Preparation method of oligodendrocyte precursor cells
By differentiating human pluripotent stem cells in nerve induction medium and collagen environment to form oligodendrocyte precursor cells, the problems of long differentiation time, complex steps and heterologous components in the prior art are solved, and efficient and simplified OPC preparation is achieved, which is suitable for clinical applications.
Patent Information
- Application Number
- CN202311710778.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-13
- Publication Date
- 2025-06-13
AI Technical Summary
The prior art has problems such as long differentiation time, complex steps, huge expense, and the induction environment in the induction environment induction of oligodendrocyte precursor cells from human pluripotent stem cells, which limits its use in clinical applications.
Human pluripotent stem cells were suspended and differentiated under the action of nerve induction medium and seeded on collagen. Neural precursor cells were first formed, and then differentiated and cultured in oligodendrocyte precursor cell induction medium. The differentiation steps were simplified, differentiation time was shortened, and OPC yield was increased.
It has achieved the shortening of differentiation time, simplification of steps, and improvement of yield, and avoided the use of heterologous components, reduced costs, and is suitable for clinical applications.
Smart Images

Figure CN120137901A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of cell biology, and in particular, to a method for preparing oligodendrocyte precursor cells. Background Art
[0002] Demyelinating diseases refer to neurological diseases characterized by the loss of myelin sheaths, which can occur in the peripheral nervous system and the central nervous system. Such diseases include adult acquired myelin disorders, such as multiple sclerosis, white matter stroke, cerebral palsy, Parkinson's disease, spinal cord injury, and neuromyelitis optica. Demyelinating diseases are one of the most common and disabling diseases in neurology, and the incidence of multiple sclerosis alone in young people is significantly higher than that of other neurological diseases. Demyelination is usually the result of a direct attack on oligodendrocytes, which are the cells that produce and maintain the myelin sheath. This type of demyelination is sometimes referred to as primary demyelination to distinguish it from secondary demyelination (or Wallerian degeneration), in which the myelin sheath degenerates as a result of primary axonal loss.
[0003] Myelin regeneration can restore saltatory conduction and recover the normal functions lost during the demyelination process. Unfortunately, spontaneous remyelination in the adult central nervous system (CNS) is usually incomplete, and this failure of remyelination is one of the main causes of the clinical deficits in demyelinating diseases. Myelin regeneration requires oligodendrocyte precursor cells (OPCs) to migrate to the damaged area and differentiate into oligodendrocytes to form myelin sheaths, and this process is affected in demyelinating diseases. The factors affecting spontaneous myelin regeneration can be divided into two major categories: non-disease-related factors and disease-related factors. Non-disease-related factors such as age, genetic background, and gender, among which age seems to have the most influence on the progression of the disease. All regeneration processes decline with age, mainly due to the decline in the function of adult stem cells and progenitor cells.
[0004] Therefore, due to the endogenous myelin regeneration disorder in demyelinating diseases, a treatment method that can effectively promote myelin regeneration is needed. Oligodendrocytes are crucial for myelin regeneration, and oligodendrocytes are a cell population derived from oligodendrocyte precursor cells. Therefore, the use of OPC transplantation therapy is considered to be one of the most suitable strategies for treating demyelinating diseases. Pluripotent stem cells have become the main source of OPCs because they can be amplified on a large scale and the differentiation technology is relatively mature, meeting the requirements for future clinical applications in terms of quantity.
