Acidithiobacillus caldus engineering bacterium with improved acid stress resistance

By overexpressing CsrA post-transcriptional regulators in Thiobacillus acidophilus, the problem of insufficient stress resistance in an acidic environment was solved, which significantly improved its acid resistance and growth rate, and enhanced its biometallurgical function.

CN120137867APending Publication Date: 2025-06-13JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510282777.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

Extreme acidophilus Thiobacteria need to quickly regulate gene expression to adapt when facing acidic environmental stress, but the prior art has failed to effectively improve its acid resistance.

Method used

By discovering and overexpressing CsrA in Thiobacteria globally regulates the superprotein family, Thiobacteria acidophilus engineered bacteria were constructed to improve their acid stress resistance.

Benefits of technology

It significantly improves the acid resistance and growth rate of Thiobacillus acidophilus, and enhances its functional efficiency in the biometallurgy process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120137867A_ABST
    Figure CN120137867A_ABST
Patent Text Reader

Abstract

The invention discloses an acidithiobacillus caldus engineering bacterium with improved acid stress resistance. The CsrA coding amino acid conserved region and the amino acid sequence of the acidithiobacillus caldus are compared and analyzed. Based on a conjugational transfer method, CsrA protein is over-expressed in the acidithiobacillus caldus, and it is verified that the post-transcriptional regulatory factor can improve the survival rate of the acidithiobacillus caldus under the acidic condition. According to the method, the environmental adaptability of the acidithiobacillus caldus is improved through metabolic means such as post-transcriptional level regulation and the like, and the acid tolerance is enhanced, so that a foundation is laid for improving metal ion leaching of low-grade copper ore.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an engineered strain of Acidithiobacillus caldus with improved acid stress resistance, belonging to the technical field of genetic engineering. Background Art

[0002] Bioleaching is a low-input method for extracting metals from sulfide ores using microbial metabolism. It can process low-grade ores and is more efficient, energy-saving, and environmentally friendly than traditional metallurgy. Acidithiobacillus caldus (abbreviated as A. caldus), an extremely acidophilic and thermophilic sulfur bacterium, is commonly used in commercial bioleaching due to its fast growth rate, strong oxidation and tolerance capabilities. It can oxidize sulfides in ores such as chalcopyrite to release metal ions, and the acidic metabolites it produces can lower the environmental pH, providing favorable conditions for the degradation of sulfides and enhancing metallurgical efficiency. However, extreme microorganisms are constantly facing various environmental stresses, which can easily damage cells and hinder growth. A. caldus needs to rapidly regulate gene expression to adapt.

[0003] Post-transcriptional regulation is a key step in controlling bacterial gene expression, playing a "differential gear function" between transcription and translation, which can save cellular resources to the greatest extent. There are various post-transcriptional regulation methods. Among them, RNA-binding proteins (RBPs) are basic components of the co-transcriptional and post-transcriptional regulatory networks in bacteria. In addition to ribosomes, other proteins bind to mRNA, and they usually compete with ribosomes for binding to exert their functions. Previous studies on the post-transcriptional level mostly explored their functions through heterologous expression in Escherichia coli, but the mechanism of action and application value in A. caldus have not been explored.

[0004] CsrA is a small RNA-binding protein that binds to conserved GGA sites in the 5′-UTR and / or its messenger RNA (mRNA) targets in the form of a dimer, thereby changing RNA structure, translation, stability, and / or transcription elongation. The carbon storage regulatory network is conserved in many bacterial species and regulates gene expression involved in carbon metabolism, iron homeostasis, motility, biofilm formation, stress response, c-di-GMP synthesis, quorum sensing, and many other survival and virulence processes. In A. caldus, there has been no study on the function of CsrA and no report on using CsrA to improve the acid tolerance of A. caldus. Summary of the Invention

[0005] To solve the deficiencies of the prior art, the inventor discovered a post-transcriptional regulator of the CsrA global regulatory superfamily in A. caldus and named it CsrA. Based on conjugation transfer overexpression of the csrA gene from A. caldus, the present invention constructs an engineered strain of Acidithiobacillus caldus. The acid resistance and growth rate of this strain are significantly improved, and it can more efficiently perform the function of bioleaching.

