Recombinant dsRNA-baculovirus and its preparation method and application
By improving the assembly structure of recombinant dsRNA-baculovirus and using AcMNPV expression vector to perform insect RNAi, the off-target and non-target effects of dsRNA were solved, and efficient and safe pest control effects were achieved.
Patent Information
- Application Number
- CN202510601320.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-12
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-05-12
AI Technical Summary
Existing RNAi biopesticides have problems with off-target, non-target effects and high cost of dsRNA in pest control, and traditional methods may pose risks to environmental and biosafety.
Recombinant dsRNA-baculovirus is used to introduce target genes with hairpin structure into baculovirus AcMNPV, and use AcMNPV expression vector to perform insect RNAi, which improves targeted delivery efficiency and reduces the expression of the coding gene of peptidoglycan recognition protein, resulting in a decrease in pest immunity.
It improves the RNAi efficiency of Lepidopteran insects, reduces the immunity of pests, reduces environmental pollution and biosafety risks, and provides efficient and safe pest control methods.
Smart Images

Figure CN120137918B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of pest control, in particular to a recombinant dsRNA-baculovirus and a preparation method and application thereof. Background Art
[0002] The fall armyworm, commonly known as the fall armyworm, belongs to the genus Spodoptera in the family Noctuidae in the order Lepidoptera. It is a omnivorous plant parasite with a wide range of host plants. Currently, common control methods include agricultural, physical, chemical, and biological control. Physical and agricultural control are limited in their effectiveness in controlling specific diseases and require auxiliary facilities, which are time-consuming and labor-intensive. Chemical control has the disadvantages of increasing pest resistance, causing serious environmental pollution, and disrupting the ecological balance. Biological control is safe for humans and animals and can reduce pest resistance. Continuous application of biological pesticides over a period of time can also have a continuous and lasting inhibitory effect on some pests. RNAi pesticides fall into this category and have broad application prospects.
[0003] RNAi biopesticides utilize exogenously designed and synthesized dsRNA, which, when ingested by pathogens or pests, causes RNA interference in the body, leading to the pest's death. These pesticides offer advantages such as strong targeting, ecological safety, and environmental friendliness. However, RNAi applications in pest control face numerous challenges, including the delivery method, reliability, and stability of dsRNA, the trade-off between efficacy and cost, and off-target and non-target effects. Nanomaterial encapsulation has been a promising approach to addressing dsRNA stability, but this approach is relatively costly. Bacterial-mediated RNAi and transgenic crops expressing dsRNA of the target gene are currently considered promising and have great potential. However, both involve bacterial vectors and transgenic techniques, which can raise biosafety concerns and pose numerous limitations to their application. Summary of the Invention
[0004] To address the above problems, the present invention provides a recombinant dsRNA-baculovirus, a preparation method, and an application thereof, which solves the problems of off-target and non-target effects of double-stranded RNA (dsRNA) in RNAi pest control applications, as well as high costs, and provides technical support for the control of Lepidoptera insects.
[0005] In order to achieve the above object, the present invention provides the following technical solutions:
[0006] The present invention provides a recombinant dsRNA-baculovirus, comprising a baculovirus AcMNPV and a dsRNA segment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA segment of the gene is shown in SEQ ID NO.2.
[0007] The present invention provides a method for preparing the recombinant dsRNA-baculovirus described in the above technical solution, comprising the following steps:
[0008] inserting the dsRNA fragment of the gene into the pFastBac1 vector to obtain a recombinant vector;
[0009] The recombinant vector is transferred into DH10Bac cells for transformation to obtain the recombinant dsRNA-baculovirus.
[0010] Preferably, after obtaining the recombinant dsRNA-baculovirus, the method further comprises: transfecting the recombinant dsRNA-baculovirus into Lepidoptera engineered cells to replicate the recombinant dsRNA-baculovirus.
[0011] Preferably, the Lepidoptera engineered cells are Sf21 cells.
[0012] Preferably, the dsRNA fragment of the gene is inserted between the BamH I and Hind III restriction sites of the pFastBac1 vector.
