Application of ZmNAC77 gene in regulating starch content of corn kernels

Abstract

The invention belongs to the technical field of biological science, and particularly relates to application of a ZmNAC77 gene in regulation of corn kernel starch content, and the application adopts the following steps: transforming an overexpression vector ZmNANC77-PUBXCN containing the corn ZmNAC77 gene into corn through an agrobacterium infection method to obtain a ZmNAC77 gene overexpressed corn homozygous strain; or the expression vector containing the corn ZmNAC77 gene target sequence is transformed into corn through an agrobacterium infection method, and the ZmNAC77 gene edited corn homozygous strain is obtained. A ZmNAC77 gene overexpressed corn homozygous strain is constructed through the ZmNAC77 gene or a ZmNAC77 gene edited corn homozygous strain is constructed through the ZmNAC77 gene, a new corn variety with high starch content or low starch content is obtained, and the ZmNAC77 gene overexpressed corn homozygous strain has important theoretical and practical significance for regulating the corn starch yield by utilizing a biological science technology.

Description

Technical Field

[0001] The present invention belongs to the field of biological science and technology, and specifically relates to the application of the ZmNAC77 gene in regulating the starch content of maize kernels. Background Art

[0002] Maize is an important food crop. With the growth of the national economy and the improvement of people's living standards, the demand for maize shows a rigid increase, and higher standards for the quality of maize are also put forward. As the main component of maize kernels, starch not only provides an important energy source for humans and animals, but also provides raw materials for various industrial production and processing. Therefore, it is of great significance to study how to regulate the yield of maize kernel starch. The starch content of maize kernels is jointly regulated by genes related to the synthesis pathway of grain nutrients, transcription factors, and genes related to the morphological development of various tissues in maize kernels.

[0003] The ZmNAC77 gene was discovered in maize, but there are currently no relevant reports on the functional research and application of the maize ZmNAC77 gene in regulating the starch content of maize kernels. Therefore, constructing a method for regulating the starch content of maize kernels by the maize ZmNAC77 gene has important theoretical and practical significance for regulating the yield of maize starch using biological science and technology. Summary of the Invention

[0004] In view of the above-mentioned situation of the prior art, the purpose of the present invention is to provide the application of the ZmNAC77 gene in regulating the starch content of maize kernels.

[0005] To achieve the above purpose, the present invention adopts the following technical solutions:

[0006] The application of the ZmNAC77 gene in regulating the starch content of maize kernels.

[0007] Furthermore, the nucleotide sequence of the ZmNAC77 gene is as shown in SEQ ID NO: 1, the CDS sequence is as shown in SEQ ID NO: 2, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO: 3.

[0008] Furthermore, the application adopts the following steps: transforming the overexpression vector ZmNAC77-PUBXCN containing the ZmNAC77 gene into maize by the method of Agrobacterium-mediated infection to obtain a homozygous line of maize overexpressing the ZmNAC77 gene;

[0009] Or, transforming the expression vector containing the target sequence of the ZmNAC77 gene into maize by the method of Agrobacterium-mediated infection to obtain a homozygous line of maize with edited ZmNAC77 gene.

[0010] Furthermore, the construction of the overexpression vector ZmNAC77-PUBXCN is carried out by the following steps:

[0011] (1) Amplify the ZmNAC77 gene by PCR;

[0012] (2) Recover the gel of the amplification product in step (1), ligate ZmNAC77 cDNA with the PUBXCN-MYC vector to obtain ZmNAC77-PUBXCN.

[0013] Furthermore, in step (1), the primer sequences used for the gene amplification are:

[0014] ZmNAC77-F-1: ACGATGGTGGAGATGTCTGTG;

[0015] ZmNAC77-R-1: CACCGCACCAGGATAGATTTA;

[0016] The reaction program of the PCR is: 95°C, pre-denaturation for 3 min; 95°C, denaturation for 15 s; 56°C, annealing for 1 min; 72°C, extension for 2 min, 33 cycles; 72°C, re-annealing for 5 min; store at 10°C.

[0017] Furthermore, in step (2), the ligation program is: The PCR reaction program is: 95°C, pre-denaturation for 30 s; 95°C, denaturation for 30 s; 55°C, annealing for 30 s; 72°C, extension for 2 min, 35 cycles; 72°C, complete extension for 7 min.