[0006] The present invention is achieved through the following technical solutions:

[0007] The first object of the present invention is to provide an engineered strain of Acidithiobacillus caldus with improved acid stress resistance, wherein the engineered strain of Acidithiobacillus caldus overexpresses the carbon storage regulator protein CsrA.

[0008] In one embodiment, the amino acid sequence of the carbon storage regulator protein CsrA is as shown in SEQ ID NO.1.

[0009] In one embodiment, the promoter nucleotide sequence of the carbon storage regulator protein CsrA is as shown in SEQ ID NO.2.

[0010] In one embodiment, the nucleotide sequence of the carbon storage regulator protein CsrA is as shown in SEQ ID NO.3.

[0011] In one embodiment, the engineered strain of Acidithiobacillus caldus uses pJD215 as an overexpression vector.

[0012] In one embodiment, the host of the engineered strain of Acidithiobacillus caldus is Acidithiobacillus caldus MTH-04.

[0013] The second object of the present invention is to provide a method for preparing the engineered strain of Acidithiobacillus caldus, comprising the following steps: connecting the carbon storage regulator factor csrA and the promoter to a plasmid, transferring the plasmid into Escherichia coli competent cells, and then transferring the plasmid into the Acidithiobacillus caldus host by conjugation transfer.

[0014] In one embodiment, the conjugation transfer method is as follows: adjusting E. coli SM10(pJD215-CsrA) and A. caldus MTH-04 to the same OD 600 mixing them in a ratio of 1:2 and spreading them onto a solid conjugation medium covered with two 0.45 μm filters, culturing them upright at 37°C for 5 days; washing the filters with an inorganic salt solution and performing 10 -1 、10 -2 、10 -3 gradient dilutions; respectively spreading them onto a Starky-Na 2 S 2 O 3 solid medium containing resistance, culturing them upside down at 37°C for 7 days; selecting single colonies from the solid plate, inoculating them into 20 mL of Starky-S 0 medium, culturing for 3-5 days, and then performing colony PCR verification and sequencing.

[0015] The third object of the present invention is to provide the application of the carbon storage regulator protein CsrA in enhancing the acid stress resistance of Acidithiobacillus thermophilum

[0016] In one embodiment of the present invention, the amino acid sequence of the carbon storage regulator protein CsrA is as shown in SEQ ID NO.1.

[0017] In one embodiment, Acidithiobacillus thermophilum expressing the carbon storage regulator protein CsrA shown in SEQ ID NO.1 is added to culture systems with different pH values.

[0018] In one embodiment, the pH values in the system are 1.0, 1.5, 2.0, and 2.5 respectively.

[0019] In one embodiment, the acid stress resistance ability includes that under acidic conditions, the growth amount and growth rate of WT(pJD215-CsrA) are both higher than those of the wild type, and the biomass reaches up to 4.85×10 8 cell·mL -1 , and the specific growth rate μ max is 1.20 d -1 . Under the culture conditions of constant pH 2.0, 1.5, and 1.0, compared with the WT(pJD215) strain, the maximum cell concentration of the WT(pJD215-CsrA) strain increases by 0.34×10 8 cell·mL -1 , 0.31×10 8 cell·mL -1 , 0.23×10 8 cell·mL -1 , and the maximum specific growth rate of the cells is increased to 1.32 d -1 , 0.45 d -1 , 0.48 d -1 respectively.

[0020] In one embodiment, the acid stress resistance ability includes observing the cell morphological changes of the WT(pJD215-CsrA) strain and the WT(pJD215) strain through a transmission electron microscope (TEM). The cell morphology of the WT(pJD215-CsrA) strain changes from short rod-shaped to slender-shaped, with the length increasing by 36.37%; the number of flagella increases; and the extracellular secretions increase.

[0021] In one embodiment, the acid stress resistance ability includes that the biofilm components of the WT(pJD215-CsrA) strain change, the fulvic acid-like substances decrease, the soluble microbial by-products and humic acid increase, the biofilm structure and permeability change, and the metal ion complexing ability may be enhanced, which is expected to improve the leaching efficiency.