[0013] The present invention provides an RNAi biopesticide, the active ingredient of which includes recombinant dsRNA-baculovirus; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by the preparation method described in the above technical solution.
[0014] Preferably, the titer of the recombinant dsRNA-baculovirus in the RNAi biopesticide is ≥8×10 5 IFU / mL.
[0015] The present invention provides the use of the recombinant dsRNA-baculovirus described in the above technical solution, or the recombinant dsRNA-baculovirus prepared by the preparation method described in the above technical solution, or the RNAi biopesticide described in the above technical solution in controlling lepidopteran insects.
[0016] Preferably, the Lepidoptera insects include Spodoptera frugiperda.
[0017] The present invention provides a method for controlling lepidopteran insects, comprising: applying a recombinant dsRNA-baculovirus or the RNAi biopesticide described in the above technical solution to a plant to be controlled; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or a recombinant dsRNA-baculovirus prepared by the preparation method described in the above technical solution; and the application method comprises spraying.
[0018] Beneficial effects:
[0019] The present invention provides a recombinant dsRNA-baculovirus, comprising a baculovirus AcMNPV and a dsRNA segment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA segment of the gene is shown in SEQ ID NO.2. The recombinant dsRNA-baculovirus provided by the present invention is a dsRNA insecticide delivery system mediated by the recombinant dsRNA-baculovirus AcMNPV. By improving the assembly structure of the recombinant dsRNA-baculovirus, a target gene with a hairpin structure is introduced into the baculovirus AcMNPV. Insect RNAi is performed based on the AcMNPV expression vector, which can silence the gene encoding the peptidoglycan recognition protein of lepidopteran insects, thereby causing the lepidopteran insects to lose their immunity and die, thereby improving the RNAi efficiency of lepidopteran insects. The system helps to solve the problems of double-stranded RNA (dsRNA) off-target, non-target effects and high costs in RNAi applications for pest control, and helps to break through bottlenecks such as obvious drug resistance and chemical pesticide pollution in pest control. In addition, the baculovirus AcMNPV is harmless to humans, animals and the environment, and can greatly reduce harmful effects on non-target organisms and the environment, providing a new model and means for the control of lepidopteran insects. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0021] Figure 1 The expression of peptidoglycan recognition protein mRNA changes after 1-3 days of infection of Sf21 cells with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs;
[0022] Figure 2 The changes in the number of living cells after 1-3 days of infection of Sf21 cells with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs;
[0023] Figure 3 The changes in cell viability of Sf21 cells after infection with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs for 1 to 3 days;
[0024] Figure 4 The appearance changes of the second-instar Spodoptera frugiperda after feeding the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs for 1 to 13 days;
[0025] Figure 5 The weight changes of Spodoptera frugiperda after feeding the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs for 7 to 13 days;
[0026] Figure 6The expression of peptidoglycan recognition protein mRNA changes after feeding recombinant dsRNA-baculovirus AcMNPV-PGRP-hs to Spodoptera frugiperda for 1 to 3 days;
[0027] Figure 7 The appearance of a dead Spodoptera frugiperda after feeding with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs;
[0028] Figure 8 This is the survival curve of recombinant dsRNA-baculovirus AcMNPV-PGRP-hs fed to Spodoptera frugiperda for 1 to 13 days;
[0029] Figure 9 The expression of peptidoglycan recognition protein mRNA after feeding recombinant dsRNA-baculovirus AcMNPV-PGRP-hs to Spodoptera frugiperda for 7-13 days;
[0030] Figure 10 The changes in the mRNA expression of the peptidoglycan recognition protein in Spodoptera frugiperda that died after being fed with the recombinant dsRNA-baculovirus AcMNPV-PGRP-hs;
[0031] Figure 11 The changes in mRNA expression of peptidoglycan recognition protein in Sf21 cells 1 to 3 days after infection with recombinant dsRNA-baculovirus AcMNPV-PGRP. DETAILED DESCRIPTION
[0032] The present invention provides a recombinant dsRNA-baculovirus, comprising a baculovirus AcMNPV and a dsRNA segment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA segment of the gene is shown in SEQ ID NO.2.
