2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexen-1-carboxylate synthase mutants and uses thereof

Abstract

The present application relates to 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase mutant and its application, and belongs to the technical field of enzyme engineering. The present application obtains key residues of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase by combining protein sequence comparison and alanine scanning strategy, randomly mutates the key residues, and obtains a mutant MenD which is resistant to feedback inhibition of 1,4-dihydroxy-2-naphthalene carboxylic acid intermediate metabolite in the methionine quinone pathway through multiple rounds of screening W322I\R323F The ability of the recombinant bacillus subtilis to produce heptamethylnaphthoquinone is improved, and the yield is 1.22 times that of the control strain, and the final yield reaches 186.5 mg / L. The present application not only provides a new direction for the modification of the methionine quinone pathway of bacillus subtilis, but also will be beneficial to the industrial large-scale production of heptamethylnaphthoquinone.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and in particular to the 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase mutant and its applications. Background Technology

[0002] Vitamin K2, also known as menadione, is a fat-soluble vitamin with a series of subtypes, often abbreviated as MK-n. Heptaenide-7 (MK-7) is one of the most important subtypes, directly absorbed and utilized by the human body. It has a range of functions, including preventing arterial calcification, strengthening bones, and protecting nerves, and is attracting significant attention in the pharmaceutical and functional food industries. Furthermore, MK-7 is a key coenzyme for electron transport in Bacillus subtilis, playing a crucial role in its respiratory chain and participating in energy metabolism.

[0003] 2-Succinoyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase (MenD) is a key thiamine diphosphate (ThDP)-dependent decarboxylase in the vitamin K2 biosynthesis pathway. This enzyme exhibits a typical three-domain structure, maintaining its catalytic activity through a tetrameric conformation. Its core function is to catalyze the conjugated addition reaction of α-ketoglutarate with an isobranched acid to generate 2-succinoyl-5-enolpyruvyl-6-hydroxy-3-cyclohexadiene-1-carboxylate (SEPHCHC), accompanied by the release of carbon dioxide. This reaction is not only the rate-limiting step in the biosynthesis of menadione but also a crucial node connecting primary metabolism and naphthoquinone ring construction. In the synthesis of MK-7, MenD is subject to feedback inhibition by the menadione pathway intermediate metabolite 1,4-dihydroxy-2-naphthoic acid (DHNA), thus affecting the biosynthesis of MK-7.

[0004] In recent years, most researchers have focused on using metabolic engineering and synthetic biology techniques to achieve high yields, high conversion rates, and high productivity of MK-7 in Bacillus subtilis. Enhancing the supply of precursor substances and reducing competitive pathways are common methods for improving strain performance. For example, overexpressing key genes in the shikimic acid and MEP pathways can strengthen precursor synthesis, while dynamic regulation of key genes through CRISPRi and population response systems can reduce competitive pathways. However, these studies have not solved the feedback inhibition problem of DHNA, thus limiting further breakthroughs in increasing MK-7 yield. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention combines protein sequence comparison and alanine scanning strategies to identify key residues of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase. Random mutations of these key residues were then performed, and after multiple rounds of screening, a mutant MenD resistant to feedback inhibition of the menadione pathway intermediate metabolite 1,4-dihydroxy-2-naphthoic acid was obtained. W322I\R323F .

[0006] The first objective of this invention is to provide a mutant of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase, wherein the mutant mutates tryptophan at position 322 of the starting sequence as shown in SEQ ID NO.1 to isoleucine, and arginine at position 323 to phenylalanine.

[0007] This invention, through protein sequence comparison and alanine scanning, identified key residues R96, W322, and R323 of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase. Random mutations of these key residues were performed, and the coupling relationship between MK-7 synthesis and strain growth was screened to obtain the MenD mutant, which exhibits significantly enhanced resistance to DHNA feedback inhibition. W322I / R323F .

[0008] Furthermore, the amino acid sequence of the mutant is shown in SEQ ID NO.2.

[0009] A second objective of this invention is to provide a gene encoding the aforementioned mutant.

[0010] Furthermore, the nucleotide sequence of the gene is shown in SEQ ID NO.4.

[0011] A third objective of this invention is to provide an expression vector containing the aforementioned mutants or genes.

