced through prokaryotic or eukaryotic expression systems, making it suitable for large-scale industrial production.

[0039] The antibodies of this invention can be prepared using methods conventional in the art, such as hybridoma technology, phage display technology, yeast display technology, single-cell screening, or single-cell sequencing technology well-known in the art. Alternatively, based on recombinant expression technology, the various antibody genes of this invention can be transformed into suitable host cells and heterologously expressed to obtain the various antibodies of this invention.

[0040] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.

[0041] The term "broad spectrum" refers to the antibody's ability to recognize and bind to multiple AAV sera, especially the clinically commonly used AAV2, AAV5, AAV8, and AAV9 sera.

[0042] To make the above-mentioned objects, features and advantages of the present invention readily apparent, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0043] This invention provides nanobodies against different serotypes of adeno-associated virus (AAV). The nanobodies are selected from any one of Nb1 to Nb24, and each nanobodies comprises three complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3, respectively.

[0044] The amino acid sequences of CDR1, CDR2 and CDR3 of nanobodies Nb1-Nb8 are shown in positions 26-33, 51-57 and 96-112 of SEQ ID NO.1-8, respectively;

[0045] The amino acid sequences of CDR1, CDR2 and CDR3 of nanobody Nb9-Nb14 are shown in positions 26-33, 51-57 and 96-113 of SEQ ID NO.9-14, respectively;

[0046] The amino acid sequences of CDR1, CDR2 and CDR3 of nanobody Nb15-Nb22 are shown in positions 26-33, 51-58 and 97-114 of SEQ ID NO.15-22, respectively;

[0047] The amino acid sequences of CDR1, CDR2 and CDR3 of nanobody Nb23 are shown in positions 25-32, 50-57 and 96-113 of SEQ ID NO.20;

[0048] The amino acid sequences of CDR1, CDR2 and CDR3 of nanobody Nb24 are shown in positions 26-32, 50-57 and 96-113 of SEQ ID NO.20.

[0049] The nanobodies provided by this invention can sensitively and specifically bind to AAV, exhibiting excellent broad-spectrum recognition and binding ability for multiple serotypes, including AAV2, AAV5, AAV8, and AAV9. They can be used in the field of AAV immunoassay, achieving sensitive and efficient detection of viral titers. Furthermore, using the nanobodies coupled to a solid-phase carrier as an affinity packing material, they demonstrate good adsorption capacity for AAV and excellent resolution under elution conditions, showing promise for application in AAV affinity chromatography to improve virus purification and recovery. This invention provides a superior antibody tool for the large-scale production and development of AAV viruses and vectors, enabling the separation, purification, identification, and titer detection of antibodies. When producing products of different AAV serotypes, it can reduce the frequency of changing detection and / or purification antibodies, improving the versatility, flexibility, and efficiency of the production process, significantly reducing production costs, and possessing significant market potential in large-scale AAV vector production and gene therapy.

[0050] Optionally, the nanobody further includes four framework regions (FR1, FR2, FR3, and FR4 in sequence), with the four FRs and three CDRs arranged alternately to form the heavy chain variable region (VHH) of the nanobody. The amino acid sequences of the heavy chain variable regions of nanobodies Nb1 to Nb24 are shown in SEQ ID NO. 1-24, respectively.

[0051] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the aforementioned nucleic acid molecule, or a host cell containing the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes a nanobody as described above.

[0052] Nucleic acid molecules can be in the form of DNA (e.g., cDNA, genomic DNA, or synthetic DNA) or RNA (e.g., mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand. The sequence of a nucleic acid molecule can be derived from the amino acid sequence of the antibody using conventional methods such as codon coding rules.

[0053] Nucleic acid molecules can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand. The sequence of a nucleic acid molecule can be derived from the amino acid sequence using conventional methods such as codon coding rules. The full-length sequence of a nucleic acid molecule or its fragments can usually be obtained using PCR amplification, recombination, or artificial synthesis.