[0033] By improving the assembly structure of recombinant dsRNA-baculovirus, the present invention introduces a target gene with a hairpin structure into the baculovirus AcMNPV. Using the AcMNPV expression vector, insect RNAi can efficiently infect a variety of lepidopteran insects, addressing the problem of off-target gene delivery. The invention offers high specificity, is environmentally friendly, avoids environmental degradation, and improves targeted delivery efficiency, making it an ideal biopesticide. The recombinant dsRNA-baculovirus provided by the present invention can directly infect other insect tissues, resolving the issue of RNAi success rates in lepidopteran insects hindered by the composition of their hemolymph, thus providing a new model and approach for the control of lepidopteran insects.
[0034] The present invention provides a method for preparing the recombinant dsRNA-baculovirus described in the above technical solution, comprising the following steps:
[0035] inserting the dsRNA fragment of the gene into the pFastBac1 vector to obtain a recombinant vector;
[0036] The recombinant vector is transferred into DH10Bac cells for transformation to obtain the recombinant dsRNA-baculovirus.
[0037] As an embodiment, after obtaining the recombinant dsRNA-baculovirus, the method further comprises: transfecting the recombinant dsRNA-baculovirus into Lepidoptera engineering cells to replicate the recombinant dsRNA-baculovirus.
[0038] As an embodiment, the Lepidoptera engineered cells are Sf21 cells.
[0039] As an embodiment, the dsRNA fragment of the gene is inserted between the BamH I and HindIII restriction sites of the pFastBac1 vector.
[0040] Based on the above advantages, the present invention provides an RNAi biopesticide, the active ingredient of which includes recombinant dsRNA-baculovirus; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or the recombinant dsRNA-baculovirus prepared by the preparation method described in the above technical solution.
[0041] As an embodiment, the titer of the recombinant dsRNA-baculovirus in the RNAi biopesticide is ≥8×10 5 IFU / mL. As another embodiment, the titer of the recombinant dsRNA-baculovirus in the RNAi biopesticide is 8×10 5 The RNAi biopesticide provided by the present invention can silence the gene encoding the peptidoglycan recognition protein of lepidopteran insects, thereby causing the lepidopteran insects to lose their immunity and die.
[0042] Based on the above advantages, the present invention provides the use of the recombinant dsRNA-baculovirus described in the above technical solution, the recombinant dsRNA-baculovirus prepared by the preparation method described in the above technical solution, or the RNAi biopesticide described in the above technical solution in controlling Lepidoptera insects.
[0043] As an embodiment, the Lepidoptera insects include Spodoptera frugiperda.
[0044] Based on the above advantages, the present invention provides a method for controlling lepidopteran insects, comprising: applying a recombinant dsRNA-baculovirus or the RNAi biopesticide described in the above technical solution to a plant to be controlled; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus described in the above technical solution or a recombinant dsRNA-baculovirus prepared using the preparation method described in the above technical solution; and the application method comprises spraying.
[0045] As an embodiment, the Lepidoptera insects include Spodoptera frugiperda.
[0046] The present invention applies recombinant dsRNA-baculovirus or RNAi biopesticide to plants to be controlled. After lepidopteran insects eat them, the coding gene of the peptidoglycan recognition protein of the lepidopteran insects can be silenced, thereby causing the immunity of the lepidopteran insects to be reduced and die. This is an efficient control method.
[0047] To further illustrate the present invention, the recombinant dsRNA-baculovirus and its preparation method and application provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0048] Example 1
[0049] In the present invention, exogenous viruses are used to infect Spodoptera frugiperda cells Sf21 to induce cell apoptosis. Transcriptome sequencing analysis and verification reveal that peptidoglycan recognition proteins (PGRPs) are involved in the regulation of the Toll and Imd signaling pathway and play an important role in the process of cellular innate immune response, and can be used as effective target genes for recombinant virus assembly.