[0005] Currently, the most widely used method for inducing oligodendrocyte progenitor cells from human pluripotent stem cells is the EB method, such as the methods of WANG J (CD133 / CD140a-based isolation of distinct human multipotent neural progenitor cells and oligodendrocyte progenitor cells), DOUVARAS P (Generation and isolation of oligodendrocyte progenitor cells from human pluripotent stem cells), NISTOR G I (Human embryonic stem cells differentiate into oligodendrocytes in high purity and myelinate after spinal cord transplantation), etc. However, it still faces problems such as complex differentiation processes, long differentiation times, high costs, and the presence of heterologous components in the induction environment, which limit its clinical application. However, the emergence of the method of differentiating human pluripotent stem cells into neural stem cells and then into oligodendrocyte progenitor cells, such as the method of Assetta (Generation of Human Neurons and Oligodendrocytes from Pluripotent Stem Cells for Modeling Neuron-Oligodendrocyte Interactions), has greatly shortened the differentiation time. However, in their method, due to the certain adverse effects of DMSO on cells (DMSO induces drastic changes in human cellular processes and epigenetic landscape in vitro), in addition, there are also problems such as neurotoxicity and the use of Matrigel as an animal-derived component, which is not conducive to clinical use. Type I collagen can rapidly and effectively promote the differentiation of neural progenitor cells (Efficient induction of neural progenitor cells from human ESC iPSCs on Type I Collagen), and can replace the role of DMSO. However, due to the weak cell adhesion, irregular blackened cell clusters are easily formed during the differentiation process, resulting in necrosis of the cells in the center, reducing the utilization rate of cells and the acquisition rate of neural progenitor cells. Summary of the Invention
[0006] In view of the deficiencies in the prior art, the object of the present invention is to provide a method for preparing oligodendrocyte progenitor cells. In this method, human pluripotent stem cells are suspended and differentiated under the action of a neural induction medium, and then seeded on collagen. First, neural progenitor cells are formed under the action of the neural induction medium, and then differentiated and cultured into oligodendrocyte progenitor cells under the action of an oligodendrocyte progenitor cell induction medium, achieving the purpose of shortening the differentiation time, simplifying the differentiation steps, and increasing the yield of OPCs.
[0007] The present invention provides a method for preparing oligodendrocyte progenitor cells, comprising the following steps:
[0008] S1. Neural progenitor cell induction stage;
[0009] S11. Digest pluripotent stem cells into single cells using Accutase enzyme, and seed the obtained single cells into a low-attachment culture vessel with a neural induction medium and culture until cell spheres with a diameter of 50-100 μm are formed; wherein, Y27632 is added to the neural induction medium.
[0010] S12. Centrifuge to collect the cell spheres, resuspend them with the neural induction medium, and continue to culture in a low-attachment culture vessel for 2-3 days.
[0011] S13. Centrifuge to collect the cell spheres, resuspend them with the neural induction medium, seed them on a collagen-coated culture dish, and culture for 1-2 days.
[0012] S2. Oligodendrocyte progenitor cell induction stage: Mechanically pipette the adherent white cell clusters on the culture dish in step S13, centrifuge to collect the cell clusters, digest them into single cells using Accutase, centrifuge to collect the single cells obtained from digestion, add an oligodendrocyte progenitor cell induction medium containing Y27632, seed them in a collagen-coated culture dish, and after the cells adhere, change to an oligodendrocyte progenitor cell induction medium without Y27632 and continue to culture for at least 6 days to obtain oligodendrocyte progenitor cells; it is acceptable if early OPC morphology (bipolar or tripolar morphology) appears at 6 days.
[0013] In the method for preparing oligodendrocyte precursor cells provided by the present invention, human pluripotent stem cells are suspended and differentiated under the action of a neural induction medium, and then inoculated on collagen. First, neural precursor cells are formed under the action of the neural induction medium, and then differentiated and cultured into oligodendrocyte precursor cells under the action of an oligodendrocyte precursor cell induction medium, further shortening the differentiation time and increasing the yield of OPCs. In the prior art, during the induction and differentiation process, due to poor cell adhesion, irregular blackened cell clusters are easily formed during differentiation, resulting in necrosis of the cells in the central part and reducing the cell yield. The present invention solves the problem of necrosis of the cells in the central part caused by the easy formation of irregular blackened cell clusters by first inducing the cells to be suspended and differentiated with a neural induction medium. The prior art uses the method of DMSO pretreatment to promote cell differentiation. DMSO has an adverse effect on cells and is not conducive to production. The present invention effectively promotes the differentiation of neural precursor cells by using collagen, replacing the role of DMSO and not affecting the differentiation of oligodendrocyte precursor cells. Therefore, the steps are further simplified. The prior art has problems such as a long differentiation time, the need to purchase an induction kit at great cost, and the presence of heterologous components in the induction environment during the induction and differentiation process, which are not conducive to clinical research and use. The present invention realizes simple operation, low cost, further shortened induction time, and no heterologous components in the induction environment by briefly forming a neural precursor cell intermediate and combining collagen to differentiate oligodendrocyte precursor cells.
