Pichia pastoris engineering strain for producing candida antarctica lipase B
By constructing and screening CALB recombinant Pichia with improved thermal stability and performing resin immobilization, the problem of insufficient thermal stability of existing CALB is solved, and the improvement of maintaining activity and esterification performance at high temperatures is achieved.
Patent Information
- Application Number
- CN202510302046.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-14
- Publication Date
- 2025-06-13
AI Technical Summary
The existing Candida Antarctic lipase B (CALB) has poor thermal stability in maintaining its activity at high temperatures and is difficult to adapt to the needs of different industrial conditions.
By constructing CALB recombinant Pichia cerevisiae with good thermal production stability, using site-directed single mutation treatment and signal peptide mutation screening, CALB mutants with improved thermal stability, such as Q231F, and the thermal stability and esterification performance of the enzyme are improved through resin immobilization.
The thermal stability of CALB is improved, and the enzyme solution maintains high hydrolase activity and esterification performance at high temperatures, adapting to the needs of different industrial conditions.
Smart Images
Figure CN120137808A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a Pichia pastoris engineering strain producing Candida antarctica lipase B. Background Art
[0002] Pichia pastoris can produce a non-methanol-induced genetically engineered yeast that produces highly thermostable Candida antarctica lipase B (CALB), and has a high protein expression level. Specifically, the protein expression level of Candida antarctica lipase B reaches 2.27 g / L, the hydrolytic enzyme activity is 93.3 U / mL, and the thermostability Tm value is 63 °C, which is 10 °C higher than that of wild-type CALB. After heat incubation at 70 °C for 1 h, the hydrolytic enzyme activity of wild-type CALB decreased by 17.5 U / mL, while the hydrolytic enzyme activity of mutant CALB-Q231F only decreased by 5 U / mL; after heat incubation at 80 °C for 1 h, the hydrolytic enzyme activity of wild-type CALB decreased by 42.5 U / mL, while the hydrolytic enzyme activity of mutant CALB-Q231F only decreased by 12.5 U / mL.
[0003] Candida antarctica lipase B (CALB) is a lipase produced by Candida antarctica. It belongs to the family of hydrolases and can catalyze the hydrolysis of esters and fatty acids. CALB has attracted much attention due to its high stability and high catalytic activity in non-aqueous solvents, making it widely used in industrial applications, including the synthesis of pharmaceutical intermediates, the production of biodiesel, and food processing. However, the existing CALB has poor thermal stability in maintaining its activity at high temperatures and is difficult to meet the requirements of different industrial conditions. To overcome this challenge, current research mainly focuses on two directions: enzyme immobilization and protein engineering.
[0004] The Pichia pastoris expression system is a widely used recombinant protein expression platform, especially showing unique advantages in producing high-level and correctly folded foreign proteins. The uniqueness of this expression system lies in its ability to secrete recombinant proteins into the culture medium, omitting the step of protein purification. The Pichia pastoris expression system has a wide range of applications in multiple fields, including but not limited to vaccine production, drug development, industrial enzyme preparation production, etc. Due to its high expression efficiency and simplified post-treatment process, it has become one of the preferred systems in biotechnology research and industrial production.
[0005] The currently widely used alcohol oxidase (AOX) promoter is derived from the methanol utilization pathway of Pichia pastoris. Using methanol as an inducer can significantly enhance the protein expression level. However, under high-density fermentation conditions, this method faces multiple challenges, including the complexity of the fermentation process, the high requirement for the initial cell concentration, and the volatility, toxicity, and potential fire risk of methanol. These characteristics limit its application in the production of pharmaceutical and food-grade proteins. Summary of the Invention
[0006] The purpose of the present invention is to provide a Pichia pastoris engineering strain producing Candida antarctica lipase B to solve the problems presented in the above-mentioned background technology.