[0012] A fourth objective of this invention is to provide the application of the above-mentioned mutant, the above-mentioned gene, or the above-mentioned expression vector in increasing the yield of heptaene-menaquinone produced by Bacillus subtilis.

[0013] During the synthesis of menadione, 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase is subject to feedback inhibition by the menadione pathway intermediate metabolite 1,4-dihydroxy-2-naphthoic acid (DHNA). The mutant MenD provided in this invention... W322I / R323F The binding affinity to DHNA was reduced, thereby weakening the feedback inhibition effect of DHNA on the synthesis of heptaene-menazone and increasing the yield of heptaene-menazone.

[0014] A fifth object of the present invention is to provide a method for increasing the yield of heptaene-menaquinone produced by Bacillus subtilis, said method being the introduction of any of the following into Bacillus subtilis:

[0015] (1) The above mutants;

[0016] (2) The above-mentioned genes;

[0017] (3) The above-mentioned expression carriers.

[0018] A sixth object of the present invention is to provide a recombinant Bacillus subtilis, wherein the Bacillus subtilis comprises any of the following:

[0019] (1) The above mutants;

[0020] (2) The above-mentioned genes;

[0021] (3) The above-mentioned expression carriers.

[0022] Furthermore, the gene encoding 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase, as shown in SEQ ID NO.3, is knocked out from the genome of the Bacillus subtilis.

[0023] Furthermore, the Bacillus subtilis is Bacillus subtilis 168.

[0024] In one embodiment of the present invention, the Bacillus subtilis is recombinant Bacillus subtilis 3AYAT02.

[0025] A seventh object of the present invention is to provide a microbial agent comprising the above-mentioned Bacillus subtilis.

[0026] An eighth object of the present invention is to provide the use of the above-mentioned mutant, the above-mentioned gene, the above-mentioned expression vector, the above-mentioned recombinant Bacillus subtilis or the above-mentioned microbial agent in the production of heptaene-menaquinone.

[0027] The ninth object of the present invention is to provide a method for producing heptaene-menaquinone, wherein heptaene-menaquinone is produced using a fermentation system comprising the above-described recombinant Bacillus subtilis or the above-described microbial agent.

[0028] Further, the recombinant Bacillus subtilis was activated in a seed culture medium and then transferred to a fermentation culture medium for 120-144 hours.

[0029] In one embodiment of the present invention, the recombinant Bacillus subtilis is cultured in a shaker at 37°C and 220 rpm for 10 hours to prepare a seed solution.

[0030] In one embodiment of the present invention, the recombinant Bacillus subtilis was fermented in a shaker at 40°C and 220 rpm for 144 hours to obtain heptaene-naphthoquinone.

[0031] Furthermore, the seed culture medium contains 10-12 g / L of peptone, 5-10 g / L of yeast extract, and 10-12 g / L of sodium chloride.

[0032] Furthermore, the fermentation medium contains 50-55 g / L of glucose, 50-55 g / L of glycerol, 50-55 g / L of soybean peptone, and 0.6-1 g / L of potassium dihydrogen phosphate.

[0033] In one embodiment of the present invention, the seed culture medium comprises 10 g / L of peptone, 5 g / L of yeast extract and 10 g / L of sodium chloride.

[0034] In one embodiment of the present invention, the fermentation medium comprises 50 g / L glucose, 50 g / L glycerol, 50 g / L soybean peptone and 0.6 g / L potassium dihydrogen phosphate.

[0035] Furthermore, it also includes the step of extracting heptaene-menaquinone.

[0036] In one embodiment of the present invention, the extractant for the heptaene-menaquinone is a mixture of isopropanol and n-hexane.

[0037] In one embodiment of the present invention, the volume ratio of isopropanol to n-hexane is 1:2.

[0038] The beneficial effects of this invention are:

[0039] This invention screened and obtained the 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase mutant MenD, which showed significantly enhanced resistance to 1,4-dihydroxy-2-naphthoic acid inhibition. W322I / R323F A recombinant Bacillus subtilis strain, 3AYAT02-IF, capable of efficiently producing heptaene-menadione, was constructed, achieving a yield of 186.5 mg / L, which is 1.22 times that of the control strain. The mutant provided by this invention can serve as a general tool for improving the efficiency of heptaene-menadione production in Bacillus subtilis, offering a low-cost and sustainable heptaene-menadione production solution suitable for industrial applications in the pharmaceutical and food industries. It also provides new theoretical basis for the research and modification of the menadione metabolic pathway. Attached Figure Description

[0040] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0041] Figure 1 The results of screening key residues of MenD in Example 1 of the present invention are as follows: (1) is the protein structure of MenD derived from Mycobacterium tuberculosis and Bacillus subtilis; (2) is the enzyme activity detection results of wild type and mutant R96A, R323A, and W322A; and (3) is the anti-feedback inhibition detection results of wild type and mutant R96A, R323A, and W322A against DHNA.