[0022] In one embodiment, the acid stress resistance ability includes that the contents of aspartic acid and glutamic acid in the WT(pJD215-CsrA) strain increase by 7.05 mg / L and 3.73 mg / L respectively, which helps to increase the acid tolerance of cells and thus promotes cell survival.

[0023] The fourth object of the present invention is to provide the application of the engineered Acidithiobacillus thermophilum in bioleaching.

[0024] Beneficial effects of the present invention:

[0025] Based on the conjugation transfer overexpression of the carbon storage regulator CsrA of Acidithiobacillus caldus itself, the present invention constructs an engineered Acidithiobacillus thermophilum strain WT(pJD215-CsrA). Compared with the wild-type A.caldus MTH-04WT(pJD215), the engineered strain A.caldus MTH-04WT(pJD215-CsrA) has improved acid stress resistance ability, increased cell mass and specific growth rate, which is of great significance for the application of Acidithiobacillus thermophilum in bioleaching. Brief description of the drawings

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0027] Figure 1 Domain information of the protein encoded by F0726_RS07045 in Example 1.

[0028] Figure 2 Amino acid sequence alignment diagram of the protein encoded by A.caldus MTH04 F0726_RS07045 and the CsrA homologous protein in Example 1.

[0029] Figure 3 Schematic diagram of the conjugation transfer construction of the CsrA overexpression strain of Acidithiobacillus thermophilum in Example 2;

[0030] Figure 4 PCR verification of the CsrA overexpression strain of Acidithiobacillus thermophilum in Example 2.

[0031] Figure 5 Growth conditions of the overexpression strain WT(pJD215-CsrA) and the control strain WT(pJD215) at different pH values in Example 3. Among them, (A) is the growth curve; (B) is the specific growth rate curve.

[0032] Figure 6 Morphological structure diagram of bacteria observed by TEM in Example 4. (A) shows the distribution of the csrA gene and adjacent genes on the A. caldus genome; (B)-(D) show the morphological observations of the wild-type strain WT(pJD215) under TEM; (E)-(G) show the morphological observations of the overexpressing strain WT(pJD215-CsrA) under TEM.

[0033] Figure 7 Overexpression of CsrA protein in Example 5 affects the composition of the A. caldus biofilm. Among them, (A) is the 3D-EEM imaging of the biofilm; (B) is the fluorescence integral value of different regions.

[0034] Figure 8 Variation in the intracellular free amino acid content of the overexpressing strain WT(pJD215-CsrA) in Example 6. Detailed implementation manners

[0035] The following combines specific examples to further elaborate on this invention patent. These implementation cases are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

[0036] The culture media involved in the following examples are as follows:

[0037] LB liquid medium: Yeast extract 5 g·L -1 、Peptone 10 g·L -1 、NaCl 10 g·L -1 ;

[0038] LB solid medium: Yeast extract 5 g·L -1 、Peptone 10 g·L -1 、NaCl 10 g·L -1 、Agar 20 g·L -1 ;

[0039] Starky-S 0 Liquid medium: CaCl 2 ·2H 2 O 0.189 g / L, (NH 4 )SO 4 2 g / L, KH 2 PO 4 3 g / L, MgSO 4 ·7H 2 O 0.5 g / L, FeSO4 ·7H 2 O 0.01 g / L. After adjusting the pH of the medium to 2.5 with concentrated sulfuric acid, autoclave at 115 °C for 30 min; before use, irradiate sulfur powder under ultraviolet light for 30 min, and add 1 g of sulfur powder to every 100 mL of the medium.

[0040] Starky-Na 2 S 2 O 3 Conjugation transfer solid medium: CaCl 2 ·2H 2 O 0.5 g / L, (NH 4 )SO 4 6 g / L, KH 2 PO 4 6 g / L, MgSO 4 ·7H 2 O 1 g / L, Na 2 S 2 O 3 ·7H 2 O 200 g / L, FeSO 4 ·7H 2 O 0.6 g / L.

[0041] The following combines specific examples to elaborate in detail on the technical solutions of the present invention. In the following examples, unless otherwise specified, the reagents, materials, and equipment used can be obtained from commercial sources, or prepared by conventional methods, or commonly used in this industry.

