Antibiotic-free host-plasmid TA maintenance system and application thereof

Abstract

The invention provides an antibiotic-free host-plasmid TA maintenance system and application thereof, and relates to the technical field of gene engineering. According to the invention, a toxin gene CcdB is accurately integrated to a host escherichia coli chromosome fhuA site through a gene editing technology, and accurate control of toxin expression is realized by adopting an inducible promoter. The antitoxin gene is simplified to a plasmid skeleton, and the toxin inhibition function is maintained through constitutive expression. According to the method, plasmid-free cells are eliminated through arabinose-induced toxin expression, so that stable maintenance of plasmids is realized (the loss rate is lt; and the method completely avoids the use of antibiotics, meets the biological safety requirements, is suitable for large-scale production of vaccines, recombinant proteins and other biological products, and has the advantages of high plasmid yield, low environmental leakage risk, process compatibility and the like.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly relates to an antibiotic-free host-plasmid TA maintenance system and its application. Background Art

[0002] As an important tool for genetic engineering and synthetic biology research, the technology for efficient and safe preparation of plasmids has always been the core requirement in the field of biotechnology. Traditional plasmid production generally relies on antibiotic resistance genes (such as ampicillin resistance gene) for screening, and ensures the stable maintenance of plasmids in host bacteria through antibiotic selection pressure. However, this method has significant defects: firstly, antibiotic residues may contaminate downstream biological products (such as vaccines, recombinant proteins), increase the complexity of the purification process, and pose safety hazards in clinical applications; secondly, the environmental release risk of antibiotic resistance genes may accelerate the spread of drug resistance, leading to ecological safety problems, and relevant regulations (such as WHO and FDA guidelines) have become increasingly strict in restricting such technologies. Although there are alternative screening strategies (such as auxotrophic marker systems), their screening efficiency is low and the host adaptability is poor, making it difficult to meet the requirements of industrial production.

[0003] The toxin-antitoxin (TA) system, as a potential alternative to antibiotic screening, realizes plasmid stable maintenance through the killing effect of the toxin gene on plasmid-free hosts. However, the low and persistent expression of the toxin gene in traditional TA systems may inhibit the growth of host bacteria, resulting in a decrease in plasmid yield, and the system leakage risk is relatively high. In addition, conventional TA systems lack a dynamic regulation mechanism and are difficult to balance the toxin expression intensity and host survival rate, which limits their application in large-scale production.

[0004] In view of the above problems, there is an urgent need in the prior art for an innovative solution that can avoid the risk of antibiotic use and achieve efficient and stable maintenance of plasmids. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide an antibiotic-free host-plasmid TA maintenance system and its application. By dynamically regulating the expression of the toxin gene, optimizing the resistance and anti-phage ability of host bacteria, a safe and efficient antibiotic-free plasmid production system is constructed to overcome the limitations of traditional technologies and meet the urgent needs of the biopharmaceutical and synthetic biology fields for green bio-manufacturing technologies.

[0006] To solve the above technical problems, the present invention provides the following technical solutions:

[0007] In the first aspect, the present invention provides an antibiotic-free host-plasmid TA maintenance system, comprising:

[0008] A host strain with a toxin gene expression cassette integrated into its chromosome, said toxin gene expression cassette comprising a toxin gene CcdB and its regulatory elements;

[0009] A plasmid, comprising an antitoxin gene expression cassette, a high-copy replication origin, and a multiple cloning site MCS, said antitoxin gene being CcdA(41) and expressed by a constitutive promoter;

[0010] The toxin gene expression cassette is integrated into the fhuA gene locus of the host strain chromosome.

[0011] Preferably, the host strain is Escherichia coli GT115. The genotype of the GT115 strain contains a Δ(ara-leu)7697 mutation, which can limit the background expression of the arabinose promoter and provide better tolerance to the CcdB gene expression cassette as a toxic gene.