[0054] The original vector used to construct the recombinant vector is any vector conventional in the art, as long as it can contain the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, bacteriophages (such as λgt4λB, λCharon, λΔz1, and M13), granules, and mini-chromosomes. Plasmids are the most common form of vector; therefore, in the context of this invention, vectors and plasmids are used interchangeably. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules into a host and multiply them in host cells) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). Inserting nucleic acid molecules into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule is a well-known technique in the art.

[0055] Recombinant vectors can be introduced into host cells using conventional techniques well-known to those skilled in the art. When the host is a prokaryote such as *E. coli*, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2 or MgCl2; alternatively, microinjection, electroporation, or liposome packaging can be used. When the host is a eukaryote, the following DNA transfection methods can be used to achieve gene introduction: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or gene gun bombardment.

[0056] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in this invention include, but are not limited to, *Escherichia coli* (e.g., DH5α, JM109, BL21, W3110, SHuffle T7), *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus thuringiensis*), *Enterobacterium* strains (e.g., *Salmonella typhimurium*, *Serratia marcescens*), and *Pseudomonas* spp. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHODG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining host cells transfected or transformed with the recombinant vector described above, they can be cultured under suitable conditions to express antibodies, which can then be isolated to obtain purified antibodies.

[0057] In a preferred embodiment, the recombinant vector described above is the prokaryotic expression vector PET25b, and the host cell is *E. coli* cells, such as *E. coli* Rosetta (DE3). The antibody preparation method includes loading the heavy chain variable region coding gene of the antibody between the NcoI and NheI restriction sites of the expression vector PET25b, transforming *E. coli* Rosetta (DE3), then inducing and culturing the recombinant *E. coli* cells, collecting the cell culture supernatant, and purifying to obtain the target antibody strain. The purification method employs conventional methods in the art, such as ion chromatography and affinity chromatography.

[0058] The present invention also provides the application of the nanobodies against different serotypes of adeno-associated virus as described above in the preparation of adeno-associated virus detection kits or purification kits.

[0059] The nanobody of this invention exhibits specificity and high affinity binding to AAV virus, enabling the capture of AAV virus particles in solution and achieving efficient, accurate, and sensitive detection of the virus. Furthermore, based on its ability to bind to AAV virus, it can be used as an affinity packing material to adsorb AAV virus, after which purified virus particles can be obtained through elution.

[0060] When used for AAV detection, the nanobody can be conjugated with a detection label. The nanobody of this invention is then used to bind to the AAV antigen in the sample to be tested. Qualitative or quantitative detection of AAV is then achieved by analyzing the identifiable signal generated by the detection label. In other embodiments, the anti-human AAV nanobody is not labeled (as a primary antibody or capture antibody), but the detection label is conjugated with a secondary antibody (detection antibody) or other molecules that can bind to the primary antibody. This allows for the specific binding of the primary antibody to the secondary antibody with the detection label, thereby generating a change in the identifiable signal, as exemplified by the enzyme-linked immunosorbent assay (ELISA) system established in Example 2 of this invention.

[0061] The aforementioned detection markers used to generate identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as isophycocyanin, phycoerythrin, PerCP, and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, and avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies, or combinations thereof. Detection methods include, but are not limited to: enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence assay (IF), Western blotting (WB), immunoprecipitation assay (IP), and flow cytometry (FC).

[0062] When used for purifying AAV, the nano-antibody of the present invention is coupled with a solid-phase support to prepare an affinity packing. The affinity packing is then contacted with the sample solution to adsorb AAV virus particles in the solution. Subsequently, the solid-phase support is separated from the sample and the adsorbed AAV is eluted.

[0063] The solid-phase carriers mentioned above include, but are not limited to: polymer microspheres, agarose gel microspheres, cellulose spheres, silica microspheres, magnetic microspheres, dextran, activated carbon, or resin microspheres.