[0042] Example 1: Bioinformatics analysis of the csrA gene from A. caldus

[0043] (1) Information on the protein domain encoded by F0726_RS07045

[0044] In A. caldus, F0726_RS07045 is annotated as carbon storage regulator, and the gene sequence is shown in SEQ ID NO.3. Search its amino acid sequence through NCBI-CD Search. Figure 1 It can be seen that there is a specific conserved region in the amino acid sequence of F0726_RS07045, which belongs to the CsrA global regulatory superprotein family. Therefore, it is inferred that F0726_RS07045 is a carbon storage regulator in A. caldus, and the A. caldus F0726_RS07045 gene and its encoded protein are named csrA gene and CsrA protein, respectively.

[0045] csrA (SEQ ID NO.3)

[0046] GTGCTGGTACTCACGCGTCGCAGTGGTCAAGCCATCTGTATTGGCGACGACATCCGTATCGTGGTGACTCGGATCGAGGATGGACAGGTTCGCATCGGCATCGAAAGCCGCAGAGACCTGTTGATCCTCCGCGAGGAACTACGCGAAAGCGTGCGTGAGGGCAATCGCGCCGCCCACACCAATCCCGCGGATCTGGACCGCTGGCTTCAGGAGCACCCGCTGCGGGAGCAGATTATCCCTGCAGCAGAGTCCGGCACGGAAGCCATCCCGCACGAGGACAGGTCATGA

[0047] (2) Amino acid sequence alignment

[0048] The amino acid sequence of the protein encoded by F0726_RS07045 from A. caldus was subjected to a homologous protein sequence alignment with the CsrA proteins of other typical strains. The alignment results are as Figure 2 shown. The secondary structure of the protein is shown at the top, with β-sheets and α-helices represented by arrows and cylinders respectively, and the amino acid sequence alignment is shown below. The CsrA protein from A. caldus contains 95 amino acids and is more similar to non-γ-proteobacteria. The F0726_RS07045-encoded protein also has conserved β1 and β5 regions and related amino acid residues. Therefore, it can be speculated that it has good RNA-binding ability.

[0049] CsrA (SEQ ID NO.1)

[0050] MLVLTRRSGQAICIGDDIRIVVTRIEDGQVRIGIESRRDLLILREELRESVREGNRAAHTN PADLDRWLQEHPLREQIIPAAESGTEAIPHEDRS*

[0051] Example 2: Construction of a CsrA overexpression strain based on conjugation transfer technology

[0052] (1) Construction of the pJD215-CsrA recombinant plasmid. The experimental process is as Figure 3 shown.

[0053] The promoter nucleotide sequence used is shown in SEQ ID NO.2. The broad-host-range plasmid pJD215 with streptomycin resistance was selected and linearized by reverse amplification of plasmid pJD215 using primers pJD215-Amp-F and pJD215-7045-R. The csrA gene fragment was amplified from the A. caldus genome using primers Amp-R and csrA-Amp-F. The linearized vector and the fragment were ligated using homologous recombination to construct the recombinant plasmid pJD215-CsrA.

[0054] P Amp (SEQ ID NO.2)

[0055] CGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAG ACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGT

[0056] The primer sequences involved are as follows (SEQ ID NO.4-7):

[0057] pJD215-Amp-F: TCAGTGAAATCCAGGGGAATTCCGCGGAACCCCTAT

[0058] pJD215-7045-R: AACTACCGCATTAAAGCTTTGACCTGTCCTCGTGCG

[0059] Amp-R: CGCGTGAGTACCAGCACACTCTTCCTTTTTCAATATTATTG

[0060] csrA-Amp-F: ATTGAAAAAGGAAGAGTGTGCTGGTACTCACGCGT

[0061] (2) Construction of overexpression strain:

[0062] E. coli SM10 competent cells for transformation were prepared according to the instructions of the Super Competent Cell Preparation Kit (Sangon Biotech; B529303-0200). The competent cells were thawed on ice and 10 μL of the recombinant plasmid pJD215-CsrA constructed in step (1) was added. They were heat-shocked at 42 °C for 90 s in a water bath and immediately ice-bathed for 5 min. Subsequently, 900 μL of liquid LB medium was added and cultured at 37 °C for 1 h. A part of the bacterial solution was spread on solid LB medium and cultured overnight. Single colonies on the plate were selected for colony PCR verification and sequencing.