[0014] In one embodiment of the present invention, in step S11, the neural induction medium comprises the following components: DMEM / F12 (1:1), 0.5%-2% N 2 , 0.5%-1.5% penicillin-streptomycin.
[0015] In one embodiment of the present invention, in step S11, the neural induction medium comprises the following components: DMEM / F12 (1:1), 1% N 2 , 1% penicillin-streptomycin.
[0016] In one embodiment of the present invention, in step S11, in the neural induction medium, the concentration of Y27632 is 5-15 μM.
[0017] In one embodiment of the present invention, in step S11, in the neural induction medium, the concentration of Y27632 is 8-12 μM.
[0018] In one embodiment of the present invention, in step S11, in the neural induction medium, the concentration of Y27632 is 10 μM.
[0019] In one embodiment of the present invention, in step S11, the seeding amount of single cells is 0.5-5×10 6 / ml.
[0020] In one embodiment of the present invention, in step S11, the seeding amount of single cells is 0.8 - 3×10 6 / ml.
[0021] In one embodiment of the present invention, in step S11, the seeding amount of single cells is 1 - 2×10 6 / ml.
[0022] In one embodiment of the present invention, in step S2, the oligodendrocyte progenitor cell induction medium comprises the following components: DMEM / F12, 0.5% - 2% B27, 0.5% - 2% N 2 , 10 - 30 ng / ml bFGF, 10 - 30 ng / ml PDGF - AA, 0.5 - 2 μM SAG, 1 - 3 μg / ml Heparin, 0.5% - 1.5% penicillin - streptomycin.
[0023] In one embodiment of the present invention, in step S2, the oligodendrocyte progenitor cell induction medium comprises the following components: DMEM / F12, 1% B27, 1% N 2 , 20 ng / ml bFGF, 20 ng / ml PDGF - AA, 1 μM SAG, 2 μg / ml Heparin, 1% penicillin - streptomycin.
[0024] In one embodiment of the present invention, the collagen in step S13 and the collagen in step S2 are both human - derived collagen.
[0025] In one embodiment of the present invention, the collagen in step S13 is at least one of type I collagen, type II collagen, type III collagen, type IV collagen, type V collagen, and type VI collagen;
[0026] The collagen in step S2 is at least one of type I collagen, type II collagen, type III collagen, type IV collagen, type V collagen, and type VI collagen.
[0027] In one embodiment of the present invention, in step S2, the single cells obtained by digestion are passaged and inoculated for culture at a ratio of 0.2 - 1×10 5 cells / cm 2 in a 1:2 ratio.
[0028] In one embodiment of the present invention, in step S2, the single cells obtained by digestion are passaged and inoculated for culture at a ratio of 0.5×10 5 cells / cm 2 in a 1:2 ratio.
[0029] In one embodiment of the present invention, in step S2, the digested single cells are induced to differentiate into oligodendrocyte precursor cells under a hypoxic environment.
[0030] In one embodiment of the present invention, the hypoxic environment is an environment with an oxygen concentration of 3% - 5%.
[0031] In one embodiment of the present invention, the hypoxic environment is an environment with an oxygen concentration of 3%.
[0032] In one embodiment of the present invention, the neural induction medium is a xeno - free neural induction medium or a human - derived neural induction medium.
[0033] In one embodiment of the present invention, in step S11, the human pluripotent stem cells include human embryonic stem cells (ESC), human embryonic germ cells, cells with functions and morphologies similar to human embryonic stem cells, human stem cells with multi - directional differentiation potential, or human induced pluripotent stem cells (iPSC).
[0034] Compared with the prior art, the embodiments of the present invention have the following beneficial effects:
[0035] 1. In the prior art, during the induction and differentiation process, due to poor cell adhesion, irregular blackened cell clusters are easily formed during differentiation, resulting in necrosis of the cells in the central part, reducing the cell yield. In the preparation method provided by the present invention, by first inducing cell suspension differentiation with a neural induction medium, the problem of easily forming irregular blackened cell clusters leading to necrosis of the cells in the central part is solved.