[0064] Optionally, the adeno-associated virus is AAV2, AAV5, AVV8, or AAV9.

[0065] When detecting AAV5, AVV8, and AAV9, preferably, the nanobody is selected from at least one of Nb1 to Nb14.

[0066] When detecting AAV2, AAV5, AVV8, and AAV9, preferably, the nanobody is selected from at least one of Nb15 to Nb24.

[0067] When purifying AAV2, AAV5, AVV8, and AAV9, the nanobody is preferably selected from Nb10.

[0068] Based on the same inventive concept described above, embodiments of the present invention also provide an adeno-associated virus (AAV) detection kit, comprising nanobodies against different serotypes of AAV as described above.

[0069] In addition, embodiments of the present invention also provide an adeno-associated virus purification kit, comprising nanobodies against different serotypes of adeno-associated virus and a solid-phase carrier as described above.

[0070] The invention is further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Cold Spring Harbor Laboratory's *Molecular Cloning: A Laboratory Manual (Fourth Edition)* or as recommended by the manufacturer.

[0071] Example 1: Preparation of anti-adeno-associated virus (AAV) nanobodies

[0072] In this embodiment, alpaca were immunized with a mixture of AAV2, AAV5, AAV8, and AAV9 viruses at different titers. Specific B lymphocytes were then isolated from the peripheral blood of the antigen-immunized alpaca, and mRNA was extracted and reverse transcribed to generate cDNA. The VHH gene was amplified by PCR using VHH-specific primers and cloned into a phage display expression vector to generate a library. Finally, the target antibody strains (Nb1-Nb24) were obtained through antigen binding experiments and other screening methods.

[0073] In the subsequent large-scale production of nanobodies, the VHH gene molecule obtained in the aforementioned process is constructed into an expression vector, and then transformed into host cells to express the nanobodies of this invention in large quantities. Antibody sequencing was performed by Suzhou Genewiz Co., Ltd., and the amino acid (AA) sequence of the antibody is shown in Table 1. In the table, CDR1-3 represent complementarity-determining regions CDR1-3, respectively. The antibody amino acid sequence is divided based on the IMGT numbering rules.

[0074] Table 1 Summary of nanobody sequence information in embodiments of the present invention

[0075]

[0076]

[0077]

[0078] 1.1 Alpaca Immunization and B Lymphocyte Isolation

[0079] A mixture of titers of AAV2, AAV5, AAV8, and AAV9 viruses was administered subcutaneously to multiple sites in the neck of an adult healthy alpaca for immunization. The immunization dose was 1 × 10⁻⁶ per alpaca. 11One viral particle (VP) was administered for a total of three immunizations, with an interval of two weeks between immunizations. After immunization, 50 mL of peripheral blood was collected from the alpaca, and B lymphocytes were isolated using lymphocyte separation medium (purchased from Solarbio, catalog number P8900).

[0080] 1.2 Construction of Nanobody Phage Display Library

[0081] Using TRIzol TM Total RNA was extracted from B lymphocytes using the Reagent kit (Thermo Fisher, catalog number 15596018), and cDNA was obtained by reverse transcription. This cDNA was then used as a template for nested PCR amplification of the VHH gene. Taq polymerase (TAKARA, catalog number R001A) was used for PCR, and the PCR program was set according to the Taq instructions. The amplified VHH gene fragment and the phage display vector pComb 3XSS were digested with Sfil restriction endonuclease. The digested VHH gene fragment and the linearized vector pComb 3XSS were then ligated using T4 DNA ligase. The ligation product was recovered and electroporated into *E. coli* TG1 competent cells to obtain a nanobody phage screening library. The library size was determined to be 1.83 × 10⁻⁶ cells using the plate serial dilution method. 9 The cloning efficiency of the target gene insertion vector was 98%.