[0018] Furthermore, using the wild-type target maize plants as the negative control, identify the homozygous lines of maize overexpressing the ZmNAC77 gene. The identification primers are:

[0019] ZmNAC77-OE-F: TGCACCATCGTCAACCACTACAT;

[0020] ZmNAC77-OE-R: AGAAACCCACGTCATGCCAGT.

[0021] Furthermore, using the wild-type target maize plants as the negative control, identify the homozygous lines of maize with the ZmNAC77 gene edited. The identification primers are:

[0022] ZmNAC77 cas9 -F-1: CTGATCCGGTCCGATGATCC;

[0023] ZmNAC77 cas9 -R-1: AGAAACCCACGTCATGCCAGT.

[0024] Furthermore, the construction of the expression vector containing the ZmNAC77 gene target sequence is carried out by the following steps:

[0025] (1) Select the target sequence by homologous alignment according to the nucleotide sequence of the ZmNAC77 gene, design primers using the target sequence, and synthesize double-stranded DNA that can transcribe sgRNA with cleavage activity;

[0026] (2) Connect the double-stranded DNA in step (1) with the plasmid pUC19-U3 to obtain the recombinant plasmid vector pUC19-ZmNAC77;

[0027] (3) Double-digest pUC19-ZmNAC77 in step (2) to obtain the ZmNAC77 target sequence fragment, and connect the fragment with the expression vector pCAMBIA1302 to obtain the expression vector containing the ZmNAC77 target sequence fragment.

[0028] Furthermore, in step (1), the target sequence is

[0029] CACCTGACAACCTAGAGGCG, and the primers are:

[0030] ZmNAC77 cas9 -F: GGGTGCTCTGTCGAAGTACTGAAG;

[0031] ZmNAC77 cas9 -R: AAACCYYCAGTACTTCGACAGAGC;

[0032] In step (3), the ZmNAC77 target sequence fragment is as shown in SEQ ID NO: 4.

[0033] Beneficial effects:

[0034] At present, the functional research on the ZmNAC77 gene in maize has not been reported. Aiming at the problems in the prior art, the present invention provides the application of the ZmNAC77 gene in regulating the starch content in maize kernels. The present invention constructs a ZmNAC77 gene overexpression maize homozygous line or a ZmNAC77 gene-edited maize homozygous line through the ZmNAC77 gene, and obtains new maize varieties with high starch content or low starch content. Compared with wild-type maize, the starch content in maize kernels of the ZmNAC77 gene overexpression maize homozygous line increased by nearly 3 times; compared with wild-type maize, the starch content in maize kernels of the ZmNAC77 gene-edited maize homozygous line decreased by nearly 27%. Therefore, the present invention has important theoretical and practical significance for regulating maize starch yield by using biological science and technology. Description of the drawings

[0035] Figure 1 It is a result diagram for DNA verification;

[0036] Figure 2 It is a screening diagram for the Bar gene of overexpression lines;

[0037] Figure 3 It is a comparison diagram of the expression levels of the ZmNAC77 gene between overexpression lines OE1, OE2, OE3 and wild-type lines;

[0038] Figure 4 It is a target identification and screening diagram for some ZmNAC77 gene-edited lines;

[0039] Figure 5 It is a schematic diagram of the mutation event of the ZmNAC77 mutant positive homozygous line;

[0040] Figure 6 It is a comparison diagram of the starch content in the grains of overexpression lines OE1, OE2, OE3, gene-edited line CRISPR and wild-type maize. Detailed implementation manners

[0041] The technical solutions of the present invention are further explained and illustrated in the following examples. Based on the above descriptions and these examples, those skilled in the art can determine the basic features of the present invention, and various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention to make it applicable to various uses and conditions; the above expression vector was introduced into maize by the agrobacterium-mediated transformation method. Among them, the methods for introducing the above expression vector into maize are well-known to those skilled in the art, and these methods include but are not limited to: agrobacterium-mediated transformation method, gene gun method, electrotransfection method, ovary injection method, etc.