[0036] 2. The prior art uses the method of DMSO pretreatment to promote cell differentiation, and DMSO has an adverse effect on cells, which is not conducive to production. In the preparation method provided by the present invention, the use of collagen effectively promotes the differentiation of neural precursor cells, replaces the role of DMSO, and does not affect the differentiation of oligodendrocyte precursor cells, thus further simplifying the steps.
[0037] 3. In the prior art, there are problems such as a long differentiation time, the need to purchase an induction kit at great expense, and the presence of xeno - components in the induction environment during the induction and differentiation process, which is not conducive to clinical research use. The present invention forms a neural precursor cell intermediate briefly and combines with type I collagen to differentiate oligodendrocyte precursor cells, achieving simple operation, low cost, further shortening of the induction time, and a xeno - free induction environment during the induction and differentiation culture process.
[0038] 4. In the preparation method of oligodendrocyte precursor cells provided by the present invention, Heparin is added to the oligodendrocyte precursor cell induction medium, enhancing the interaction between bFGF and bFGFR and further improving the differentiation efficiency.
[0039] 5. The method for preparing oligodendrocyte precursor cells provided by the present invention is heterologous-free, low-cost, simple to operate, and can rapidly differentiate. A large number of oligodendrocyte precursor cells can be stably obtained within two weeks, and the prepared oligodendrocyte precursor cells can be used for the production of cell therapy products.
[0040] Of course, it is not necessary for any product implementing the present invention to simultaneously achieve all the above-mentioned advantages. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] By reading the following detailed description of non-limiting embodiments with reference to the accompanying drawings, other features, objects, and advantages of the present invention will become more apparent:
[0042] Figure 1 It is the morphological diagram of each stage of hiPSC-OPC differentiation in Example 1;
[0043] Figure 2 It is the gel electrophoresis diagram of RT-PCR detection of the marker genes Olig2, SOX10, PDGFRα, and NG2 of hiPSC-OPC in Example 1;
[0044] Figure 3 It is the immunofluorescence detection diagram of NG2 and PDGFRα, the markers of hiPSC-OPC at the end of differentiation in Example 1;
[0045] Figure 4 It is the morphological diagram of each stage of hESC-OPC differentiation in Example 2;
[0046] Figure 5 It is the gel electrophoresis diagram of RT-PCR detection of the marker genes Olig2, SOX10, PDGFRα, and NG2 of hESC-OPC in Example 2;
[0047] Figure 6 It is the morphological diagram of each stage of hiPSC-OPC differentiation in Example 3;
[0048] Figure 7 It is the gel electrophoresis diagram of RT-PCR detection of the marker genes Olig2, SOX10, PDGFRα, and NG2 of hiPSC-OPC in Example 3;
[0049] Figure 8 For Example 1 Figure 2 and Example 3 Figure 7 It is the gray-scale analysis result diagram. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0050] The present invention will be described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several changes and improvements can still be made. These all fall within the protection scope of the present invention.
[0051] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0052] Example 1: Inducing the differentiation of human induced pluripotent stem cells hiPSC into oligodendrocyte progenitor cells
[0053] Cell line: Human induced pluripotent stem cells hiPSC (purchased from the Cell Resource Center of Shanghai Institute of Life Sciences, Chinese Academy of Sciences).
[0054] Step 1: Neural progenitor cell induction stage
[0055] (1) Digest the adherent hiPSC into single cells using Accutase enzyme, and then add 10 μM Y27632 to the neural induction medium and inoculate at 1 - 2×10 6 / ml into a low-attachment P35 culture dish and culture for 1 day.
[0056] (2) Centrifuge at 800 rpm for 5 minutes to collect cell spheres, add an appropriate amount of neural induction medium to resuspend, and continue to culture in a low-attachment culture vessel for 2 days, and change the medium every other day.
[0057] (3) Centrifuge at 500 rpm for 5 minutes to collect cell spheres, add an appropriate amount of neural induction medium to resuspend, and inoculate on a P35 culture dish coated with type I collagen and culture for 2 days.