[0042] Figure 2 The mutant MenD in Example 3 of this invention W322I / R323F Results of anti-DHNA feedback inhibition detection;

[0043] Figure 3 The fermentation yield of heptaene-menaquinone by the recombinant strain Bacillus subtilis 3AYAT02-IF in Example 5 of this invention is shown. Detailed Implementation

[0044] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0045] The culture media and reagents involved in the examples are shown below:

[0046] (1) Culture medium:

[0047] The seed culture medium consists of 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0048] The fermentation medium consists of: 50 g / L glucose, 50 g / L glycerol, 50 g / L soybean peptone, and 0.6 g / L potassium dihydrogen phosphate.

[0049] (2) MK-7 extractant: a mixture of isopropanol and n-hexane (1:2, v / v).

[0050] The detection methods involved in the embodiments are as follows:

[0051] (1) MK-7 yield detection: An Agilent ZORBAX EclipseXDB-C18 separation column (5μm, 250×4.6mm) was used. The detection temperature was 40℃, the mobile phase was methanol:dichloromethane (9:1, v / v), the flow rate was 1mL / min, the detection wavelength was 254nm, and the injection volume was 10μL.

[0052] (2) Detection of bacterial growth: The absorbance value (OD) of the fermentation broth was measured periodically using a UV-Vis spectrophotometer. 600 .

[0053] The primers and sequences involved in the embodiments are shown in Table 1.

[0054] Table 1 Primer sequences

[0055] pHT-HF GTGAAAAAACAATGGGAACTGTAACTGCAGGTCGACGTCCCC pHT-HR AAAATAAACCTCCTTTCTTTTACTTACCCTCTATTAAAC menD-F TCGTGTTGTACAATAAATGTAGTGATAGCG menD-R TAGCCTCGTATGTTTCAACCATTTGTTC YZ-pHT-F AAAACCGGTTTTCTTATGGCTTAAGGATG YZ-pHT-R TAGTACAGGGACTATTCCTAATAAGCCG pET-HF CACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAG pET-HR ATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG MenD-F GAAGGAGATATACATTTGACAGTCAACCCGATTACTCATTAC MenD-R GTGGTGGTGGTGGTGGTGCAGTTCCCATTGTTTTTTCACTTCCC TB-1F GGTTGAAGCCCATTATTCANNKGTGCCTATTATTGTGTT TB-1R TGAATAATGGGCTTCAACCACAGC TB-2F CGAGGATGGAGGGNNKNNKGACCCGACA TB-2R CCCTCCATCCTCGTCAATCACGATTTGC YZ-MenDF TTATGCGACTCCTGCATTAGGAAG YZ-MenDR CGCAATAATGTTTTCCTTGTCCGCATC TBmenD-1F TTACAGTTCCCATTGTTTTTTCACTTCCCG TBMenD-1R GAGGTGAGAGGCGTTGACAGTCAACCCGATTACTCATTACATCG TBMenD-2F GGGTTGACTGTCAACGCCTCTCACCTCCTAATGCAG TBMenD-2R GAAATTGTTATCCGCTCGCGGATACAACCTTTGCTATCAGTGG TBMenD-3F CAAAGGTTGTATCCGCGAGCGGATAACAATTTCACACAGGAAAC TBMenD-3R CCTGAGAACTTTCATAATAACGCCAGGGTTTTCCCAGTC TBMenD-4F GGGAAAACCCTGGCGTTATTATGAAAGTTCTCAGGCGATCTGTTC TBMenD-4R TATTTTCAACCGGATATTTTTAATGAGCTGGAG

[0056] Example 1: Construction of the MenD mutant

[0057] Construction of the MenD expression vector: Using pHT01 as a template, PCR amplification was performed using pHT-HF / R as forward and reverse primers, respectively. The reaction system consisted of: 1 μL template; 25 μL PrimerSTAR Max; 20 mM each of forward and reverse primers; and sterile water to a total volume of 50 μL. The reaction conditions were: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s; 58℃ annealing for 30 s; 72℃ extension for 4 min, for a total of 30 cycles; and a final extension at 72℃ for 10 min. The amplified product was verified by nucleic acid electrophoresis and purified using a PCR Purification Kit. Subsequently, the template plasmid was digested with Dpn I to obtain the linearized vector.