[0063] (3) Transfer the successfully verified E. coli SM10 and A. caldus MTH-04 by conjugation, coat them on the Starky-Na 2 S 2 O 3 solid conjugation transfer plate, select single colonies for cultivation, and extract plasmids.

[0064] (4) Perform PCR verification on the recombinant plasmid obtained in step (3) using the primers pJD215-junP-F and pJD215-7045-R.

[0065] The primer sequences involved are as follows (SEQ ID NO.8):

[0066] pJD215-junP-F: CAGCCATGATGGATACTTTCTCGG

[0067] (5) Obtain positive transformants by nucleic acid electrophoresis, and the results are as Figure 4 shown, with the correct size. Therefore, after correct sequencing, it was named A. caldus MTH-04WT(pJD215-CsrA), abbreviated as WT(pJD215-CsrA).

[0068] (6) Transfer the pJD215 plasmid used in step (1) into A. caldus MTH-04 as a control group, named A. caldus MTH-04WT(pJD215), abbreviated as WT(pJD215), for subsequent experiments.

[0069] Example 3: Cell growth of two strains of WT(pJD215-CsrA) and WT(pJD215) under extremely acidic conditions

[0070] Take the acidophilic thermophilic sulfur bacterium recombinant strain A. caldus MTH-04WT(pJD215-CsrA) prepared in Example 2, hereinafter abbreviated as WT(pJD215-CsrA), and A. caldus MTH-04WT(pJD215), hereinafter abbreviated as WT(pJD215), for subsequent experiments.

[0071] (1) Culture conditions: Set gradient culture conditions of pH 1.0, pH 1.5, pH 2.0 and pH 2.5, and sample once every two days.

[0072] (2) Determine the cell concentration of A. caldus by the nucleic acid method. The specific steps are as follows:

[0073] Take 1 mL of the medium and centrifuge at 3000 rpm for 30 s to remove sulfur powder. Take the supernatant and mix it with 5% trichloroacetic acid at a ratio of 1:1. After heating in a metal bath at 80 °C for 25 min, immediately cool it in an ice bath. Using 5% trichloroacetic acid as a blank control, measure the absorbance of the sample at OD 260 and calculate the cell concentration according to the standard curve.

[0074] The growth curves and specific growth curves of WT(pJD215-CsrA) strain and WT(pJD215) strain are as Figure 5 shown. The optimal culture conditions for A. caldus MTH-04 were determined to be pH 2.5 in the previous stage. In this paper, acid stress cultures were set at initial pH 1.0, 1.5, and 2.0. The results showed that the cell growth of the wild-type strain was the strongest at a constant pH of 2.0, followed by pH 1.5, and the worst at pH 1.0, with the maximum cell concentration only reaching 1.38×10 8 cell·ml -1 . And under acidic conditions, the growth amount and growth rate of WT(pJD215-CsrA) were higher than those of the wild type. Under the optimal conditions, starting from the 4th day, the growth of the overexpressing strain and the control strain showed differences, with the highest cell concentrations being 4.85×10 8 cell·mL -1 , 4.59×10 8 cell·mL -1 , and the specific growth rates μ max were 1.20 d -1 , 1.27 d -1 respectively. Under the culture conditions of constant pH 2.0, 1.5, and 1.0, compared with the WT(pJD215) strain, the maximum cell concentrations of the WT(pJD215-CsrA) strain increased by 0.34×10 8 cell·mL -1 , 0.31×10 8 cell·mL -1 , 0.23×10 8 cell·mL -1 , and the maximum specific growth rates of the cells were increased to 1.32 d -1 , 0.45 d -1 , 0.48 d -1 respectively.

[0075] Example 4: Cell morphology differences of the CsrA overexpressing strain

[0076] Take the recombinant strains of Acidithiobacillus thermophilum WT(pJD215-CsrA) and WT(pJD215) prepared in Example 2 for subsequent experiments.