[0082] The first round primers for nested PCR were F1: 5'-CTTGGTGGTCCTGGCTGC-3' (see SEQ ID NO.25) and R1: 5'-GGTACGTGCTGTTGAACTGTTCC-3' (see SEQ ID NO.26); the second round primers were F2: 5'-CATGCCATGACTGTGGCCCAGGCGGCCCAGKTGCAGCTCGTGGAGTC-3' (see SEQ ID NO.27), R2: 5'-CATGCCATGACTCGCGGCCGGCCTGGCCATGGGGGTCTTCGCTGTGGTGCG-3' (see SEQ ID NO.28) and R3: 5'-CATGCCATGACTCGCGGCCGGCCTGGCCGTCTTGTGGTTTTGGTGTCTTGGG-3' (see SEQ ID NO.29).

[0083] 1.3 Phage Library Enrichment and Screening

[0084] (1) First round of screening: AAV5 virus was coated onto microplates at a dose of 100 μL / well, with a virus coating dose of 1 × 10⁻⁶. 11The microplate was coated overnight at 4°C with vp / mL, and blocked the next day with 1% bovine serum albumin (BSA). The microplate was washed with PBST. 100 μL of the constructed nanobody phage display library was added and incubated at 37°C for 1 h. Unbound library was then removed, and the microplate was washed with PBST and PBS. 100 μL of Gly-HCl buffer (pH 2.2) was added to the microplate to dissociate the specific phage. After gentle shaking for 10 min, the eluent was collected. The eluent was used to infect E. coli TG1 in the logarithmic growth phase. A small amount of infected E. coli TG1 was used to determine the titer of the eluent using a plate gradient dilution method. The remainder was amplified to obtain an anti-AAV5 specific phage enrichment library.

[0085] (2) Second round of screening: The same operation as in “(1) First round of screening” was used, except that the coated virus was AAV8. 100 μL of the enriched library obtained in the first round of screening was combined with a microplate coated with AAV8 virus. After elution and PCR library expansion, a phage enriched library specific to AAV5 and AVV8 was obtained.

[0086] (3) Third round of screening: The same operation as in “(1) First round of screening” was used, except that the coated virus was AAV2. 100 μL of the enriched library obtained in the second round of screening was combined with a microplate coated with AAV2 virus. After elution and PCR library expansion, a phage enriched library specific to AAV2, AAV5 and AVV8 was obtained.

[0087] (4) Fourth round of screening: The same operation as in “(1) First round of screening” was used, except that the virus coating was AAV9. 100 μL of the enriched library obtained in the third round of screening was combined with a microplate coated with AAV9 virus. After elution and PCR library expansion, a broad-spectrum and specific phage enriched library against AAV2, AAV5, AVV8 and AAV9 was obtained.

[0088] The phage-enriched library obtained from the fourth round of screening was used to infect E. coli TG1. Single clones were randomly picked from the culture dishes used for titer determination and inoculated into 2 mL deep-well plates, and incubated at 30°C until OD500. 600 Approximately 0.5 μL of IPTG was used to induce VHH expression at a final concentration of 4 mM. The bacterial culture supernatant containing the nanobodies was collected by centrifugation. The specific responses of the antibodies to the antigens AAV2, AAV5, AVV8, and AAV9 were identified using enzyme-linked immunosorbent assay (ELISA), including the following steps: coating with 1 × 10⁻⁶ ppm of IPTG. 11AAV2 virus at vp / mL was injected, followed by blocking with 5% skim milk, and then appropriate dilution of the induction expression supernatant was added. Binding was incubated at 37°C for 1 h. After washing away unbound antibodies, HRP-conjugated rabbit anti-goat secondary antibody (RabbitAnti-CamelidVHH Cocktail [HRP], purchased from Genscript Biotech Co., Ltd., catalog number A02016) diluted 1:5000 was added, and binding was incubated at 37°C for 1 h. After washing, TMB substrate solution was added for color development, and absorbance was read at 450 nm. Negative controls (without nanobody induction expression supernatant) and blank wells (buffered buffer) were included. A positive result was defined as an OD value in the test well greater than 3 times that of the negative control.