[0058] Using wild-type Bacillus subtilis 168 as a template and menD-F / R as upstream and downstream primers, PCR amplification was performed. The reaction system was the same as above, and the reaction conditions were: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s; 58℃ annealing for 30 s; 72℃ extension for 5 min, for a total of 30 cycles; and a final extension at 72℃ for 10 min. The product was recovered using the same method to obtain the fragment. The construction method and template used for the promoter P43 fragment were the same as those for the MenD fragment. The linearized vector and the target fragment were mixed at a concentration ratio of 1:1:1, and T4 ligase and T4 buffer were added, followed by water to a final volume of 10 μL. The mixture was ligated at 40℃ for 30 min, and then transformed into E. coli DH5α competent cells. The cells were plated on LB plates (containing 50 μg / mL Kan), and positive transformants were screened. The recombinant plasmid pHT-MenD was extracted and sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing verification.

[0059] Screening of key residues in MenD: Bashiri et al., after crystallizing MenD (Mtb-MenD) from Mycobacterium tuberculosis and combining it with in vitro experiments, determined that Mtb-MenD binds to DHNA through a cage-like structure of three arginine residues, naming it "arginine cage" (published in the literature Allosteric Regulation of Menaquinone (Vitamin K2) Biosynthesis in the Human Pathogen Mycobacterium Tuberculosis. Journal of Biological Chemistry 2020, 295(12), 3759–3770.). We used After docking MenD (Bs-MenD) from Bacillus subtilis with DHNA using docking software, comparison with the corresponding position in the "arginine cage" of Mtb-MenD revealed that the binding site of Bs-MenD to DHNA also exhibits a certain degree of conservation. This site retains two of the three arginine residues in the "arginine cage," while the remaining tryptophan residue can also play a similar role to arginine after migration. Subsequently, alanine scanning was used to assess the mutational potential of these three amino acids, R96, W322, and R323, in reducing feedback inhibition. The results are as follows: Figure 1 As shown, mutations at positions 96 and 322 to alanine enhance both the intrinsic activity and anti-feedback inhibition performance, demonstrating the importance of these two sites for feedback inhibition effects. Mutations at position 323 to alanine do not significantly alter performance; however, due to the proximity of this site to the active site, subsequent mutations will still consider this site.

[0060] Construction of MenD mutants: Using the constructed pHT-MenD as a template, two rounds of full plasmid amplification were performed at the three sites using the corresponding upstream and downstream primers listed in Table 1, resulting in MenD mutants with random combinations of mutations at the three sites (R96, W322, and R323). The reaction system was the same as above, and the reaction conditions were: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s; 58℃ annealing for 30 s; 72℃ extension for 4 min, for a total of 30 cycles; and a final extension at 72℃ for 10 min. The amplified products were purified using a PCR Purification Kit and then sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing verification.

[0061] Example 2: Screening for MenD mutants

[0062] The obtained pHT-MenD mutant plasmid was integrated into wild-type Bacillus subtilis 168 via chemical transformation, with an addition amount of approximately 1000 ng. Screening was performed on LB solid medium supplemented with 100 μM DHNA and chloramphenicol resistance. After 12 hours, single colonies with good growth were selected and transferred to medium supplemented with 150 μM DHNA for further screening. After another 12 hours, single colonies with good growth were selected and transferred to medium supplemented with 200 μM DHNA. Finally, a mutant with the strongest DHNA feedback inhibition resistance was selected. Other mutants were eliminated as the DHNA concentration increased. The final mutant strain was sequenced to determine the amino acid sequence of the mutation site, yielding the MenD mutant. W322I / R323F .