[0012] Preferably, the toxin gene expression cassette is integrated into the fhuA gene locus of the host bacterium through the CRISPR-Cas9 system; the fhuA mutation confers natural resistance to T1 and T5 phages.

[0013] Preferably, the regulatory element of the toxin gene is the arabinose-inducible promoter araBAD.

[0014] Preferably, the antitoxin gene is a truncated CcdA gene, encoding 41 amino acid residues.

[0015] Preferably, the antitoxin gene CcdA is regulated by the constitutive promoter EM7.

[0016] Preferably, the ribosome binding site (SD sequence) of the toxin gene is designed to be weakened.

[0017] Preferably, the nucleotide sequence of the weakened SD sequence is as shown in SEQ ID NO.1.

[0018] In a second aspect, the present invention provides the application of the system described in the first aspect in the large-scale production of vaccines, recombinant proteins, or gene therapy vectors.

[0019] Advantages of the present invention:

[0020] By the dynamic regulation of the toxin-antitoxin (TA) system and the adaptation modification of the host bacterium genome, the present invention solves the core problems of traditional plasmid production technology relying on antibiotics and the low efficiency of conventional TA systems, specifically as follows:

[0021] 1. In the present invention, the CcdB toxin gene is placed downstream of the arabinose-inducible promoter (araBAD), combined with a weakened ribosome binding site (SD sequence), significantly reducing the basal expression level. The toxin is highly expressed only upon arabinose induction, breaking through the bottleneck that the continuous leakage of the toxin in the conventional TA system inhibits the growth of the host. Both the host survival rate and plasmid yield are greatly improved, and the plasmid loss rate is <1% by inducing the elimination of plasmid-free cells.

[0022] 2. The present invention selects the GT115 strain (containing the Δ(ara-leu)7697 mutation) to inhibit the basal activity of araBAD, and integrates the CcdB expression cassette at the fhuA gene locus through the CRISPR-Cas9 system, resulting in the loss of fhuA function and endowing the host with natural resistance to T1 / T5 phages; greatly reducing the risks of phage contamination and environmental leakage, improving the stability of continuous passage of the host, and being suitable for industrial scale-up production.

[0023] 3. The constitutively expressed antitoxin CcdA in the plasmid of the present invention neutralizes the toxin activity in real time, and a high-copy replication origin is used to increase the plasmid yield; under the condition of no antibiotic, the plasmid has advantages in both stability and yield, and the downstream purification process is simplified, fully meeting the regulatory requirements of WHO / FDA for no resistance residue in biological products. Description of the Drawings

[0024] Figure 1 It is a schematic diagram of the donor plasmid structure.

[0025] Figure 2 It is a schematic diagram of the antitoxin gene plasmid.

[0026] Figure 3 It is a gene editing map of the host strain.

[0027] Figure 4 It is an agarose gel electrophoresis map of the amplification product in Example 2.

[0028] Figure 5 It is the detection of the CcdB expression level induced by arabinose (colony growth data).

[0029] Figure 6 It is a graph of the experimental results of plasmid stability test without antibiotic (induced by 1% L-ara).

[0030] Figure 7-1 It is an agarose gel electrophoresis map of the plasmid extracted under kan antibiotic.

[0031] Figure 7-2 It is an agarose gel electrophoresis map of the plasmid extracted with 1% arabinose.

[0032] Figure 7-3Agarose gel electrophoresis pattern of plasmid extraction from Mach1-T1 bacteria cultured in antibiotic-free LB with 1% arabinose. Detailed implementation manners

[0033] The technical solutions of the present invention will be further described below through specific implementation manners. Those skilled in the art should understand that the described embodiments are only for helping to understand the present invention and should not be regarded as specific limitations on the present invention.

[0034] For those not specifying specific techniques or conditions in the embodiments, they shall be in accordance with the techniques or conditions described in the literature in this field or in accordance with the product specifications. For reagents or instruments not specifying the manufacturer, they are all conventional products that can be obtained through regular channels.