[0042] Example 1 Construction of overexpression homozygous lines of maize ZmNAC77 gene

[0043] (1) Amplification of ZmNAC77 gene and construction of overexpression vector

[0044] A sticky end with A base was introduced at the 5' and 3' ends of the ZmNAC77 gene, and the full-length cDNA sequence of the gene was obtained by PCR amplification and identified by agarose gel electrophoresis. The results are as Figure 1 shown. The primer sequences used for gene amplification are:

[0045] ZmNAC77-F-1: ACGATGGTGGAGATGTCTGTG (SEQ ID NO: 5)

[0046] ZmNAC77-R-1: CACCGCACCAGGATAGATTTA (SEQ ID NO: 6)

[0047] The PCR reaction program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s; annealing at 56°C for 1 min; extension at 72°C for 2 min, for 33 cycles; final extension at 72°C for 5 min; stored at 10°C.

[0048] The obtained amplification products were subjected to gel extraction to determine the concentration. The PUBXCN-MYC vector was digested with SmaⅠ endonuclease to form sticky ends containing T bases. Taq enzyme (purchased from Nanjing Novozymes Biotechnology Co., Ltd.) was used to ligate ZmNAC77 cDNA and the PUBXCN-MYC vector. The ligation procedure was as follows:

[0049] The PCR reaction program was as follows: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 2 min, for 35 cycles; final extension at 72°C for 7 min.

[0050] (2) Obtaining of ZmNAC77 gene overexpressing maize homozygous lines

[0051] The successfully ligated ZmNAC77-PUBXCN expression vector was transformed into Agrobacterium tumefaciens AG10 to obtain recombinant Agrobacterium tumefaciens AG10 / ZmNAC77-PUBXCN. The transformation method is specifically described in the literature: Methods in Molecular Biology, vol. 343: Agrobacterium Protocols, 2 / e, volume 1.

[0052] Preparation of in-situ transformation solution: Add 2% (by mass) sucrose, 0.05% (by mass) silwet-77 (surfactant), 2 mg / L 6-BA, 1 ng / L 2,4-D, and 10 mg / L acetosyringone to 1 / 4 MS medium. Add 4 mL of Agrobacterium tumefaciens AG10 / ZmNAC77-PUBXCN bacterial solution to every 100 mL of medium and culture at 28°C and 250 rpm for 24 h.

[0053] Cut off the corn silk, and use a 5 mL syringe to inject the Agrobacterium

[0054] AG10 / ZmNAC77-PUBXCN bacterial solution directly into the corn cob from the lower 1 / 3 of the corn. The injection amount should be such that the bacterial solution oozes out at the corn silk. After two months of growth, harvest the corn kernels.

[0055] Dry the corn kernels and sow them. When the seedlings grow to the 3-4 leaf stage, use the formulated 0.01% (concentration) herbicide basta and the bar protein detection test strip (AS013LS) to detect the BAR gene protein contained in the expression vector ZmNAC77-PUBXCN, screen positive transgenic plants, and multiply the obtained corn seedlings of independent transformation events.

[0056] After the corn seedlings of the independent transformation events obtained by multiplication mature, select 20 grains from each ear, use the total DNA of their leaves as a template, and use the Bar gene to screen positive pure-line transgenic lines. Amplify the Bar gene and identify it by agarose gel electrophoresis. The results are as Figure 2 shown, and 8 positive pure-line plants are screened. Identify the transgenic plants. When identifying, use the wild-type target corn plants as negative controls. The primers for the ZmNAC77 gene used for identification are:

[0057] ZmNAC77-OE-F: TGCACCATCGTCAACCACTACAT (SEQ ID NO: 7)

[0058] ZmNAC77-OE-R: AGAAACCCACGTCATGCCAGT (SEQ ID NO: 8)

[0059] The PCR reaction program is: pre-denaturation at 95°C for 5 min: denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 1 min, 32 cycles: total extension at 72°C for 5 min, and preservation at 10°C.

[0060] Identify the expression levels of the ZmNAC77 gene in the overexpression lines OE1, OE2, OE3 and the wild-type line. The results are as Figure 3 shown. The gene expression level of the overexpression line OE1 is significantly higher than that of the overexpression lines OE2 and OE3, and the gene expression level of the overexpression line OE2 is significantly higher than that of the overexpression line OE3. The obtained positive pure-line lines are used to measure the expression level of ZmNAC77 in the plants by qRT-PCR, and three homozygous lines with high, medium and low expression levels are selected and named OE1, OE2, and OE2 according to the expression level. They are used for subsequent experiments.