[0089] Clones corresponding to positive wells were selected, preserved, and then their vectors were extracted for sequencing to obtain the VHH coding gene sequence. The DNA sequence was translated into amino acid sequences and compared. Clones with identical CDR1, CDR2, and CDR3 sequences were considered the same antibody strain, while clones with different CDR sequences were considered different antibody strains. The detection results of positive clones are shown in Table 2, and the corresponding antibody sequences are shown in Table 1.

[0090] Table 2. Reactivity of nanobody phage display libraries against AAVx viruses (x = 2, 5, 8, or 9)

[0091]

[0092] 1.4 Large-scale production of anti-AAVx (x = 2, 5, 8 or 9) nanobodies

[0093] A VHH coding gene fusion sequence with a 6×His tag at the N-terminus was synthesized from the whole genome. The fusion gene was then inserted between the NcoI and NheI restriction sites of the PET25b vector. The resulting expression vector PET25b was transformed into *E. coli* Rosetta (DE3) competent cells to obtain a VHH-expressing recombinant strain. The recombinant strain was inoculated at a 1% inoculum in LB medium containing 50 μg / mL ampicillin (Amp) and cultured at 37°C with shaking until OD600 = 0.8. 0.5 mM IPTG was added, and the culture was induced at 22°C and 200 rpm for 16 h. After centrifugation and discarding the supernatant, the bacterial cells were resuspended in 20 mL of PBS (20 mM, pH = 7.4) buffer, centrifuged again, and the supernatant was discarded. The washed bacterial blocks were resuspended in 20 mL of PBS, sonicated for 3-5 min to disrupt the bacterial suspension until the solution became clear, and then centrifuged at 10000 rpm for 20 min to separate the supernatant. The supernatant was then separated by passing the supernatant through a nickel column (SC-Ni). NTAFF column packing material (from Shangchun Biotechnology (Wuhan) Co., Ltd., catalog number SCB0E005B) was used to purify cell-lysed supernatant. The sample was washed with 10 column volumes (CV) of washing buffer (PBS + 10 mM imidazole), followed by 2 CV of elution buffer (PBS + 250 mM imidazole) to elute the target protein. The eluted sample was dialyzed in PBS buffer at 4°C for 16 h, and then concentrated to 2 mL using a 3 kDa ultrafiltration tube to obtain the purified nanobody. Protein concentration was determined using the BCA method, and purity was assessed by SDS-PAGE. The antibody purity was >95%.

[0094] Example 2: Binding ability test of nanobody to AAVx (x = 2, 5, 8 or 9)

[0095] The specific binding ability of antibodies to antigens AAV2, AAV5, AVV8, and AAV9 viruses was identified using ELISA, including the following steps: diluting AAVx (x = 2, 5, 8, or 9) viruses to 1 × 10⁻⁶. 11 Vp / mL, 100 μL / well, was used to coat 96-well plates; then, 5% skim milk was used for blocking; serially diluted nanobody (primary antibody) solution was added, and the plates were incubated at 37°C for 1 h; after primary antibody incubation, the 96-well plates were washed with PBST, and then 1:5000 diluted HRP-conjugated rabbit anti-goat secondary antibody (Rabbit Anti-Camelid VHH Cocktail [HRP]) was added, and the plates were incubated at 37°C for 1 h; after washing with PBST, TMB substrate solution was added for color development for 15 min, and color development was stopped with 2M H2SO4. The absorbance was read at 450 nm. The half-maximal effective concentration (EC50) of the nanobody was calculated. 50 (Unit: ng / mL), the results are shown in Table 3.