[0058] Step 2: Oligodendrocyte progenitor cell induction stage
[0059] Mechanically pipette down the adherent white cell clusters, centrifuge to collect the cell clusters, digest them into single cells using Accutase, centrifuge at 1000 rpm for 5 minutes to collect the cells, add the oligodendrocyte progenitor cell induction medium supplemented with 10 μM Y27632, and inoculate at 0.5×10 5 cells / cm 2 onto a P60 culture dish coated with type I collagen, and culture in an incubator at 37°C, 3% O 2 , 5% CO 2 for 1 day until the cells adhere. On the second day, change to the oligodendrocyte progenitor cell induction medium without Y27632 and continue to culture at 37°C, 3% O 2 , 5% CO 2Cultivate for 6 days in an incubator, change the medium every other day. During this period, when the cell confluence reaches 90%, passage the cells at a ratio of 1:2.
[0060] On the 7th day, obtain the cell morphology diagram using an inverted microscope ( Figure 1 ), and collect the cells for RT-PCR to detect the expression of olig2, SOX10, PDGFRα, and NG2 ( Figure 2 ), and use immunofluorescence staining to detect the expression of PDGFRα and NG2 ( Figure 3 ).
[0061] The specific implementation method of RT-PCR is as follows:
[0062] (1) Total RNA extraction:
[0063] Aspirate the culture medium, wash with 1 mL of PBS, aspirate the PBS and place on ice;
[0064] Prepare RNase-free EP tubes and place on ice;
[0065] Add an appropriate amount of Trizol to blow down the cells, transfer to an EP tube, and let stand for 2 min;
[0066] Add chloroform, shake vigorously for 15 s, and let stand for 3 min (Trizol:chloroform = 5:1);
[0067] Centrifuge at 12000 rpm for 15 min at 4 °C;
[0068] Aspirate the upper aqueous phase into a new EP tube;
[0069] Add isopropanol with a volume ratio of 1:1, vortex for 15 s, mix well, and let stand at room temperature for 30 min;
[0070] Centrifuge at 12000 rpm for 10 min at 4 °C, discard the supernatant, and the RNA precipitates at the bottom of the tube;
[0071] Wash the precipitate twice with 1 ml of 75% DEPC ethanol;
[0072] Centrifuge at 7500 rpm for 5 min at 4 °C, discard the supernatant;
[0073] Air dry at room temperature;
[0074] Add 20 μL of DEPC water to mix well;
[0075] Measure the OD value to quantify the RNA concentration.
[0076] (2) Reverse transcription:
[0077] Prepare the reaction solution according to the following table for reverse transcription (the reverse transcription conditions are 37 °C for 15 min and 85 °C for 5 sec)
[0078] Component Volume 5X PrimeScript Buffer (for Real Time) 2 μL PrimeScript RT Enzyme Mix I 0.5 μL Oligo dT Primer (50 uM) 0.5 μL Random 6mers (100 uM) to 0.5 μL Total RNA 500 ng RNase Free dH20 up to 10 μL
[0079] (3) PCR amplification:
[0080] Prepare the reaction solution according to the following table for PCR amplification (reaction conditions: 98°C for 10 sec, 55°C for 30 sec, 72°C for 1 min.)
[0081]
[0082]
[0083] Among them, the primer information is:
[0084] Primer Name Sequence ACTB-F AGCGAGCATCCCCCAAAGTT ACTB-R GGGCACGAAGGCTCATCATT NG2-F CTGCAGCTCTACTCTGGACG NG2-R TGAGGAGGCGTTCAGAAACC PDGFRα-F GTGGGTTGCACAGAACCCTA PDGFRα-R AGCTTTCGTGGTGACCTCAG SOX10-F AGGCTGCTGAACGAAAGTGA SOX10-R AAGTGGGCGCTCTTGTAGTG OLIG2-F TCGCATCCAGATTTTCGGGT OLIG2-R CCACTGCCTCCTAGCTTGTC
[0085] (4) Gel electrophoresis:
[0086] Prepare a 1*TAE solution containing 2% agarose.