[0061] Example 2 Construction of homozygous lines of the maize ZmNAC77 gene

[0062] Based on the nucleotide sequence of the ZmNAC77 gene, a target sequence CACCTGACAACCTAGAGGCG was selected through homologous alignment; according to the homologous alignment results and the PAM design principle of gRNA, primers were designed using the target sequence to synthesize double-stranded DNA that differed from the ZmNAC77 nucleotide sequence. The double-stranded DNA was different from the target sequence but expressed the same protein, and it was double-stranded DNA that could transcribe sgRNA with cleavage activity and carried the same BbsⅠ sticky ends. The primers designed using the target sequence were:

[0063] ZmNAC77 cas9 -F: GGGTGCTCTGTCGAAGTACTGAAG (SEQ ID NO: 11);

[0064] ZmNAC77 cas9 -R: AAACCYYCAGTACTTCGACAGAGC (SEQ ID NO: 12).

[0065] The amplification primer sequences were:

[0066] ZmNAC77-F: GAAGACCACCGCACCTGACAACCTAGAGG;

[0067] ZmNAC77-R: GTCTTCAAACCGCCTCTAGGTTGTCAGGTG.

[0068] The PCR reaction conditions were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 30 s, for 32 cycles; total extension at 72°C for 5 min.

[0069] The pUC19-U3 plasmid was digested with BbsⅠ, the digested product was subjected to agarose gel electrophoresis, and then gel extraction was performed; the double-stranded DNA was ligated with the digested pUC19-U3 plasmid using a ligase to obtain a recombinant plasmid vector, named pUC19-ZmNAC77.

[0070] The recombinant pUC19-ZmNAC77 cloning vector was digested with EcoRⅠ and XbaⅠ to obtain a fragment containing the ZmNAC77 target sequence fragment of approximately 500 bp. The ZmNAC77 target sequence fragment was as shown in SEQ ID NO: 4. The expression vector pCAMBIA1302 was digested with EcoRⅠ and NheⅠ, and the obtained 500 bp fragment and the linearized expression vector were ligated using T4 ligase.

[0071] Using the same method as for constructing the ZmNAC77 overexpressing maize homozygous lines, the target maize was transformed using Agrobacterium-mediated transformation and directly propagated.

[0072] After the corn seedlings of the independently transformed events obtained from seed propagation matured, 20 kernels were selected from each ear. Using the total DNA of their leaves as a template, positive pure-line transgenic plant lines were screened using identification primers for the target gene. The results are as Figure 4 shown. After sequencing and comparison, the mutation events of the ZmNAC77 mutant positive homozygous plant lines are as Figure 5 shown. Using the wild-type target corn plants as negative controls, transgenic corn plants were identified. The primers for the ZmNAC77 gene used for identification are:

[0073] ZmNAC77 cas9 -F-1: CTGATCCGGTCCGATGATCC (SEQ ID NO: 9)

[0074] ZmNAC77 cas9 -F-1: AGAAACCCACGTCATGCCAGT (SEQ ID NO: 10)

[0075] The PCR reaction conditions were: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 30 s, for 32 cycles; total extension at 72°C for 5 min.

[0076] Observe the PCR results to check whether the band sizes of the leaves of 20 plant lines in the same occurrence line are consistent and single. Select those with a single band, cut the gel, ligate the T vector, and send it to the company for first-generation sequencing.

[0077] Use the bioedit software to compare the sequencing results with the ZmNAC77 cDNA sequence published in the MaizeGDB database, and select the occurrence line without other mutation sites and no double peaks at the target sequence as the gene-edited positive homozygous corn material.

[0078] Example 3 Determination of total starch content in the kernels of wild-type corn line KN5585, ZmNAC77 gene overexpressing corn homozygous lines, and ZmNAC77 gene-edited corn homozygous lines

[0079] A kit for determining the starch content of plant kernels (Sailisi Biotechnology Co., Ltd.) was used for the determination.

[0080] Select 10 kernels each from the wild-type corn line KN5585, ZmNAC77 gene overexpressing corn homozygous lines, and ZmNAC77 gene-edited corn homozygous lines, weigh their masses using a precision electronic balance, and grind each kernel separately. Add 1 mL of reagent one and grind thoroughly to make a homogenate, then transfer it to a 2 mL centrifuge tube, incubate in a water bath at 80°C for 30 min, centrifuge at 3000 rpm at room temperature for 5 min, and discard the supernatant to retain the precipitate.