[0035] Example 1: Plasmid construction

[0036] 1. Design specific primers for amplifying the CcdB toxin gene fragment containing a weakened SD sequence, and the weakened SD sequence is as shown in SEQ ID NO.1.

[0037] SEQ ID NO.1: acccgtttttttgggctagcgattgaaaacg

[0038] 2. Insert the arabinose-inducible promoter araBAD into the vector ptarget-F through SpeI and EcoRI restriction enzyme sites, and connect the above CcdB gene fragment downstream to construct a toxin expression module. The final synthesized donor plasmid structure is as Figure 1 , and the synthesized sequence is as shown in SEQ ID NO.2.

[0039] 3. Connect the antitoxin gene CcdA41 with the constitutive promoter EM7 and clone it into the EcoRV site of the vector Puc57 to form an antitoxin gene plasmid ( Figure 2 ), and the synthesized sequence is as shown in SEQ ID NO.3.

[0040] 4. Plasmid verification: Confirm the correctness of the promoter, SD sequence and gene by Sanger sequencing, and the sequencing coverage rate reaches 100%.

[0041] Example 2: Host bacterium modification - introducing the CcdB gene by fhuA mutation

[0042] Use the CRISPR-Cas9 system to introduce the CcdB gene expression framework into fhuA in Escherichia coli GT115, and the gene editing map is as Figure 3 shown.

[0043] Prepare electrocompetent cells of strain GT115, transform the Cas9 plasmid into GT115 cells, spread the bacterial solution on a kanamycin-resistant plate, and culture it at a constant temperature of 37°C; the next day, pick monoclonal colonies for PCR verification. Prepare electrocompetent cells from the positive clones (induced with arabinose), and name them GT115-Cas9. Transform the donor plasmid prepared in Example 1 into GT115-Cas9 cells, spread the bacterial solution on a kanamycin + spectinomycin-resistant plate (add glucose with a final concentration of 1% to the plate), and culture it at a constant temperature of 37°C overnight; the next day, pick monoclonal colonies for colony PCR verification and scale-up culture (the reaction system is shown in Table 1). Use primers to amplify the target gene, and perform agarose gel electrophoresis ( Figure 4 ) Recover and purify the PCR product, and sequence the recovered DNA for verification.

[0044] Table 1

[0045] Primer-F 1ul Primer-R 1ul Appropriate single colony culture broth 5ul 1.25X PCR mix (Huoxun Biotechnology) 28ul <![CDATA[ddH 2 O]]> - Total 35ul

[0046] Transfer the correct mutant strain from the above step to a solid medium supplemented with Kan and rhamnose, and culture it at a constant temperature of 37°C overnight; the next day, pick monoclonal colonies into a Kan-resistant liquid medium, culture it at a constant temperature of 37°C for 6 hours, and then transfer it to a spectinomycin-resistant liquid medium. Screen for clones with Kan resistance but no spectinomycin resistance, dilute the bacterial solution and spread it on an antibiotic-free LB solid medium containing sucrose, and culture it at a constant temperature of 37°C overnight (if necessary, the above two plasmid removal steps can be passaged multiple times); the next day, pick monoclonal colonies onto an antibiotic-free liquid medium, culture it at a constant temperature of 37°C for 6 hours, and then transfer it to a Kan-resistant liquid medium; screen for clones without Kan resistance, spread them on antibiotic-free, Kan-resistant, and spectinomycin-resistant plates, and culture it at a constant temperature of 37°C overnight; if the resistance has been completely removed, use the preset upstream and downstream primers of the target gene (Primer-F, Primer-R), recover and purify the PCR product by agarose gel electrophoresis, sequence the recovered DNA for verification, and a sequencing result consistent with the designed sequence indicates successful strain modification.