[0063] Example 3: Detection of the anti-feedback inhibition ability of MenD mutants

[0064] Protein purification of MenD: The wild-type menD gene (sequence shown in SEQ ID NO.3) and its mutant gene (sequence shown in SEQ ID NO.4) were amplified using the menD-F / R primer pair, while the pET-HF / R primer pair was used to linearize the plasmid pET28a(+). Subsequently, the menD and its mutant DNA fragments were inserted into the linearized pET-28a(+) plasmid using the Gibson Assembly Cloning Kit (NEB) and transformed into *E. coli* BL21. Single colonies were then screened and cultured in LB medium supplemented with kanamycin (50 μg / mL) at 37°C with shaking at 220 rpm for 8 h. 4% (v / v) of the inoculum was transferred to 50 mL of TB fermentation medium containing an equal volume of kanamycin and cultured at 37°C with shaking at 220 rpm for approximately 1.5 h (OD). 600 =0.6). To induce MenD expression, IPTG (0.2 mM) was added to the culture medium, and the cells were cultured at 16°C with shaking at 200 rpm for 16 h. Cells were then collected and lysed by sonication in Tris-HCl (pH 8.0, 20 mM). The resulting supernatant was fed into a His GraviTrap column (GE Healthcare) and used... Purification was performed using an FPLC system (GE Healthcare). The column was then washed with 15 mL of buffer A (20 mM Tris, 0.5 M NaCl, 5 mM imidazole, pH 8.0) and 15 mL of buffer B (20 mM Tris, 0.5 M NaCl, 100 mM imidazole, pH 8.0). Finally, MenD and the mutant MenD were eluted with 5 mL of buffer C (20 mM Tris, 0.5 M NaCl, 200 mM imidazole, pH 8.0). W322I / R323F protein.

[0065] Detection of feedback inhibition ability of MenD mutants: MenD and its mutant MenD W322I / R323F The activity was quantified by detecting the consumption rate of the substrate α-ketoglutarate. The reaction system consisted of 1 μM MenD enzyme and 300 μM ThDP, with buffers including 100 mM Tris-HCl (pH 7.8), 100 mM NaCl, and 5 mM MgCl2. The mixture was first preheated at 25 °C for 30 min, followed by the addition of 2 μM isobranched acid and 300 μM α-ketoglutarate to initiate the reaction. Analysis was performed using a MARS MOA column (FLM) and a UV detector at 50 °C, with a mobile phase of 5 mM H2SO4 and a flow rate of 0.5 mL / min. The degree of decrease in enzyme activity with gradually increasing DHNA addition represented the anti-feedback inhibition ability of MenD. Different concentrations of DHNA were added to the reaction system to test MenD and its mutant MenD. W322I / R323F Enzyme activity was measured, and the results are as follows: Figure 2 As shown.

[0066] Example 4: Construction of recombinant Bacillus subtilis 3AYAT02-IF

[0067] The mutated MenD W322I / R323F The fragment was integrated into the MenD region of the genome of strain 3AYAT02 (strain description is shown in Table 2) to construct recombinant Bacillus subtilis 3AYAT02-IF. The specific construction process is as follows.

[0068] Table 2 Construction of recombinant Bacillus subtilis

[0069]

[0070]

[0071] The following sequences were amplified using overlap extension PCR. The required amplified sequences for the integration frame are the upstream sequence of menD (1000 bp, sequence as shown in SEQ ID NO.5), the chloramphenicol resistance gene zeo sequence (1309 bp, sequence as shown in SEQ ID NO.6), and MenD. W322I / R323F The first 1000 bp of the mutant sequence (sequence as shown in SEQ ID NO.7). The menDup-lox71-zeo-lox66-menD fusion expression cassette was obtained by fusion PCR.

[0072] The obtained fusion expression cassette fragment was integrated into the recombinant Bacillus subtilis 3AYAT02 genome via chemical transformation, with an integration amount of approximately 1000 ng. Successful integration was confirmed by screening on LB agar medium supplemented with chloramphenicol and sequencing of single colonies.

[0073] Chloramphenicol resistance was eliminated in the successfully integrated recombinant Bacillus subtilis. The Cre plasmid was chemically transformed into the constructed recombinant Bacillus subtilis. After screening on LB solid medium supplemented with kanamycin, the expression of the Cre plasmid was induced by IPTG to eliminate the resistance gene. Cre plasmid elimination was achieved by picking single colonies and inoculating them into LB liquid medium, incubating at 50°C for 12 hours. Screening was performed using LB plates with no antibiotic, chloramphenicol, and kanamycin to select single colonies that successfully eliminated chloramphenicol resistance and the Cre plasmid. Finally, the recombinant Bacillus subtilis integrating the MenD mutant was obtained and named 3AYAT02-IF.