[0096] Table 3. Binding ability test of nanobodies to AAVx virus (x = 2, 5, 8 or 9)

[0097] serial number Antibody strain <![CDATA[AVV2EC 50 ]]> <![CDATA[AVV5EC 50 ]]> <![CDATA[AVV8EC 50 ]]> <![CDATA[AVV9EC 50 ]]> SC007 Nb1 ＞1000 33.3 17.4 18.9 SC080 Nb2 ＞1000 24.2 13.2 13.5 SC017 Nb3 ＞1000 43.0 20.7 22.4 SC043 Nb4 ＞1000 53.4 25.1 33.0 SC079 Nb5 ＞1000 66.9 78.2 46.3 SC013 Nb6 775.7 21.3 57.5 54.0 SC044 Nb7 ＞1000 103.1 62.4 78.8 SC081 Nb8 ＞1000 26.4 11.5 17.4 SC016 Nb9 ＞1000 58.2 103.1 102.4 SC015 Nb10 ＞1000 73.7 356.4 574.7 SC014 Nb11 ＞1000 189.4 243.7 369.1 SC025 Nb12 ＞1000 99.9 148.7 222.3 SC078 Nb13 ＞1000 198.2 84.4 136.7 SC012 Nb14 ＞1000 156.2 62.8 112.2 SC067 Nb15 399.4 701.7 214.3 267.8 SC068 Nb16 305.7 643.9 158.4 187.3 SC069 Nb17 224.7 611.7 105.9 112.7 SC070 Nb18 292.3 581.7 124.8 197.9 SC071 Nb19 304.1 596.3 247.5 310.0 SC076 Nb20 249.2 589.1 122.0 174.3 SC074 Nb21 261.2 705.1 128.3 156.7 SC073 Nb22 301.3 699.0 175.2 193.4 SC072 Nb23 265.1 609.4 132.8 139.2 SC075 Nb24 282.3 607.8 164.2 193.1

[0098] Note: >1000 indicates weak binding and EC could not be accurately measured. 50 .

[0099] As shown in Table 2, the nanobodies provided by this invention have broad-spectrum binding ability with AAV2, AAV5, AVV8, and AAV9 viruses. Among them, nanobodies Nb1-Nb14, especially Nb1-Nb9, have stronger binding ability to AAV5, AVV8, and AAV9 serotypes, and their EC5 binding capacity is higher. 50 The binding ability of nanobodies is generally low, with weak binding ability to AAV2 serotype. The binding ability of nanobodies Nb15-Nb24 to AAV2, AVV8 and AAV9 serotypes is strong, while the binding ability to AAV5 serotype is moderate.

[0100] Example 3: Preparation of nanobody affinity packing material and testing of its purification performance for AAVx (x = 2, 5, 8, or 9)