[0007] To achieve the above purpose, the present invention provides the following technical solution: A Pichia pastoris engineering strain producing Candida antarctica lipase B, and the method for constructing the lipase mutant has the following steps:
[0008] Step 1: Construction of the vector signal peptide of the recombinant Pichia pastoris producing CALB
[0009] Three replacements, SP23, Mα, MFΔ, are made to the Pichia pastoris plasmid vector pGAPZαA. The above signal peptides are used for the construction and screening of recombinant strains. The expression levels of CALB synthesized by different strains are measured through shake-flask fermentation. Among them, the protein expression level using the Mα signal peptide is 33% higher than that of the α signal peptide during screening. The vector pGAPZ(Mα)A is selected as the high-protein expression vector;
[0010] Step 2: Construction and screening of CALB thermostable strains
[0011] The FoldX calculation of the CALB single amino acid mutants is performed using the FireProt program, and 12 mutation schemes are screened out: A151P, Q211L, D145F, T186Y, D49M, D265M, A282Y, Q231F, T43F, S10M, V210I, T174F;
[0012] The method of single-point mutation is to perform circular PCR on the plasmid in the mutation micro-shop and then self-ligate it with T4 ligase. The remaining steps are carried out according to the method of the CALB engineering strain to obtain 12 genetically recombinant Pichia pastoris, and then fermentation is carried out to produce enzymes. After screening, CALB enzyme solution is obtained;
[0013] Step 3: Immobilization of the CALB enzyme solution
[0014] The resin material of NKA was selected, the enzyme solution dosage was 1:5 (m / V), the immobilization time was 12 hours, the immobilization temperature was 40°C, ethylene glycol diglycidyl ether was selected as the cross-linking agent, the cross-linking temperature was 40°C, the concentration of the cross-linking agent was 0.8%, and the cross-linking time was 10 hours; the immobilized lipase was obtained.
[0015] As a further improvement of the present invention, in step 1, the SP23 signal peptide is a signal peptide endogenously secreted by Pichia pastoris, which lacks 73 amino acids relative to the α signal peptide. The Mα signal peptide can be obtained by codon optimization of the α signal peptide, and the MFΔ signal peptide deletes amino acids 57-70 of the α signal peptide.
[0016] As a further improvement of the present invention, the FoldX calculation of the CALB single amino acid mutant in step 2 comprises the following steps:
[0017] S1. Prepare amino acid sequence information of CALB single amino acid mutants;
[0018] S2. In the FoldX module, select one or more protein structures similar to the mutant sequence as templates. The mutant is similar to the CALB wild-type sequence, and the crystal structure of the CALB wild-type can be used as a template.
[0019] S3. Input the mutant sequence and the selected template structure into FireProt;
[0020] S4. Set the parameters of FoldX calculation according to the characteristics of the mutant and the quality of the template;
[0021] S5. Start the FoldX calculation process. FireProt will use the template information to predict the three-dimensional structure of the mutant.
[0022] S6. After the calculation is completed, the predicted structure is analyzed to check the effect of the mutation on the protein structure;
[0023] S7. Use other bioinformatics methods to verify the rationality of the predicted structure.
[0024] As a further improvement of the present invention, the α signal peptide in the Pichia pastoris plasmid vector pGAPZαA in step 1 is derived from Saccharomyces cerevisiae and is a signal peptide that comes from the empty plasmid pGAPZαA.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] The Pichia pastoris engineering strain producing Candida antarctica lipase B was subjected to site-directed single mutation treatment experiments on the CALB gene fragment, and a recombinant Pichia pastoris with good thermostability of CALB was screened out. Its recombinant plasmid number is pGAPZ(Mα)A-CALB-Q231F; the signal peptide of protein expression was screened for mutations, and it was found that the protein expression level of pGAPZ(Mα)A was relatively high, and the actual protein expression level in 150 L fermentation was as high as 2.02 g / L; the above strain secreted CALB externally, and the enzyme solution was immobilized on resin, and the immobilized enzyme showed good thermostability and esterification performance. Brief Description of the Drawings
[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0028] Figure 1 is the proportion of the glyceride-type product obtained by esterifying DHA glyceride;
[0029] Figure 2 is the curve of the acid value of the esterification reaction of (A) DHA triglyceride changing with time;
[0030] Figure 3 is the curve of the conversion rate of the esterification reaction of (B) DHA triglyceride changing with time. Detailed Embodiments
[0031] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.