[0050] Based on the above findings, the present invention provides an RNAi biopesticide based on the AcMNPV expression vector, the construction method of which is as follows:
[0051] According to the gene encoding the peptidoglycan recognition protein of Spodoptera frugiperda PGRPs (NCBI reference sequence: XM_035572809.2), and target sequences with more interference sites were designed and determined as follows:
[0052] 5'-cacactgtcagtcccgagtgcaatttgttcgtgaattgcgcagctgagatggtcaaccttcagaattattttaccacccattatggatacgatttaccgtat aacttcgtgataggaaatgaaggaagagtttatgaaggccgtagttgggagataattggtgcacacaccagtggatacaaccgttgctctcttggcttagcgttt ataggtgactaccgcgagggtttaccatcttactcaaaagtgacaagtctacaactgcaaagagcacaaatgttattagacaagggtgtcgagcttggatatata gacaaagactaccaagtcgtcggagcgaaagatctggcttcctcatatagtcctggcaccaacctatacagagagatacaaaaatggccccactacgc-3' (seq ID NO.1).
[0053] After comparing the RNAi effects of various assembly schemes, it was determined that the assembly mode of recombinant AcMNPV is a hairpin structure. That is, based on the target sequence with more interference sites mentioned above, a sequence with a hairpin structure was synthesized, as follows:
[0054] 5'-cacactgtcagtcccgagtgcaatttgttcgtgaattgcgcagctgagatggtcaaccttcagaattattttaccacccattatggatacgatttaccgtataacttcgtgataggaaatgaaggaagagtttatgaaggccgtagttgggagataattggtgcacacaccagtggatacaaccgttgctctcttggcttagcgtttataggtgactaccgcgagggtttaccatcttactcaaaagtgacaagtctacaactgcaaagagcacaaatgttattagacaagggtgtcgagcttggatatatagacaaagactaccaagtcgtcggagcgaaagatctggcttcctcatatagtcctggcaccaacctatacagagagatacaaaaatggccccactacgcTTTCGAAAGAGGTGCGCCCCCAGAAGCAATTTCGTGTAAATTAGATAAATCGTATTTGTCAATCAGAGTGCTTTTGGCGAAGAATGAAAATAGGGTTGGTACTAGCAACGCAGAATTCgcgtagtggggccatttttgtatctctctgtataggttggtgccaggactatatgaggaagccagatctttcgctccgacgacttggtagtctttgtctatatatccaagctcgacacccttgtctaataacatttgtgctctttgcagttgtagacttgtcacttttgagtaagatggtaaaccctcgcggtagtcacctataaacgctaagccaagagagcaacggttgtatccactggtgtgtgcaccaattatctcccaactacggccttcataaactcttccttcatttcctatcacgaagttatacggtaaatcgtatccataatgggtggtaaaataattctgaaggttgaccatctcagctgcgcaattcacgaacaaattgcactcgggactgacagtgtg-3'(SEQ ID NO.2); Among them, the lowercase unbold sequence (5'-cacactgtcagtcccgagtgcaatttgttcgtgaattgcgcagctgagatggtcaaccttcagaattattttaccacccattatggatac gatttaccgtataacttcgtgataggaaatgaaggaagagtttatgaaggccgtagttgggagataattggtgcacacaccagtggatacaaccgttgctctcttggct tagcgtttataggtgactaccgcgagggtttaccatcttactcaaaagtgacaagtctacaactgcaaagagcacaaatgttattagacaagggtgtcgagcttggata tatagacaaagactaccaagtcgtcggagcgaaagatctggcttcctcatatagtcctggcaccaacctatacagagagatacaaaaatggccccactacgc-3', SEQ ID NO.1) is the target sequence of the peptidoglycan recognition protein of Spodoptera frugiperda; the uppercase sequence (5'-TTTCGAAAGAGGTGCGCCCCCAGAAGCAATTTCGTGTAAATTAGATAAATCGTATTTGTCAATCAGAGTGCTTTTGGCGAAGAATGAAAATAGGGTTGGTACTAGCAACGCAGAATTC-3', SEQ ID NO.3) is the middle spacer sequence; the sequence in lowercase bold (5'-gcgtagtggggccatttttgtatctctctgtataggttggtgccaggactatatgaggaagccagatctttcgctccgacgacttggtagtctttgtctatatatccaagctcgacacccttgtctaataacatttgtgctctttgcagttgtagacttgtcacttttgagtaagatggtaaaccctcgcggtagtcac ctataaacgctaagccaagagagcaacggttgtatccactggtgtgtgcaccaattatctcccaactacggccttcataaactcttccttcatttcctatcacgaagttatacggtaaatcgtatccataatgggtggtaaaataattctgaaggttgaccatctcagctgcgcaattcacgaacaaattgcactcgggactgacagtgtg-3', SEQ ID NO.4) is a sequence that is complementary to the base pairing of the target sequence.