[0101] The nanobody of the present invention can specifically bind to AAV, and when coupled to a solid-phase support, an affinity packing material can be prepared for the purification of AAV. Specifically, it includes: (1) Preparation of pre-activated affinity packing material: Take 2g of NHS 4FF pre-activated agarose (packing material from Shangchun Biotechnology (Wuhan) Co., Ltd., catalog number SCB0E009), and wash it three times with pre-cooled 1mM hydrochloric acid (0-4℃), each wash lasting at least 10min; (2) Preparation of nanobody solution: Replace the purified nanobody solution with a 3KDa ultrafiltration membrane (from Hangzhou Kebote Filter Material Co., Ltd., model UFELA0003001P) into the coupling buffer, and determine the protein concentration by BCA protein quantification method. The coupling buffer is selected according to the activated packing material. In this example, sodium bicarbonate buffer (pH 8.5) is used; (3) Nanobody coupling affinity packing material: Add 2g of NHS 4FF affinity packing material to 6mL of nanobody solution. The mass ratio of packing material to nanobody is 1g:10mg. React at 28℃ and 250rpm for 3.5h. After the reaction, use 1M ethanolamine (pH 8.5) to remove the residue. 8.0) Overnight blocking to obtain AAV affinity packing material with conjugated nanobodies; (4) Preparation of AAV virus loading solution: The AAV virus harvested liquid obtained after fermentation was lysed using Tween-20 and nuclease was added for incubation. The fermentation liquid after incubation was filtered through a 0.22 μm filter membrane to obtain AAV supernatant. The supernatant was concentrated and replaced with ultrafiltration membrane to make the AAV sample after replacement consistent with the affinity packing equilibration solution. The sample after replacement was filtered through a 0.22 μm filter membrane, and the filtrate was collected as the loading solution for the affinity packing material; (5) Purification of AAV virus affinity packing material: 1 mL of AAV affinity packing material was loaded into the chromatography column, and AAV2, AAV5, AAV8, and AAV9 virus loading solutions were used for loading to detect the purification effect; Before purification, the chromatography column was equilibrated with PBS equilibration solution. After loading, the column was equilibrated with citric acid (pH 2.5) and phosphoric acid (pH 2.5) respectively. 1.9) A 4M guanidine hydrochloride elution column was used, and the viral genome titer in the eluted sample was detected by qPCR. The AAV purification yield was calculated based on the viral genome titer before and after sample purification. The recovery rate was calculated as the percentage of viral genome titer in the purified sample relative to the viral genome titer in the loading solution. Simultaneously, the purity of the eluted sample was determined by SDS-PAGE silver staining.

[0102] The qPCR procedure is as follows: Dilute the sample 10:100 with purified water, then take 200 μL of the diluted sample for double enzyme treatment with nuclease and proteinase K. After treatment, the sample is further diluted appropriately to prepare the qPCR system and perform qPCR detection. The qPCR system includes: 0.3 μL of forward primer (10 μM), 5 μL of iTaq UniversalSYBR Green Supermix (Bio-Rad, catalog number 1725125), and purified water to a final volume of 8 μL. The qPCR reaction program is: 95℃ for 3 min; 95℃ for 10 s; 60℃ for 30 s, for a total of 40 cycles. The primers are as follows:

[0103] QF: CCGTTGTCAGGCAACGTG (see SEQ ID NO. 30);

[0104] QR: AGCTGACAGGTGGTGGCAAT (see SEQ ID NO. 31).

[0105] The nanobodies of this invention have similar properties. Taking SC015 (antibody strain Nb10) as an example, it was prepared into an AAV affinity filler and a series of tests were conducted. Figure 1-4 The chromatograms of AAV2, AAV5, AAV8, and AAV9 virus loading solutions purified using the affinity packing material conjugated with the nanobody Nb10 of this invention are shown. Red represents the absorbance curve at 260 nm, and blue represents the absorbance curve at 280 nm. Tables 4-7 show the qPCR detection results of AAV2, AAV5, AAV8, and AAV9 viruses purified using the affinity packing material conjugated with the nanobody Nb10 of this invention. AC-Load represents the sample containing adeno-associated virus before purification; this sample has been clarified, filtered, and the buffer has been changed to the PBS equilibration solution used in the purification step. AC-FT represents the flow-through buffer used in the purification step, and AC-E represents the virus elution buffer used in the purification step. Most of the purified virus will be eluted in citric acid (pH 2.5) elution buffer. AC-CIP represents the elution buffer after the chromatography column has been regenerated by washing with guanidine hydrochloride in the purification step. Figure 5 The results of SDS-PAGE silver staining detection of AAV2, AAV5, AAV8, and AAV9 viruses purified by affinity packing material conjugated with the nanobody Nb10 of the present invention are shown. In the diagram, lane markers represent molecular markers, the sample loading solution in the lane is the sample containing adeno-associated virus before purification, the flow-through solution in the lane is the flow-through solution in the purification step, and the collection solution in the lane is the virus elution solution in the purification step.

[0106] Table 4. qPCR detection results of AAV2 virus purified by Nb10 nanobody-conjugated affinity packing material.