[0074] Example 5: Fermentation production of MK-7 by strain

[0075] (1) Seed liquid preparation

[0076] Single colonies of recombinant Bacillus subtilis 3AYAT02 and the 3AYAT02-IF strain constructed in Example 4 were picked and inoculated into 15 mL shake tubes, each containing 3 mL of liquid seed culture medium, and cultured on a shaker at 37°C and 220 rpm for 10 h. 3AYAT02 served as a control, with three replicates for each strain.

[0077] (2) Fermentation culture

[0078] The seed culture obtained in step (1) was inoculated into 250 mL Erlenmeyer flasks at an inoculation rate of 2%, with each flask containing 20 mL of fermentation medium. The flasks were cultured on a shaker at 40 °C and 220 rpm for 6 days. After fermentation, the samples were prepared. The specific method is as follows.

[0079] Take 1.2 mL of fermentation broth after 6 days of fermentation. Add 500 μL of the fermentation broth to 4 times its volume of MK-7 extraction solvent, vortex for 10 min, filter the extract, and centrifuge at 8000 rpm for 5 min. Collect the supernatant and determine the content of MK-7 in the whole cell fraction by HPLC. The results are shown in the table below. Figure 3 After 6 days of fermentation, the yield of 3AYAT02-IF was 1.22 times that of the control strain 3AYAT02, indicating that it is feasible to promote the synthesis of MK-7 by enhancing MenD's resistance to DHNA feedback inhibition.

[0080] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A mutant of 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase, characterized in that: The mutant mutates tryptophan at position 322 to isoleucine and arginine at position 323 to phenylalanine in the starting sequence shown in SEQ ID NO.

1.

2. The gene encoding the mutant of claim 1.

3. The gene according to claim 2, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

4.

4. An expression vector comprising the mutant of claim 1 or the gene of claim 2 or 3.

5. The use of the mutant of claim 1, the gene of claim 2 or 3, or the expression vector of claim 4 in increasing the yield of heptaene-menaquinone by Bacillus subtilis.

6. A method for increasing the yield of heptaene-menaquinone produced by Bacillus subtilis, characterized in that, The method introduces any of the following into Bacillus subtilis: (1) The mutant according to claim 1; (2) The gene as described in claim 2 or 3; (3) The expression vector according to claim 4.

7. A recombinant Bacillus subtilis, characterized in that, The recombinant Bacillus subtilis includes any of the following: (1) The mutant according to claim 1; (2) The gene as described in claim 2 or 3; (3) The expression vector according to claim 4.

8. The recombinant Bacillus subtilis according to claim 7, characterized in that: The genome of the recombinant Bacillus subtilis contains a knockout nucleotide sequence, as shown in SEQ ID NO.3, encoding the gene for 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic acid synthase.

9. The recombinant Bacillus subtilis according to claim 7, characterized in that: The Bacillus subtilis strain is Bacillus subtilis 168.

10. A microbial agent comprising any one of the recombinant Bacillus subtilis according to claims 7-9.

11. The use of the mutant of claim 1, the gene of claim 2 or 3, the expression vector of claim 4, the recombinant Bacillus subtilis of any one of claims 1-9, or the microbial agent of claim 10 in the production of heptaene-menaquinone.

12. A method for producing heptaene-menaquinone, characterized in that: Heptaenenaphthoquinone is produced using a fermentation system comprising any one of the recombinant Bacillus subtilis according to claims 7-9 or the microbial agent according to claim 10.

13. The method according to claim 12, characterized in that: The recombinant Bacillus subtilis was activated in a seed culture medium and then transferred to a fermentation culture medium and cultured for 120-144 hours.

14. The method according to claim 13, characterized in that: The seed culture medium contains 10-12 g / L of peptone, 5-10 g / L of yeast extract, and 10-12 g / L of sodium chloride.

15. The method according to claim 13, characterized in that: The fermentation medium contains 50-55 g / L glucose, 50-55 g / L glycerol, 50-55 g / L soybean peptone, and 0.6-1 g / L potassium dihydrogen phosphate.

Images