[0055] Nanjing Zhongding Biotechnology Co., Ltd. was commissioned to construct a recombinant bacmid, which included the following steps:
[0056] The gene fragment shown in SEQ ID NO.2 was inserted into the polyhedrin promoter of the pFastBac1 vector (i.e., inserted between the BamH I and Hind III restriction sites of the pFastBac1 vector), and then transformed into DH10Bac cells to obtain a recombinant bacmid.
[0057] The recombinant bacmid was transfected into Sf21 cells using LipoInsect Transfection Reagent (Biyuntian Biotechnology, product number: C0551) to obtain recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) solution with a titer of 8×10 5 IFU / mL.
[0058] Example 2
[0059] The recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) prepared in Example 1 was used to infect Spodoptera frugiperda cells Sf21 at a concentration of MOI=10. The relative expression levels of peptidoglycan recognition protein mRNA and cell viability were detected 1, 2, and 3 days after infection. Spodoptera frugiperda cells Sf21 not infected with the recombinant dsRNA-baculovirus were set as a control group (denoted as Control). The internal reference gene was Spodoptera frugiperda. Actin The primer sequences used are as follows:
[0060] PGRP-F: 5'-GTTGAGTTAGCCCTGAACGTG-3' (SEQ ID NO.5);
[0061] PGRP-F: 5'-CCGCTTGGAGTTCTGGGG-3' (SEQ ID NO. 6);
[0062] Actin-F: 5'-CCTGTAGCTGAGGGCTATGTAA-3' (SEQ ID NO. 7);
[0063] Actin-R: 5'-CTGGTGGGATGCCTACTTCA-3' (SEQ ID NO. 8).
[0064] See the results Figures 1 to 3 and Tables 1 to 3, where ** indicates a difference compared to the Control group. P <0.01, *** indicates P <0.001.
[0065] Table 1 Relative expression levels of peptidoglycan recognition protein mRNA after recombinant dsRNA-baculovirus infection of Sf21 cells
[0066]
[0067] Table 2 Statistical results of the number of viable cells after recombinant dsRNA-baculovirus infection of Sf21 cells (cells / mL)
[0068]
[0069] Table 3 Cell viability of Sf21 cells after infection with recombinant dsRNA-baculovirus (%)
[0070]
[0071] The results showed that after 1-2 days of infection of Sf21 cells with recombinant dsRNA-baculovirus AcMNPV-PGRP-hs, the expression of peptidoglycan recognition protein gene in Sf21 cells was significantly reduced ( P<0.01), and reduced the cell survival rate, indicating that AcMNPV-PGRP-hs can infect Sf21 cells and reduce the cell survival rate, causing the expression of peptidoglycan recognition protein gene to decrease and play a certain RNAi effect.
[0072] Example 3
[0073] The recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) prepared in Example 1 was used to feed and infect the second-instar Spodoptera frugiperda. The titer of AcMNPV-PGRP-hs was 8×10 5 IFU / mL. The frugiperda insects were fed corn leaves, and the test solution was added to the corn leaves. There were two groups: an infection group (AcMNPV-PGRP-hs) and a control group (Control). The infection group was fed with AcMNPV-PGRP-hs solution, and the control group was fed with virus-free Sf21 cell culture medium. Each group had 30 insects, and each was fed individually. The test solution was added at a rate of 150 μl / egg / day. Changes in the appearance of the frugiperda insects were observed, their weight changes were detected, and changes in the mRNA expression of the peptidoglycan recognition protein were detected. Survival curves were drawn. The results are shown in the figure. Figures 4 to 10 and Tables 4 to 7, where * indicates P <0.08, *** indicates P <0.001.