[0077] In the genome of A. caldus MTH-04, the csrA gene is located within the flagellar gene cluster, surrounded by more than 40 genes related to flagella and chemotaxis, such as Figure 6 shown in A. To further explore the effects of overexpression of CsrA protein on cell motility and flagellar structure, transmission electron microscopy (TEM) was used to observe bacterial flagella and cell morphology. The steps are as follows:

[0078] (1) Take two strains of acidophilic and thermophilic thiobacilli cultured to the logarithmic growth phase, and spread them on Starkey-Na 2 S 2 O 3 solid plates and incubate them upside down for 7 days.

[0079] (2) Pick plump single colonies. After fixing with 2.5% (v / v) glutaraldehyde for 0.5 h, fix with 1.25% (v / v) agar, and then soak the cell sections in PBS solution containing 2.5% (v / v) glutaraldehyde for 0.5 h and 1% (v / v) osmium tetroxide for 1 h respectively. Wash the sections with ultrapure water, soak them in 1% (v / v) uranyl acetate solution for 1 h, dehydrate using an ethanol gradient, and finally implant the agar sections stained with epoxy resin. Observe the samples by TEM (H-7650, Hitachi, Ltd., Japan). The results are as Figure 6 shown.

[0080] The results showed that at different magnifications of the scanning electron microscope ( Figure 6 in B, C, D, E, F, and G), compared with the morphology of wild-type cells, there were mainly three differences in the overexpressing cells: the morphology changed from short rod-shaped to slender; the number of flagella increased; and the extracellular secretions increased. The length of the WT(pJD215-CsrA) strain increased by 36.37% compared with the wild type, the width decreased, and the cell morphology changed from oval and plump to slender.

[0081] Example 5: Effect of overexpression of CsrA on the biofilm of A. caldus

[0082] Take the recombinant strains of acidophilic and thermophilic thiobacilli WT(pJD215-CsrA) and WT(pJD215) prepared in Example 2 for subsequent experiments.

[0083] To further explore the effect of overexpression of CsrA protein on the biofilm of A. caldus, three-dimensional fluorescence spectroscopy was used to analyze two biofilm samples formed on sulfur tablets. The steps are as follows:

[0084] (1) Use the sulfur tablet method to culture and obtain biofilms. Adjust the OD of A. caldus grown to the logarithmic phase 600 = 1.0. Transfer it to Starky-S containing sulfur tablets according to an inoculation amount of 2%0 In the liquid medium, static culture was carried out for 6 days. The sulfur flakes were taken out, gently washed twice with PBS buffer, air-dried, and then 1 mL of 33% glacial acetic acid was added to dissolve the biofilm.

[0085] (2) The 3D-EEM spectrum of the sample was measured using an F-7000 fluorescence spectrophotometer. The ranges of the excitation wavelength (Ex) and the scanning wavelength (Em) were set as: 200 - 600 nm, the increment was 5 cm, and the scanning speed was 12,000 nm·min -1 . Using 33% glacial acetic acid as the blank control, Rayleigh scattering was removed by shearing and baseline calibration in Matlab software to generate 3D-EEM pictures. The results are as Figure 7 shown in A below.

[0086] (3) According to different excitation and emission wavelengths, the biofilm components were divided into 5 regions: Region I, tyrosine of aromatic protein substances; Region II, tryptophan of aromatic protein substances; Region III, fulvic acid or humic acid substances; Region IV, SMP (soluble microbial by-products); Region V, humic acid substances. The three-dimensional fluorescence spectrum was integrated using the fluorescence region integration method to analyze the content of substances in different regions. The results are as Figure 7 shown in B below.

[0087] The results showed that in the WT strain, the proportions of Regions I - V were: 2.90%, 1.50%, 11.52%, 68.66%, 15.50% in sequence; in the WT(pJD215-csrA) strain, the proportions were: 1.10%, 1.0%, 7.30%, 72.19%, 18.40% in sequence. Compared with the WT strain, the protein substances in Regions I and II of the overexpressing strain were basically unchanged, the fulvic acid substances decreased, and the soluble microbial by-products and humic acids increased.