[0047] Primer-F (SEQ ID NO.4): cgctatagctgaagtaaggtgttacacc

[0048] Primer-R (SEQ ID NO.5): gatgatgacggtgtttactcttatcgc

[0049] Example 3: System Function Verification

[0050] 1. Detection of expression level:

[0051] Screen for a reasonable induction level (0.5% - 1%) through an arabinose gradient, indicating that the modified toxin gene has antibacterial effects.

[0052] As Figure 5 shown, there is no significant difference in colony size between the modified strain and the ordinary strain on the plate without antibiotics and without arabinose; the colonies of the modified strain are tiny on the 0.5% arabinose plate and difficult to detect with the naked eye; no growth is observed for the colonies of the modified strain on the 1% arabinose plate.

[0053] 2. Toxin induction experiment:

[0054] Culture the strain containing the CcdA plasmid in a medium containing 1% arabinose and detect the tolerance of the bacteria. The experimental results are as Figure 6 shown. The colonies containing the CcdA plasmid are the same size as ordinary colonies on the plate, indicating that CcdA has a detoxifying effect.

[0055] 3. Plasmid stability test:

[0056] Subculture once (without antibiotics) in a medium containing 1% arabinose, and calculate the retention rate (>99%) by PCR electrophoresis.

[0057] After transforming the CcdA plasmid into the modified GT115-ccdb strain in Example 2, coat it on an LB solid medium containing 1% arabinose. Extract 8 colonies from the plate for induction culture (LB medium without antibiotics containing 1% arabinose), and perform bacterial liquid PCR verification.

[0058] 1) Culture the 8 colonies separately in LB medium with Kan antibiotic, extract the plasmids for electrophoresis, and the results are as Figure 7-1 shown;

[0059] 2) Culture the 8 colonies separately in LB medium without antibiotics containing 1% arabinose, extract the plasmids for electrophoresis, and the results are as Figure 7-2 shown;

[0060] 3) Set up a control group experiment. Transform the CcdA plasmid into mach1-T1 bacteria, culture them in LB medium with Kan antibiotic, pick 8 colonies for detection, and after passing the test, culture them in LB medium without antibiotics containing 1% arabinose, extract the plasmids for electrophoresis, and the results are as Figure 7-3 shown;

[0061] In summary, as Figure 7-1 、 7-2 、7-3 shown, the plasmid electrophoresis is clear, indicating that the strain of the present invention has the ability to stably retain the plasmid without resistance pressure.

[0062] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. An antibiotic-free host-plasmid TA maintenance system, characterized in that: include: A host strain having a toxin gene expression cassette integrated into its chromosome, wherein the toxin gene expression cassette comprises the toxin gene CcdB and its regulatory elements; A plasmid comprising an antitoxin gene expression cassette, a high copy replication origin and a multiple cloning site MCS, wherein the antitoxin gene is CcdA (41) and is expressed by a constitutive promoter; The toxin gene expression frame is integrated into the chromosome fhuA gene site of the host strain.

2. The system according to claim 1, characterized in that The host strain is Escherichia coli GT115.

3. The system according to claim 1, characterized in that The toxin gene expression frame is integrated into the host bacteria fhuA gene site through the CRISPR-Cas9 system.

4. The system according to claim 1, characterized in that The regulatory element of the toxin gene is the arabinose-inducible promoter araBAD.

5. The system according to claim 1, characterized in that The antitoxin gene is a truncated CcdA gene, encoding 41 amino acid residues.

6. The system according to claim 1, characterized in that The antitoxin gene CcdA is regulated by the constitutive promoter EM7.

7. The system according to claim 1, characterized in that The ribosome binding site (SD sequence) of the toxin gene is weakened by design.

8. The system according to claim 7, characterized in that The nucleotide sequence of the weakened SD sequence is shown as SEQ ID NO.

1.

9. Use of the system according to any one of claims 1 to 8 in the large-scale production of vaccines, recombinant proteins or gene therapy vectors.

Images