[0074] Table 4 Body weight changes of Spodoptera frugiperda after feeding with recombinant dsRNA-baculovirus solution for 7-13 days (g)
[0075]
[0076] Table 5 Relative expression levels of peptidoglycan recognition protein mRNA after feeding recombinant dsRNA-baculovirus solution for 1 to 3 days
[0077]
[0078] Table 6 Relative expression of peptidoglycan recognition protein mRNA after feeding recombinant dsRNA-baculovirus solution for 7 to 13 days
[0079]
[0080] Table 7 Relative expression levels of PGRPs mRNA in Spodoptera frugiperda that died after being fed with recombinant dsRNA-baculovirus
[0081]
[0082] The results showed that after continuously feeding the second-instar larvae of Spodoptera frugiperda with AcMNPV-PGRP-hs solution for 13 days, both the infected and control groups continued to grow. However, after 7 days of feeding, the body length and weight of the infected group were lower than those of the control group ( Figures 4 and 5 , Table 4), indicating that AcMNPV-PGRP-hs can infect Spodoptera frugiperda and slow its growth. Since there was no significant difference in appearance and condition between the infected and control groups after feeding with AcMNPV-PGRP-hs solution for 1 to 3 days, the present invention used fluorescent quantitative PCR to detect the expression of peptidoglycan recognition protein mRNA and found that AcMNPV-PGRP-hs infection significantly reduced the expression of peptidoglycan recognition protein mRNA ( P <0.001) ( Figure 6 , Table 5), indicating that AcMNPV-PGRP-hs can infect Spodoptera frugiperda larvae and induce RNAi interference. No mortality occurred in the control group during infection for 7 to 13 days, but the infected group began to show varying degrees of slow growth and a small number of deaths ( Figures 7 and 8 ), compared with the control group, the body length and weight of the Spodoptera frugiperda larvae infected with AcMNPV-PGRP-hs and died were significantly lower ( Figure 5 ), the survival curve also began to show a downward trend after 7 days ( Figure 8 ). Fluorescence quantitative PCR was then used to detect the mRNA expression of the peptidoglycan recognition protein of the 7-13 day-old and dead fall armyworms. It was found that in the survival group, the mRNA expression of the peptidoglycan recognition protein of the 7-13 day-old fall armyworms infected with the virus was significantly reduced ( P <0.001) ( Figure 9 , Table 6); In the death group, the mRNA expression of the peptidoglycan recognition protein of Spodoptera frugiperda infected for 8-11 days was significantly reduced ( P <0.01, P <0.001) ( Figure 10 , Table 7), indicating that AcMNPV-PGRP-hs exerted a certain RNAi effect.
[0083] The above results show that the recombinant dsRNA-baculovirus (AcMNPV-PGRP-hs) can infect Spodoptera frugiperda, causing slow growth and partial death of Spodoptera frugiperda 7 to 13 days after infection. These phenomena are related to the reduction of peptidoglycan recognition protein caused by AcMNPV-PGRP-hs. It can be seen that AcMNPV-PGRP-hs can exert a certain degree of RNAi effect in Spodoptera frugiperda larvae and is feasible for achieving green control of Spodoptera frugiperda.
[0084] Comparative Example 1
[0085] A recombinant dsRNA-baculovirus (AcMNPV-PGRP) similar to that in Example 1 was constructed using a commonly used recombinant dsRNA-baculovirus assembly method to directly introduce a gene fragment (shown in SEQ ID NO. 1) containing a large number of interference sites for the peptidoglycan recognition protein of Spodoptera frugiperda. The construction method was similar to that in Example 1, except that, during the construction of the recombinant bacmid, the gene fragment shown in SEQ ID NO. 2 was replaced with the gene fragment shown in SEQ ID NO. 1.