[0032] Example 1: Extraction and Amplification of CALB Gene Fragment and pGAPZαA Plasmid Fragment
[0033] The target gene CALB is derived from the recombinant Pichia pastoris strain that can synthesize CALB retained in the laboratory. The vector empty plasmid pGAPZαA required for plasmid extraction is derived from Escherichia coli carrying the empty plasmid retained in the laboratory. The genes of Candida antarctica lipase B and pGAPZαA plasmid were amplified using the Omega Escherichia coli plasmid extraction kit.
[0034] Forward primer of Candida antarctica lipase B gene:
[0035] AAGCTCTACCTTCCGGTTCGGACCCT
[0036] Reverse primer:
[0037] ACATCCTCTTGATTAGGGGGTGACGATGCCGG
[0038] Forward primer for amplifying empty plasmid pGAPZαA:
[0039] CCCCCTAATCAAGAGGATGTCAGAATGCCATT
[0040] Reverse primer:
[0041] AACCGGAAGGTAGAGCTTCAGCCTCTCTTTTCTCG
[0042] Using Takara's PrimeSTAR as the polymerase, with the CALB gene as the template, PCR amplification was carried out using the forward primer and the reverse primer. The system was: 1 μL of template, 2 μL of forward primer, 2 μL of reverse primer, 25 μL of Prime Star series enzyme (2×), 20 μL of double-distilled water. The reaction conditions were: pre-denaturation at 98°C for 3 min, denaturation at 98°C for 10 s, annealing for 15 s, extension at 72°C, and the extension time was the template length × the enzyme amplification rate. The three steps of denaturation to extension were cycled 34 times, and the 34th extension step was extended for 10 min, stored at 4°C, electrophoresed on 1% agarose gel, gel recovered, the template was eliminated by endonuclease DpnI, and PCR recovery was performed to obtain the gene fragment. The amplification steps of plasmid pGAPZαA were the same as above.
[0043] Example 2: Construction of recombinant plasmid pGAPZαA-CALB
[0044] The recovered CALB mutant gene fragment and the pGAPZαA plasmid template were mixed evenly at a molar ratio of 1:5. 10 μL of the mixed solution was taken and mixed with 10 μL of Gibson enzyme (2×), and ligated at 50°C for 15 min. The hot lid temperature was set to 85°C.
[0045] After the ligation reaction was completed, the liquid was subjected to chemical transformation of Escherichia coli. The specific operation was as follows: Take out Escherichia coli Trans 10 competent cells, thaw them in an ice bath for 5 min, quickly add the ligation reaction solution, and then incubate in an ice bath for 30 min. Heat shock at 42 °C for 30 s, then incubate in an ice bath for 2 min, resuscitate with 500 μL of LB medium, and gently pipette to mix evenly. Incubate at 37 °C and 200 rpm for 1 h. Spread with glass beads on an LB plate containing 1‰ bleomycin and culture at 37 °C for 16 h. After transformation, the single colonies of Escherichia coli obtained by culture were subjected to colony PCR to preliminarily verify whether the target gene and the vector were successfully ligated.
[0046] Example 3: Cultivation and screening of Pichia pastoris engineering bacteria producing CALB
[0047] Extract the pGAPZαA-CALB plasmid with correct sequencing, add 2 μL of restriction enzyme BstXI and a certain amount of buffer 3.1, incubate at 37 °C for 2 - 3 h, and obtain the linearized plasmid after PCR recovery. Then, integrate the plasmid into the Pichia pastoris genome by electroporation. The transformants were spread on YPD plates and cultured at 30 °C for two days. Eight single colonies of Pichia pastoris strains obtained on the plates were inoculated into YPD shake flasks for fermentation culture under the same conditions. The fermentation process was as follows: Seed culture: Inject the sterilized medium into a sterile tube, add 1‰ antibiotic, and then inoculate 1% of the bacterial liquid in the glycerol tube into the tube medium, and culture at 37 °C / 30 °C and 200 rpm. Shake flask fermentation: Inoculate 1% of the Pichia pastoris seed liquid into the YPD shake flask medium, culture at 30 °C for 2 d, supplement 2% sterile glycerol to the shake flask, and culture at 30 °C for another 2 d. Centrifuge the fermentation broth at 7000 rpm at 4 °C for 10 minutes to obtain the upper clear enzyme solution, and detect the protein expression level and the hydrolytic activity of CALB to screen out the engineering strains with high protein expression level and high CALB hydrolytic activity.
