Mortierella elongata and application thereof

Abstract

The invention discloses Mortierella elongata and application of the Mortierella elongata, the strain number of the Mortierella elongata is JSAFC 247, the Mortierella elongata is preserved in the China General Microbiological Culture Collection Center (CGMCC) on December 9, 2024, and the preservation number is CGMCC No.41703. The Mortierella elongata has the advantages that the Mortierella elongata can be used for preparing the Mortierella elongata and the application of the Mortierella elongata; the mortierella elongata strain provided by the invention is strong in pathogenicity to larvae of the larvae of the corpulenta aeruginosa, is environment-friendly and pollution-free, is not easy to generate drug resistance, can be used as a living body biopesticide, and has very strong application potential in biological prevention and control of the corpulenta aeruginosa.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology and relates to Mortierella elongata and its application. Background Art

[0002] Anomala corpulenta belongs to the family Rutelidae of Coleoptera and is an important underground pest. It is widely distributed in China and can be found everywhere. It is commonly found in environments such as orchards, farmland greenlands, and forest belts. It harms with adult and larval stages. Adult beetles bite the leaves of trees and crops, causing notches, and larval beetles bite the newly germinated seeds of crop roots, causing seedling shortages and ridges to break, or bite off the base of the plant stem and roots, causing the plant to wither and die.

[0003] The traditional control methods for Anomala corpulenta mainly rely on chemical pesticides. The advantage of chemical pesticides is that they are quick-acting and have obvious effects, suppressing the population density of pests in a short time and protecting agriculture and forestry. However, in the long run, the extensive use of pesticides has caused serious "3R" problems (pesticide residues, pest resistance, and resurgence), and problems such as killing natural enemies and other pollinating insects, destroying the ecological balance and the earth's self-repair ability cannot be ignored. Along with the concept of ecological and healthy development, the research and application of pest biological control technology have been increasingly emphasized. Biological control is the future development trend of pest control methods. It can solve a series of problems caused by chemical pesticides (high toxicity, environmental pollution, killing natural enemies, resistance, and residues), and apply pathogenic microorganisms, sex attractants, food attractants, insect natural enemies, plant-derived pesticides, etc. to pest control, developing precise, efficient, safe, and environmentally friendly green prevention and control new technologies. The research and application of biocontrol bacteria have become a hot spot in the field of biological control. Among them, the main application research mainly focuses on Beauveria bassiana and Metarhizium anisopliae, while the development and utilization of other pest biocontrol bacterial agent resources are less. Summary of the Invention

[0004] Object of the Invention: The object of the present invention is to provide a Mortierella elongata and its application in controlling Anomala corpulenta.

[0005] Technical Solution: The present invention provides a Mortierella elongata, and the strain number of the Mortierella elongata is JSAFC 247, which was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on December 09, 2024, with the deposit number CGMCC No. 41703.

[0006] Furthermore, the nucleotide sequence of the ITS gene of the Mortierella elongata is as shown in SEQ ID NO.1.

[0007] The present invention also provides a biocontrol bacterial agent, and the active ingredient of the biocontrol bacterial agent is the above-mentioned Mortierella elongata.

[0008] The present invention also provides the application of the above-mentioned Mortierella elongata and the biocontrol bacterial agent in controlling Anomala corpulenta.

[0009] Furthermore, the application specifically is to spray the spore suspension of Mortierella elongata JSAFC247 on the larvae of Anomala corpulenta, or on the plants eaten by the larvae of Anomala corpulenta.

[0010] Furthermore, the preparation method of the spore suspension is as follows: (1) Take the strain of biocontrol bacteria Mortierella elongata JSAFC 247, under sterile conditions, pick hyphae with an inoculation needle and inoculate them into the sterilized PDA medium, and culture for 5 days; (2) Under sterile conditions, scrape the hyphae, rinse the hyphae with sterile water and filter with gauze; (3) Under sterile conditions, adjust the spore concentration with sterile water.

[0011] Furthermore, the culture conditions in step (1) are 25°C, 75% humidity, and dark culture.