[0087] Add a staining solution at 1:10000, mix well and quickly and steadily pour it into the nucleic acid gel plate. After the nucleic acid gel is completely solidified, pull out the comb, place it in the nucleic acid electrophoresis tank with electrophoresis buffer, load the sample, apply a voltage of 80 V, start electrophoresis, and stop electrophoresis when the sample runs to the middle position, and take a picture with a gel imaging system.
[0088] The specific implementation method of the cell immunofluorescence staining method is as follows: The cells are fixed with 4% paraformaldehyde for 15 min, permeabilized with Triton, and then incubated overnight at 4°C with PDGFRα and NG2 primary antibodies. The next day, the remaining liquid is removed, and the cells are incubated with a fluorescein-labeled secondary antibody in the dark for 1 hour, and then stained with DAPI for 5 min, and photographed under a fluorescence microscope.
[0089] The results showed that starting from the 8th day, some obvious bipolar cells appeared, and on the 12th day, the morphology of a large number of hiPSC-OPC cells showed bipolar morphology, expressing marker genes such as olig2, SOX10, PDGFRα, and NG2, and immunofluorescence staining showed that hiPSC-OPC expressed PDGFRα and NG2 proteins.
[0090] Example 2: Inducing human embryonic stem cells hESC (H1) to differentiate into oligodendrocyte precursor cells
[0091] Cell line: Human embryonic stem cell line H1
[0092] Step 1: Neural precursor cell induction stage
[0093] (4) Digest the adherent hESC (H1) into single cells using Accutase enzyme and then use a neural induction medium supplemented with 10 μM Y27632 at 1 - 2×10 6Inoculate at a density of / ml into a low-attachment P35 culture dish and culture for 1 day.
[0094] (5) Centrifuge at 800 rpm for 5 minutes to collect cell spheres, resuspend with an appropriate amount of neural induction medium, and continue to culture in a low-attachment culture vessel for 2 days, changing the medium every other day.
[0095] (6) Centrifuge at 500 rpm for 5 minutes to collect cell spheres, resuspend with an appropriate amount of neural induction medium, and inoculate on a P35 culture dish coated with type I collagen and culture for 2 days.
[0096] Step 2: Oligodendrocyte progenitor cell induction stage
[0097] Mechanically pipette the adherent white cell clusters, centrifuge to collect the cell clusters, digest them into single cells using Accutase, centrifuge at 1000 rpm for 5 minutes to collect the cells, add oligodendrocyte progenitor cell induction medium supplemented with 10 μM Y27632 at a density of 0.5×10 5 cells / cm 2 Inoculate into a P60 culture dish coated with type I collagen, and culture in an incubator at 37°C, 3% O 2 , 5% CO 2 for 1 day until the cells adhere. On the second day, change to oligodendrocyte progenitor cell induction medium without 10 μM Y27632 and continue to culture in an incubator at 37°C, 3% O 2 , 5% CO 2 for 6 days, changing the medium every other day. When the cell confluence reaches 90% during this period, passage at a ratio of 1:2.
[0098] On the 7th day, obtain the cell morphology diagram using an inverted microscope ( Figure 4 ). From the 8th day, some obvious bipolar cells begin to appear, and on the 12th day, the morphology of a large number of cells shows bipolar morphology. Collect the cells after differentiation and use RT-PCR to detect the expression of the marker genes olig2, SOX10, PDGFRα, and NG2. The results show that hESC-OPC expresses the Olig2, SOX10, PDGFRα, and NG2 genes ( Figure 5 ). Therefore, this method can also be used to induce the differentiation of human embryonic stem cells into OPC.
[0099] In this example, the detection methods corresponding to the above detections are the same as those in Example 1.
[0100] Example 3: Inducing the differentiation of human induced pluripotent stem cells hiPSC into oligodendrocyte progenitor cells
[0101] Cell line: Human induced pluripotent stem cells hiPSC (purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences).
[0102] Step 1: Neural progenitor cell induction stage
[0103] (7) Digest the adherent hiPSCs into single cells using Accutase enzyme, and then add 10 μM Y27632 to the neural induction medium and inoculate them at a density of 1 - 2×10 6 / ml into a low - attachment P35 culture dish and culture for 1 day.