[0048] Example 4: Determination of protein expression level and acid value
[0049] The protein expression level is one of the indicators representing the enzyme-producing ability of the strain. In this patent, the Coomassie brilliant blue staining method was used to determine the protein expression level.
[0050] Prepare the standard curve:
[0051] Prepare the solutions required for standard curve determination according to Table 2 - 5. The standard protein solution is 0.1 g / L bovine serum albumin (BSA), and G250 is Coomassie brilliant blue G250.
[0052] Table 1 Preparation of standard curve solutions
[0053]
[0054] After shaking the prepared solution well, inject it into a 96-well plate, measure the absorbance at 595 nm, and plot a standard curve.
[0055] 1. Measuring the sample solution:
[0056] Take a certain amount of enzyme solution and deionized water according to an appropriate dilution factor. The two together constitute a 200 μL sample system. Then add 200 μL of Coomassie Brilliant Blue G250 and 600 μL of deionized water, mix well, measure the absorbance at 595 nm, and the protein concentration in the sample solution can be obtained corresponding to the standard curve.
[0057] Acid value titration: The degree of the oleic acid methylation reaction can be represented by measuring the remaining amount of oleic acid, which requires comparing the acid values of the oil phases in the solution before and after the reaction.
[0058] 2. The method for measuring the acid value is as follows:
[0059] Take 1 mL of the post-reaction suspension, centrifuge it, take the upper oil phase, and weigh it. Add 50 mL of ethanol, 4 drops of phenolphthalein, and titrate with 0.05 mol / L NaOH solution until it turns slightly pink. If it does not fade within 30 s, it reaches the titration end point, and read the consumption of the NaOH standard solution.
[0060] Acid value calculation formula:
[0061]
[0062] In the formula:
[0063] AV—Acid value;
[0064] V—Volume of the NaOH solution used in the titration, in milliliters (mL);
[0065] C—Concentration of the NaOH solution used in the titration, in moles per liter (mol / L);
[0066] MNaOH—Relative molecular mass of NaOH, 40;
[0067] m—Mass of the sample taken before titration, in grams (g).
[0068] 3. Calculation of the esterification rate:
[0069] Measure the acid values of the mixed solution at the zero time of the reaction and the suspension after the reaction ends respectively.
[0070] Esterification rate calculation formula:
[0071]
[0072] In the formula,
[0073] AV—Acid value of the suspension after the reaction ends;
[0074] AV0—acid value of the mixed liquid at reaction time zero.
[0075] Example 5: Oleic acid methyl esterification reaction
[0076] The esterification ability of an enzyme is also one of the indicators of the enzyme-producing ability of a strain. This article uses the method of oleic acid methyl esterification to determine the reaction conversion rate and identify the activity of the enzyme.
[0077] Oleic acid methyl esterification reaction: weigh 20g oleic acid into a 100mL sealable reaction bottle, add methanol (add 6 times, add once every 1.5h, add 550μL each time, add a total of 3.3mL), and finally add 2mL enzyme solution and seal. The reaction was carried out at 40℃ and 200rpm, and the total reaction time was 24h. After measuring the protein expression and oleic acid methyl esterification rate, a non-methanol-induced recombinant Pichia strain that can ferment and produce CALB can be screened.