[0088] Example 6: Difference in the intracellular free amino acid levels of the CsrA overexpressing strain

[0089] The recombinant strains of Acidithiobacillus caldus WT(pJD215-CsrA) and WT(pJD215) prepared in Example 2 were taken for subsequent experiments.

[0090] Based on the possible regulatory function of CsrA, it was speculated that in A. caldus, CsrA might adapt to environmental changes by regulating branched-chain amino acids, amino acids related to nitrogen metabolism, and amino acids related to signal transduction and cell functions. To further explore the effect of CsrA protein overexpression on the environmental adaptability of A. caldus, the intracellular free amino acid contents of WT(pJD215-CsrA) and WT(pJD215) were measured, including the following steps:

[0091] (1) After activating the wild-type and overexpressing strains, single colonies were selected and cultured until the logarithmic growth phase.

[0092] (2) Cells with a wet weight of approximately 1.0 g were collected by centrifugation, washed 2 - 3 times with PBS buffer, and then resuspended thoroughly in 1 mL of PBS buffer. They were incubated in boiling water for 15 min, centrifuged, and the supernatant was taken. 1 mL of 10% trichloroacetic acid solution was added to the supernatant, mixed well, and left standing for 10 min. After centrifugation again, the supernatant was taken. After filtration through a 0.22 μm filter membrane, the intracellular free amino acid content was determined by high performance liquid chromatography (HPLC). The results are as Figure 8 shown.

[0093] The results showed that compared with WT, the contents of aspartic acid and glutamic acid in the overexpressing strain increased by 7.05 mg / L and 3.73 mg / L respectively, which helped to increase the acid tolerance of cells, thus promoting cell survival. The contents of some basic amino acids, such as histidine and arginine, also increased slightly, which helped to buffer the intracellular pH.

[0094] The embodiments provided above are not intended to limit the scope covered by the present invention, nor are the described steps intended to limit the order of their execution. Obvious improvements made by those skilled in the art in combination with the existing common general knowledge also fall within the protection scope defined by the claims of the present invention.

Claims

1. An engineered bacterium of the acidophilic thermophilic thiobacillus having improved acid stress resistance, characterized in that: The acidophilic and thermophilic Thiobacillus engineered bacteria overexpresses the carbon storage regulatory protein CsrA.

2. The acidophilic thermophilic thiobacillus engineered bacteria according to claim 1, characterized in that The amino acid sequence of the carbon storage regulatory protein CsrA is shown in SEQ ID NO.

1.

3. The acidophilic thermophilic thiobacillus engineered bacteria according to claim 1 or 2, characterized in that The carbon storage regulatory protein CsrA is expressed by a promoter whose nucleotide sequence is shown in SEQ ID NO.

2.

4. The acidophilic thermophilic thiobacillus engineered bacteria according to claim 1, characterized in that The nucleotide sequence of the carbon storage regulatory protein CsrA is shown in SEQ ID NO.

3.

5. The acidophilic thermophilic thiobacillus engineered bacteria according to claim 1 or 2, characterized in that: The acidophilic and thermophilic Thiobacillus engineering bacteria uses pJD215 as an overexpression vector.

6. The acidophilic thermophilic thiobacillus engineered bacterium according to claim 1 or 2, characterized in that: The host of the acidophilic thermothiobacillus engineered bacteria is acidophilic thermothiobacillus A.caldus MTH-04.

7. A method for preparing the engineered bacteria of Acidophilic Thermothiobacillus according to any one of claims 1 to 6, characterized in that: The method comprises the following steps: connecting the carbon storage regulatory factor csrA and the promoter to the plasmid, transferring the plasmid into the competent state of Escherichia coli, and then transferring the plasmid into the acidophilic thermophilic sulfur bacillus host through conjugation transfer.

8. Application of a carbon storage regulatory protein CsrA in improving the acid stress resistance of Thermothiobacillus acidophilus.

9. The use according to claim 8, characterized in that: The amino acid sequence of the carbon storage regulatory protein CsrA is shown in SEQ ID NO.

1.

10. Use of the engineered bacteria of the acidophilic thermothiobacillus according to any one of claims 1 to 6 in biological mining.