[0104] (8) Centrifuge at 800 rpm for 5 minutes to collect cell spheres, resuspend them with an appropriate amount of neural induction medium, and continue to culture in a low - attachment culture vessel for 2 days, changing the medium every other day.
[0105] (9) Centrifuge at 500 rpm for 5 minutes to collect cell spheres, resuspend them with an appropriate amount of neural induction medium, and inoculate them onto a P35 culture dish coated with type I collagen and culture for 2 days.
[0106] Step 2: Oligodendrocyte progenitor cell induction stage
[0107] Mechanically pipette the adherent white cell clusters, centrifuge to collect the cell clusters, digest them into single cells using Accutase, centrifuge at 1000 rpm for 5 minutes to collect the cells, add 10 μM Y27632 to the oligodendrocyte progenitor cell induction medium and inoculate them at a density of 0.5×10 5 cells / cm 2 onto a P60 culture dish coated with type I collagen I, and culture in an incubator at 37°C, normal oxygen content, and 5% CO 2 until the cells adhere. On the second day, change to the oligodendrocyte progenitor cell induction medium without 10 μM Y27632 and continue to culture in an incubator at 37°C, normal oxygen content, and 5% CO 2 for 6 days, changing the medium every other day. When the cell confluence reaches 90% during this period, passage at a ratio of 1:2.
[0108] Cell morphology images were obtained using an inverted microscope at each stage of induced differentiation, as shown in Figure 6 , the cell death increased after passage on the 8th day, resulting in a relatively sparse cell density on the 12th day, but the cell morphology on the 12th day was similar to that in Figure 1 、 Figure 4 , presenting a typical oligodendrocyte progenitor cell morphology with bipolar or tripolar morphological characteristics. After the differentiation was completed, the cells were collected for RT - PCR to detect the expression of olig2, SOX10, PDGFRα, and NG2. Among them, the detection methods corresponding to the above detections in this example were the same as those in Example 1.
[0109] The RT - PCR results showed that hiPSC - OPC under normal oxygen expressed the Olig2, SOX10, PDGFRα, and NG2 marker genes ( Figure 7), compared with 3% O 2 Condition( Figure 2 ) The brightness of Olig2, SOX10, NG2, and PDGFRα was significantly weakened. According to Figure 2 and Figure 7 The gray-scale analysis and comparison results showed that ( Figure 8 ) It was found that the gene expression levels of Olig2, SOX10, NG2, and PDGFRα in hiPSC-OPC prepared under normoxic conditions were significantly reduced. Therefore, it was shown that although a certain number of OPCs (expressing Olig2, SOX10, NG2, and highly expressing PDGFRα) could also be obtained using this method under normal oxygen concentration, it was recommended to use 3% O 2 Condition.
[0110] All the documents mentioned in the present invention are cited in this application as references, as if each document was cited separately as a reference. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.
[0111] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. Without conflict, the embodiments of this application and the features in the embodiments can be combined with each other arbitrarily.
Claims
1. A method for preparing oligodendrocyte precursor cells, characterized in that, it comprises the following steps: S1. Neural precursor cell induction stage; S11. Digest pluripotent stem cells into single cells using Accutase enzyme, and inoculate the obtained single cells into a low-attachment culture vessel with neural induction medium and culture until cell spheres with a diameter of 50-100 μm are formed; wherein, Y27632 is added to the neural induction medium. S12. Centrifuge to collect the cell spheres, resuspend them with neural induction medium, and continue to culture in a low-attachment culture vessel for 2-3 days. S13. Centrifuge to collect the cell spheres, resuspend them with neural induction medium, and inoculate them on a collagen-coated culture dish and culture for 1-2 days. S2. Oligodendrocyte precursor cell induction stage: Mechanically pipette the adherent white cell clusters on the culture dish in step S13, centrifuge to collect the cell clusters, digest them into single cells using Accutase, centrifuge to collect the digested single cells, add oligodendrocyte precursor cell induction medium containing Y27632, inoculate them in a collagen-coated culture dish, and after the cells adhere, change to oligodendrocyte precursor cell induction medium without Y27632 and continue to culture for at least 6 days to obtain oligodendrocyte precursor cells.