[0078] Example 6: Construction and screening of vector signal peptides for producing CALB recombinant Pichia pastoris
[0079] The α signal peptide in the Pichia pastoris plasmid vector pGAPZαA is derived from Saccharomyces cerevisiae and is a signal peptide that comes with the empty plasmid pGAPZαA. The signal peptide has an important influence on the protein expression level, so three replacements are made to the signal peptide of the vector, and various primers are used for PRC replacement, SP23, Mα, and MFΔ, wherein the SP23 signal peptide is a signal peptide endogenously secreted by Pichia pastoris and lacks 73 amino acids relative to the α signal peptide; the Mα signal peptide can be obtained by codon optimization of the α signal peptide; the MFΔ signal peptide deletes the amino acids 57-70 of the α signal peptide, and the above signal peptides are used to construct and screen recombinant strains, and the protein expression levels of CALB synthesized by different strains are determined by shake flask fermentation, wherein the protein expression level of the Mα signal peptide is 33% higher than that of the α signal peptide in the screening, so the vector pGAPZ(Mα)A is selected as the protein high expression vector, and all subsequent constructions use pGAPZ(Mα)A as the plasmid vector.
[0080] Example 7: Construction and screening of CALB single amino acid mutation engineered strains
[0081] First, the FoldX calculation was performed on the single amino acid mutants of CALB using the FireProt program to predict the single-point mutation results that could improve the thermal stability. The Candida antarctica lipase B was subjected to saturation mutagenesis at different sites and with different amino acids. Then, through directed evolution and high-throughput screening, a strain with significantly improved enzyme activity and heat resistance was screened. Through sequencing, the following mutations in the amino acids relative to wild-type CALB were found: A151P, Q211L, D145F, T186Y, D49M, D265M, A282Y, Q231F, T43F, S10M, V210I, T174F. The method of single-point mutation was to perform circular PCR on the plasmid at the mutation point and then self-ligate it with T4 ligase. The T4 ligation reaction system was as follows: 1.5 μL of T4 ligase, 1.5 μL of T4 PNK enzyme, 3 μL of T4 ligase buffer (10×), and 24 μL of the target fragment. The above solution was reacted at 22 °C for 3 h or at 16 °C overnight. After the successful construction of recombinant Pichia pastoris, for each mutant, a recombinant Pichia pastoris strain that optimally synthesized the CALB mutant was screened according to the above examples.
[0082] Example 8: Immobilization of CALB and Its Application in DHA Glycerides
[0083] A single-factor variable immobilization experiment was carried out on the enzyme solution, including the resin material, the amount of enzyme solution added, the immobilization time, the immobilization temperature, the screening of cross-linking agents, the cross-linking temperature, the concentration of cross-linking agents, and the cross-linking time, etc. The experimental results of the optimal immobilization conditions showed that the resin material of NKA was selected, the amount of enzyme solution added was 1:5 (m / V), the immobilization time was 12 hours, the immobilization temperature was 40 °C, ethylene glycol diglycidyl ether was selected as the cross-linking agent, the re-cross-linking temperature was 40 °C, the concentration of the cross-linking agent was 0.8%, and the cross-linking duration was 10 h;
[0084] The wild-type CALB catalyzed the esterification reaction of DHA glycerides, and the reaction reached the end point at 168 h. The acid value decreased from 172.0 mg NaOH / g to 5.3 mg NaOH / g. The sample at the end point of the reaction was subjected to defatty acid treatment and then detected by liquid chromatography-mass spectrometry to obtain the proportions of the three glycerides, as Figure 1 shown.
[0085] According to Figure 1 it can be obtained that the esterification product of DHA glycerides contains 22.9% of DHA monoglyceride, 48.8% of DHA diglyceride, and 28.3% of DHA triglyceride. Obviously, the content of DHA diglyceride reaches about half of the product. Therefore, the research shows that the currently fermented and synthesized wild-type CALB is more inclined to the synthesis of DHA diglyceride in the esterification reaction of DHA glycerides.
[0086] The mutant CALB-Q231F obtained by fermentation was used to catalyze the esterification of DHA glyceride, and the acid value in the reaction solution was measured every once in a while, and the reaction esterification rate was calculated until the reaction reached the end point and stopped. Plotting with time as the abscissa gives Figures 2-3 .