[0012] Furthermore, the concentration of the spore suspension is 10 8 / ml.

[0013] Beneficial effects: Compared with the prior art, the present invention has the following prominent and remarkable advantages: Through isolation and purification of the soil in Jurong, Jiangsu, 1 strain of Mortierella elongata is obtained in the present application. This strain can be used as a biocontrol strain and has a relatively high lethality rate to Anomala corpulenta and is environmentally friendly, non-toxic, and can significantly inhibit the survival activity of Anomala corpulenta, which has great significance for the future development of biocontrol bacterial agents for controlling Anomala corpulenta. Description of the Drawings

[0014] Figure 1 : Colony morphology diagram of Mortierella elongata JSAFC 247.

[0015] Figure 2 : Phylogenetic tree of Mortierella elongata JSAFC 247.

[0016] Figure 3 : Influence of Mortierella elongata JSAFC 247 on the growth of larvae of Anomala corpulenta. Detailed Embodiments

[0017] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0018] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly bacteria, fungi, and actinomycetes.

[0019] Example 1: Isolation and identification of Mortierella elongata JSAFC 247

[0020] 1. Isolation of Mortierella elongata JSAFC 247

[0021] JSAFC 247 was isolated from soil in Jurong, Jiangsu Province. The characteristics of the colony are as follows: when cultured on PDA plate medium, the colony grows rapidly in a rose-shaped form, and its surface color is light yellow.

[0022] 2. Molecular biological identification of Mortierella elongata JSAFC 247

[0023] (1) The genomic DNA of strain JSAFC 247 was extracted using a kit produced by TIANGEN.

[0024] (2) Amplify the ITS gene of genomic DNA separately. DNA amplification uses a 30 μL reaction volume, including 15 μL 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) of primer pair ITS1 (SEQ ID NO.2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3'), 2 μL template DNA and 11 μL ddHO. 2 O, PCR amplification program conditions are as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 54°C annealing for 45 s, 72°C extension for 60 s, for a total of 35 cycles; and finally 72°C extension for 10 min.

[0025] (3) After the amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light, the PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: The ITS gene sequence of strain JSAFC 247 was SEQ ID NO.1 (GAAGTAAAAAATCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATAATAAGTGTTTTATGGCACTTTTTAAATCCATATCCACCTTGTGTGCAATGTCAGTCGATCTTCTTCATGGAGATCGACCAAACATCAACCTTTATTTTTTAACTCTTTGTCTGAAAAATATTATGAATAAACAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTTTGGTATTCCGAAGAGCATGCTTGTTTGAGTATCAGTAAACACCTCAAAGCTTTTGGATTTTTTAATCGAAAAGCTTTGGACTTGAGCAATCCCAACACCAATCTTTTTGAGATCGGTGGCGGGTTGCTTGAAATGCAGGTGCAGCTGGACATTCTCCTGAGCTAAAAGCATATTCATTTAGTCCCGTCAAACGGATTATTACTTTTGCTGCAGCTAACATAAAGGGAGTTTGACCGTATTGGCTGACTGATGCAGGATTTCACAAGGGTCGGCAACGATTCTTGTTAAACTCGATCTCAAATCAAGTAAGACTACCCGCTGAACTTAAGCATATCAAAAGGCGGAG).

[0026] (4) Align the SEQ ID NO.1 sequence on the NCBI database website and construct a phylogenetic tree. See Figure 2The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacterium JSAFC 247 of the present invention is Mortierella elongata, named Mortierella elongata JSAFC 247. The strain was deposited with the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on December 09, 2024, with the deposit number CGMCC No. 41703, the taxonomic name Mortierella elongata JSAFC 247, and the deposit address being the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen, Chaoyang District, Beijing.