2. The method for preparing oligodendrocyte precursor cells according to claim 1, characterized in that, In step S11, the neural induction medium comprises the following components: DMEM / F12, 0.5%-2% N 2 , 0.5%-1.5% penicillin-streptomycin.
3. The method for preparing oligodendrocyte precursor cells according to claim 2, characterized in that, In step S11, the neural induction medium comprises the following components: DMEM / F12, 1% N 2 , 1% penicillin-streptomycin.
4. The method for preparing oligodendrocyte precursor cells according to claim 1, characterized in that, In step S11, in the neural induction medium, the concentration of Y27632 is 5-15 μM.
5. The method for preparing oligodendrocyte precursor cells according to claim 4, characterized in that, In step S11, in the neural induction medium, the concentration of Y27632 is 8-12 μM.
6. The method for preparing oligodendrocyte precursor cells according to claim 4, characterized in that, In step S11, in the neural induction medium, the concentration of Y27632 is 10 μM.
7. The method for preparing oligodendrocyte precursor cells according to claim 1, characterized in that, In step S11, the inoculation amount of single cells is 0.5 - 5×10 6 / ml.
8. The method for preparing oligodendrocyte precursor cells according to claim 7, characterized in that, In step S11, the inoculation amount of single cells is 0.8 - 3×10 6 / ml.
9. The method for preparing oligodendrocyte precursor cells according to claim 7, characterized in that, In step S11, the inoculation amount of single cells is 1-2×10 6 / ml.
10. The method for preparing oligodendrocyte precursor cells according to claim 1, characterized in that, In step S2, the oligodendrocyte progenitor cell induction medium comprises the following components: DMEM / F12, 0.5%-2% B27, 0.5%-2% N 2 , 10-30 ng / ml bFGF, 10-30 ng / ml PDGF-AA, 0.5-2 μM SAG, 1-3 μg / ml Heparin, 0.5%-1.5% penicillin-streptomycin.
11. The method for preparing oligodendrocyte precursor cells according to claim 10, characterized in that, In step S2, the oligodendrocyte progenitor cell induction medium comprises the following components: DMEM / F12, 1% B27, 1% N 2 , 20 ng / ml bFGF, 20 ng / ml PDGF-AA, 1 μM SAG, 2 μg / ml Heparin, 1% penicillin-streptomycin.
12. The method for preparing oligodendrocyte precursor cells according to claim 1, characterized in that, The collagen in step S13 and the collagen in step S2 are both human-derived collagen.
13. The method for preparing oligodendrocyte precursor cells according to claim 12, characterized in that, The collagen in step S13 is at least one of type I collagen, type II collagen, type III collagen, type IV collagen, type V collagen, and type VI collagen. The collagen in step S2 is at least one of type I collagen, type II collagen, type III collagen, type IV collagen, type V collagen, and type VI collagen.
14. The method for preparing oligodendrocyte precursor cells according to claim 1, wherein, In step S2, the digested single cells are inoculated and cultured by subculture at a ratio of 1:2 at a density of 0.2 - 1×10 5 cells / cm 2 .
15. The method for preparing oligodendrocyte precursor cells according to claim 14, wherein, In step S2, the obtained single cells after digestion are inoculated and cultured for subculture at a ratio of 1:2 at a density of 0.5×10 5 cells / cm 2 .
16. The method for preparing oligodendrocyte precursor cells according to claim 1, wherein, In step S2, the digested single cells are induced to differentiate into oligodendrocyte precursor cells under a hypoxic environment.
17. The method for preparing oligodendrocyte precursor cells according to claim 16, wherein, The hypoxic environment is an environment with an oxygen concentration of 3% - 5%.
18. The method for preparing oligodendrocyte precursor cells according to claim 17, wherein, The hypoxic environment is an environment with an oxygen concentration of 3%.
19. The method for preparing oligodendrocyte precursor cells according to claim 2 or 3, wherein, The neural induction medium is a xeno-free neural induction medium or a human-derived neural induction medium.
20. The method for preparing oligodendrocyte precursor cells according to claim 1, wherein, In step S11, the human pluripotent stem cells include one of human embryonic stem cells, human embryonic germ cells, human stem cells, or human induced pluripotent stem cells.