[0087] According to Figures 2-3 it can be obtained that when the esterification reaction of DHA glyceride is carried out at 40 °C, the reaction reaches the end point after 48 h, the acid value decreases from 170.0 mg NaOH / g to 52.2 mg NaOH / g, and the esterification rate reaches 69.3%; while when the reaction is carried out at 50 °C, the reaction reaches the end point after 91 h, the acid value decreases from 170.0 mg NaOH / g to 13.5 mg NaOH / g, and the esterification rate can reach 92.1%. Therefore, raising the reaction temperature from 40 °C to 50 °C can greatly increase the content of the product DHA glyceride at the end point of the reaction.
[0088] Example 9: Esterification synthesis of triglyceride caprylate / caprate
[0089] 0.1 mol of glycerol and 0.302 mol of caprylic / capric acid (caprylic acid: 57.18%, capric acid: 42.82%) were added to a 250 mL jacketed esterification reaction device equipped with a circulating water bath, a thermometer and a stirring paddle. The circulating water bath heated the substrate to 50 °C, the stirring device was turned on, the immobilized enzyme prepared by the method of Example 8 was added, and the reaction was carried out under vacuum at 50 °C and 200 rpm. The results were that the reaction duration was 24 hours, the enzyme addition amount was 10%, and the conversion rate was 98.82%.
[0090] Example 10: Esterification synthesis of dioctanoate / didecanoate of butanediol
[0091] 0.11 mol of butanediol and 0.202 mol of caprylic / capric acid (caprylic acid: 57.18%, capric acid: 42.82%) were added to a 250 mL jacketed esterification reaction device equipped with a circulating water bath, a thermometer and a stirring paddle. It was added to the preheated esterification reaction device at 50 °C. After the substrate temperature rose to the reaction temperature of 50 °C, the weighed immobilized enzyme was added, and the reaction was carried out under vacuum at 50 °C and 200 rpm. The results were that the reaction duration was 19 hours, the enzyme addition amount was 10%, and the conversion rate was 99.12%.
[0092] Example 11: Synthesis of isopropyl palmitate
[0093] In a 250 mL jacketed esterification reaction device equipped with a circulating water bath, a thermometer, and a stirring paddle, add 0.1 mol of palmitic acid and 0.2 mol of isopropanol. Add them to the esterification reaction device preheated to 50 °C, turn on the stirring paddle. Wait until the palmitic acid melts and is uniformly mixed with the isopropanol, and react with the immobilized enzyme at 50 °C and 200 rpm. The results are a reaction time of 5 hours, an enzyme addition amount of 5%, and a conversion rate of 97.48%.
[0094] Example 12: Esterification synthesis of methyl palmitate
[0095] In a 250 mL jacketed esterification reaction device equipped with a circulating water bath, a thermometer, and a stirring paddle, add 0.1 mol of palmitic acid and 0.2 mol of methanol. Add them to the esterification reaction device preheated to 50 °C, turn on the stirring paddle. Wait until the palmitic acid melts and is uniformly mixed with the methanol, and add the immobilized enzyme to react at 50 °C and 200 rpm. The results are a reaction time of 5 hours, an enzyme addition amount of 5%, and a conversion rate of 99.43%.
[0096] Example 13: Esterification synthesis of isooctyl palmitate
[0097] In a 250 mL jacketed esterification reaction device equipped with a circulating water bath, a thermometer, and a stirring paddle, add 0.1 mol of palmitic acid and 0.2 mol of isooctanol. Add them to the esterification reaction device preheated to 50 °C, turn on the stirring paddle. Wait until the palmitic acid melts and is uniformly mixed with the isooctanol, and when the mixture temperature stabilizes at about 50 °C, add the immobilized enzyme, evacuate and react at 50 °C and 200 rpm. The results are a reaction time of 17 hours, an enzyme addition amount of 5%, and a conversion rate of 98.75%.