[0086] The recombinant dsRNA-baculovirus (AcMNPV-PGRP) was used to infect Spodoptera frugiperda cells Sf21 at an MOI of 10. The relative expression of peptidoglycan recognition protein mRNA was detected 1, 2, and 3 days after infection (the detection method was the same as in Example 2). Spodoptera frugiperda cells Sf21 not infected with the recombinant dsRNA-baculovirus were set as a control group (denoted as Control). The results showed that after 1 to 3 days of infection with the recombinant dsRNA-baculovirus AcMNPV-PGRP, there was no significant difference in the peptidoglycan recognition protein gene expression in the infected Sf21 cells compared with the control group ( P >0.05) ( Figure 11 , Table 8), indicating that it did not show a significant RNAi effect and was inferior to the AcMNPV-PGRP-hs constructed in Example 1.
[0087] Table 8 Relative expression of peptidoglycan recognition protein mRNA after AcMNPV-PGRP infection of Sf21 cells
[0088]
[0089] The present invention improves the recombinant dsRNA-baculovirus assembly structure and performs insect RNAi for the first time based on the AcMNPV expression vector. AcMNPV packaging of dsRNA solves the effect of lepidopteran insect hemolymph components on RNAi efficiency, improves the RNAi efficiency of lepidopteran insects, and provides a new model and means for green pest control.
[0090] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A recombinant dsRNA-baculovirus, characterized in that The invention consists of a baculovirus AcMNPV and a dsRNA segment of a gene introduced into the baculovirus AcMNPV; the nucleotide sequence of the dsRNA segment of the gene is shown in SEQ ID NO.2; and the dsRNA segment has a hairpin structure.
2. The method for preparing the recombinant dsRNA-baculovirus according to claim 1, characterized in that: The following steps are involved: inserting the dsRNA fragment of the gene into the pFastBac1 vector to obtain a recombinant vector; The recombinant vector is transferred into DH10Bac cells for transformation to obtain the recombinant dsRNA-baculovirus.
3. The preparation method according to claim 2, characterized in that After obtaining the recombinant dsRNA-baculovirus, the method further comprises: transfecting the recombinant dsRNA-baculovirus into Lepidoptera engineering cells to replicate the recombinant dsRNA-baculovirus.
4. The preparation method according to claim 3, characterized in that The Lepidoptera engineering cells are Sf21 cells.
5. The preparation method according to claim 2, characterized in that The dsRNA fragment of the gene is inserted between the BamH I and Hind III restriction sites of the pFastBac1 vector.
6. An RNAi biopesticide, characterized in that: The active ingredient comprises recombinant dsRNA-baculovirus; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus according to claim 1 or the recombinant dsRNA-baculovirus prepared by the preparation method according to any one of claims 2 to 5.
7. The RNAi biopesticide according to claim 6, characterized in that The titer of the recombinant dsRNA-baculovirus in the RNAi biopesticide is ≥8×10 5 IFU / mL.
8. Use of the recombinant dsRNA-baculovirus according to claim 1, or the recombinant dsRNA-baculovirus prepared by the preparation method according to any one of claims 2 to 5, or the RNAi biopesticide according to claim 6 or 7 in controlling Lepidoptera insects; The lepidopteran insect is Spodoptera frugiperda ( Spodoptera frugiperda ).
9. A method for controlling lepidopteran insects, characterized in that: include: The recombinant dsRNA-baculovirus or the RNAi biopesticide according to claim 6 or 7 is applied to the plant to be controlled; the recombinant dsRNA-baculovirus is the recombinant dsRNA-baculovirus according to claim 1 or the recombinant dsRNA-baculovirus prepared by the preparation method according to any one of claims 2 to 5; the application method includes spraying; the lepidopteran insect is the fall armyworm.
Citation Information
Patent Citations
Recombinant baculovirus vector resistant to host apoptosis
CN106636207A