[0107] Sample Name Virus titer volume Total virus count Recovery rate AAV2AC-Load 7.54E+12 18 1.36E+14 N / A AAV2AC-FT 5.25E+11 32.16 1.69E+13 12.44％ AAV2AC-E 7.72E+12 6.95 5.36E+13 39.49％ AAV2AC-CIP 3.98E+12 4.12 1.64E+13 12.07％

[0108] Table 5. qPCR detection results of AAV5 virus purified by Nb10 nanobody-conjugated affinity packing material.

[0109] Sample Name Virus titer volume Total virus count Recovery rate AAV5AC-Load 8.08E+12 19.50 1.57E+14 N / A AAV5AC-FT 5.37E+11 33.61 1.80E+13 11.45％ AAV5AC-E 6.69E+12 13.38 8.95E+13 56.84％ AAV5AC-CIP 3.46E+12 7.67 2.65E+13 16.85％

[0110] Table 6. qPCR detection results of AAV8 virus purified by Nb10 nanobody-conjugated affinity packing material.

[0111] Sample Name Virus titer volume Total virus count Recovery rate AAV8AC-Load 9.75E+12 19.5 1.90E+14 N / A AAV8AC-FT 6.85E+11 33 2.26E+13 11.89％ AAV8AC-E 1.01E+13 10.9 1.10E+14 57.86％ AAV8AC-CIP 4.26E+12 2.49 1.06E+13 5.58％

[0112] Table 7. qPCR detection results of AAV9 virus purified by Nb10 nanobody-conjugated affinity packing material.

[0113] Sample Name Virus titer volume Total viral load Recovery rate AAV9AC-Load 7.38E+12 15 1.11E+14 N / A AAV9AC-FT 4.62E+10 39.751 1.84E+12 1.66％ AAV9AC-E 2.47E+13 4.112 1.02E+14 91.80％ AAV9AC-CIP 4.08E+12 1.878 7.66E+12 6.92％

[0114] Note: E represents a power with base 10. For example, 7.54E+12 means 7.54 × 10⁻¹². 12 .

[0115] from Figure 1-5 As shown in Table 4-7, Nb10 coupled affinity packing material can be used to purify AAV2, 5, 8, and 9 viruses. During the purification process, the virus can be captured and eluted very gently. The purified virus has high purity and high yield, confirming that the nanobody Nb10 can be used for affinity purification of viruses.

[0116] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A nanobody against different serotypes of adeno-associated virus, characterized in that, The nanobody is selected from one of Nb1 to Nb8; wherein: The amino acid sequences of CDR1, CDR2 and CDR3 of nanobodies Nb1-Nb8 are shown at positions 26-33, 51-57 and 96-112 of SEQ ID NO.1-8, respectively.

2. The nanobodies against different serotypes of adeno-associated virus according to claim 1, characterized in that, The amino acid sequences of the heavy chain variable regions of nanobodies Nb1 to Nb8 are shown in SEQ ID NO.1-8, respectively.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes nanobodies against different serotypes of adeno-associated virus as described in any one of claims 1-2.

4. A recombinant vector, characterized in that, It includes the nucleic acid molecule as described in claim 3.

5. A host cell, characterized in that, It includes the recombinant vector as described in claim 4.

6. The use of the nanobodies against different serotypes of adeno-associated virus as described in any one of claims 1-2 in the preparation of adeno-associated virus detection kits or purification kits, characterized in that, The adeno-associated viruses mentioned are AAV5, AVV8, and AAV9.

7. An adeno-associated virus (AAV) detection kit, characterized in that, Including nanobodies against different serotypes of adeno-associated virus as described in any one of claims 1-2.

8. An adeno-associated virus purification kit, characterized in that, This includes nanobodies and solid-phase carriers against different serotypes of adeno-associated virus as described in any one of claims 1-2.

Images