[0098] Example 14: Esterification synthesis of cetyl octanoate / decanoate
[0099] In a 250 mL jacketed esterification reaction device equipped with a circulating water bath, a thermometer, and a stirring paddle, add 0.1 mol of cetyl alcohol and 0.102 mol of n-octanoic acid. Add them to the esterification reaction device preheated to 50 °C, turn on the stirring paddle. Wait until the cetyl alcohol melts and is uniformly mixed with the n-octanoic acid, and when the temperature stabilizes at about 50 °C, add the immobilized enzyme, evacuate and react at 50 °C and 200 rpm. The results are a reaction time of 2 hours, an enzyme addition amount of 5%, and a conversion rate of 97.38%.
[0100]
[0101]
[0102]
[0103] Although embodiments of the present invention have been shown and described, those of ordinary skill in the art will appreciate that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. An engineered strain of Pichia pastoris producing Candida antarctica lipase B, characterized in that: The method for constructing a lipase mutant comprises the following steps: Step 1: Construction of the vector signal peptide for producing CALB recombinant Pichia pastoris The Pichia pastoris plasmid vector pGAPZαA was replaced with three kinds of peptides, SP23, Mα, and MFΔ, and the above signal peptides were used to construct and screen recombinant strains. The expression levels of CALB synthesized by different strains were determined by shake flask fermentation. The protein expression level of the Mα signal peptide was 33% higher than that of the α signal peptide in the screening. The vector pGAPZ(Mα)A was selected as the protein high expression vector. Step 2: Construction and screening of CALB thermostable strains FireProt program was used to perform FoldX calculations on CALB single amino acid mutants, and 12 mutation schemes were screened: A151P, Q211L, D145F, T186Y, D49M, D265M, A282Y, Q231F, T43F, S10M, V210I, and T174F; The single-point mutation method is to perform circular PCR on the plasmid in the mutation micro-store, and then use T4 ligase for self-ligation. The remaining steps are made according to the method of producing CALB engineering strains to obtain 12 gene recombinant Pichia pastoris, and then ferment to produce enzymes. After screening, CALB enzyme liquid is obtained; Step 3: Immobilization of CALB enzyme solution The resin material of NKA was selected, the enzyme solution dosage was 1:5 (m / V), the immobilization time was 12 hours, the immobilization temperature was 40°C, ethylene glycol diglycidyl ether was selected as the cross-linking agent, the cross-linking temperature was 40°C, the concentration of the cross-linking agent was 0.8%, and the cross-linking time was 10 hours; the immobilized lipase was obtained.
2. The Pichia pastoris engineered strain producing Candida antarctica lipase B according to claim 1, characterized in that: In the step 1, the SP23 signal peptide is a signal peptide endogenously secreted by Pichia pastoris, which lacks 73 amino acids compared to the α signal peptide. The Mα signal peptide can be obtained by codon optimization of the α signal peptide, and the MFΔ signal peptide deletes amino acids 57-70 of the α signal peptide.
3. The Pichia pastoris engineered strain producing Candida antarctica lipase B according to claim 1, characterized in that: The second step is the FoldX calculation of CALB single amino acid mutants, comprising the following steps: S1. Prepare amino acid sequence information of CALB single amino acid mutants; S2. In the FoldX module, select one or more protein structures similar to the mutant sequence as templates. The mutant is similar to the CALB wild-type sequence, and the crystal structure of the CALB wild-type can be used as a template. S3. Input the mutant sequence and the selected template structure into FireProt; S4. Set the parameters of FoldX calculation according to the characteristics of the mutant and the quality of the template; S5. Start the FoldX calculation process. FireProt will use the template information to predict the three-dimensional structure of the mutant. S6. After the calculation is completed, the predicted structure is analyzed to check the effect of the mutation on the protein structure; S7. Use other bioinformatics methods to verify the rationality of the predicted structure.
4. The Pichia pastoris engineered strain producing Candida antarctica lipase B according to claim 1, characterized in that: The α signal peptide in the Pichia pastoris plasmid vector pGAPZαA in the step 1 is derived from Saccharomyces cerevisiae and is a signal peptide that comes with the empty plasmid pGAPZαA.