[0027] Table 1 Sequence alignment results of SEQ ID NO.1

[0028]

[0029] Example 2: Determination of the pathogenicity of Mortierella elongata JSAFC 247 to the larvae of Anomala corpulenta

[0030] 1. Preparation of spore suspension

[0031] (1) Use a punch to take a 5 mm diameter mycelium block of the strain Mortierella elongata JSAFC 247 and inoculate it into a 9 cm diameter petri dish (containing 15 ml of PDA medium), and culture it in the dark at 25 °C and 75% humidity for 7 days.

[0032] (2) Under sterile conditions, scrape the mycelium of Mortierella elongata JSAFC 247 cultured for 7 days, rinse the mycelium with sterile water and filter it with gauze, and then adjust the spore concentration to 10 8 / mL.

[0033] 2. Inoculation of test insects

[0034] (1) Raise the larvae of Anomala corpulenta (collected from the fields of Sizhuang Village, Houbai Town, Jurong City) in an artificial climate chamber (temperature 26 ± 1 °C, humidity 80%, light-dark ratio 14:10 light) until they reach the 2nd instar for standby.

[0035] (2) Use sterilized ultrapure water as the negative control to determine the insecticidal activity of JSAFC 247 against Anomala corpulenta.

[0036] (3) Prepare the spore suspension of the above-mentioned JSAFC 247 strain. Take the larvae of Anomala corpulenta, set 3 replicates in each group, with 20 larvae in each replicate. Dip each larva for 30 s, place it on a sterile filter paper, let it crawl to dry the moisture on its body, and then put it into a feeding box filled with sterile soil. Feed the sterilized feed every day, observe and record the infection and death conditions of the larvae every day, and continuously observe for 28 days.

[0037] The experimental results are shown in Table 3 and Figure 3 shown.

[0038] Table 3 Mortality rate of Anomala corpulenta after inoculation with JSAFC 247 (%)

[0039]

[0040] It can be seen from the data in Table 3 that after 28 days of inoculation, the larval mortality rate of the treatment group was significantly higher than that of the control group. The mortality rate of Anomala corpulenta caused by the JSAFC 247 strain in the present invention reached more than 98%. The peak of death occurred at 14 - 20 days, and dead insects appeared 3 days after inoculation. The strain JSAFC 247 of the present invention has a good lethal effect on the larvae of Anomala corpulenta.

[0041] In summary, JSAFC 247 provided by the present invention provides a biological control resource for controlling the larvae of Anomala corpulenta, and has characteristics such as strong toxicity and fast insecticidal speed. At the same time, it solves the problems of pesticide residues and environmental pollution caused by using chemical pesticides to control pests, and has good development potential and production value.

Claims

1. A Mortierella elongata, characterized in that The strain number of the Mortierella elongata is JSAFC 247, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on December 9, 2024, with the deposit number CGMCC No.41703.

2. The Mortierella elongata according to claim 1, characterized in that The nucleotide sequence of the ITS gene of Mortierella longispora is shown in SEQ ID NO.

1.

3. A biocontrol agent, characterized in that: The active ingredient of the biocontrol fungus agent is the Mortierella elongata described in any one of claims 1 to 2.

4. Use of the Mortierella elongata according to any one of claims 1 to 2 and the biocontrol agent according to claim 3 in controlling A. cooperi.

5. The use according to claim 4, characterized in that: The application is specifically to spray the spore suspension of Mortierella elongata JSAFC 247 described in any one of claims 1 to 2 on the larvae of A. cooperi, or on the plants that the larvae of A. cooperi feed on.

6. The use according to claim 5, characterized in that: The preparation method of the spore suspension is as follows: (1) taking the biocontrol fungus Mortierella longispora JSAFC 247 strain, picking up mycelium with an inoculation needle under sterile conditions, inoculating it into a sterilized PDA culture medium, and culturing it for 5 days; (2) scraping the mycelium under sterile conditions, washing the mycelium with sterile water and filtering it with gauze; (3) adjusting the spore concentration with sterile water under sterile conditions.

7. The use according to claim 6, characterized in that: The culture conditions in step (1) are 25° C., 75% humidity, and dark culture.

8. The use according to claim 5, characterized in that: The concentration of the spore suspension is 10 8 / mL.

Images