[0081] Add 0.5 mL of sterilized ddH 2 O to the precipitate and gelatinize it in a boiling water bath for 15 min. After cooling, add 0.35 mL of Reagent II and extract it at room temperature for 15 min, shaking 3 - 5 times. Add 0.85 mL of sterilized ddH 2 O to the obtained mixture, mix well, and centrifuge at 3000 rpm for 10 min. Take 100 μL of the supernatant for testing, add 300 μL of sterilized distilled water for dilution (if the absorbance is greater than 1.5 or less than 0.1, modify the dilution factor), and evenly mix the mixtures of all grains of each line. Set three biological replicates to obtain the samples to be tested.

[0082] Dilute the 1 mg / L glucose standard to the required concentrations (0.4, 0.2, 0.1, 0.05, 0.025, 0.0125, 0.00625, 0.00156 mg / L) to obtain the standard solutions. Take 50 μL of the standard solution, add 250 μL of the working solution, heat it in a 95℃ water bath for 10 min, then place it in a 96 - well plate. After preheating the microplate reader for 30 min, use distilled water as the blank control, measure the absorbance values of each concentration of the standard solution at 620 nm, and calculate △A = Astandard - Ablank.

[0083] Take the concentration of the standard solution as the abscissa and △A as the ordinate to obtain the regression equation y = kx + b. Substitute △A' (△A’ = Ameasurement - Ablank) into the equation to get x (mg / L). Among them, Ameasurement is the absorbance value of each sample.

[0084] Calculated according to the fresh weight of the sample, the starch content (mg / g) = x × dilution factor × volume after extraction ÷ fresh weight of the sample.

[0085] The comparison results of the starch content in the over - expression lines OE1, OE2, OE3, the gene - edited line CRISPR and wild - type maize grains are as Figure 6 shown. The results show that the total starch content in the grains of the homozygous lines of ZmNAC77 - overexpressing maize is significantly higher than that of wild - type maize, and the total starch content in the grains of the homozygous lines of ZmNAC77 - edited maize is significantly lower than that of wild - type maize. The starch content in wild - type maize grains is about 47.5 mg / g, and the starch content in the grains of the homozygous lines of ZmNAC77 - overexpressing maize is about 173.5 mg / g. Compared with the wild - type, the starch content in the grains of the homozygous lines of ZmNAC77 - overexpressing maize increased by nearly 3 times; the starch content in the grains of the homozygous lines of ZmNAC77 - edited maize decreased by nearly 27%.

Claims

1. Application of the ZmNAC77 gene in regulating the starch content of maize kernels.

2. The application according to claim 1, wherein, the nucleotide sequence of the ZmNAC77 gene is shown as SEQ ID NO: 1, the CDS sequence is shown as SEQ ID NO: 2, and the amino acid sequence of the protein encoded thereby is shown as SEQ ID NO:

3.

3. The application according to claim 1 or 2, wherein, the application adopts the following steps: transforming the overexpression vector ZmNAC77-PUBXCN containing the ZmNAC77 gene into maize by the method of Agrobacterium infection to obtain a homozygous line of maize overexpressing the ZmNAC77 gene; alternatively, transforming an expression vector containing the target sequence of the ZmNAC77 gene into maize by the method of Agrobacterium infection to obtain a homozygous line of maize edited for the ZmNAC77 gene.

4. The application according to claim 3, wherein, for the construction of the overexpression vector ZmNAC77-PUBXCN, the following steps are adopted: (1) Amplify the ZmNAC77 gene by PCR; (2) Recover the PCR product of step (1), ligate the ZmNAC77 cDNA with the PUBXCN-MYC vector to obtain ZmNAC77-PUBXCN.

5. The application according to claim 4, wherein, in step (1), the primer sequences used for gene amplification are: ZmNAC77-F-1: ACGATGGTGGAGATGTCTGTG; ZmNAC77-R-1: CACCGCACCAGGATAGATTTA; the reaction program of the PCR is: 95 °C, pre-denaturation for 3 min; 95 °C, denaturation for 15 s; 56 °C, annealing for 1 min; 72 °C, extension for 2 min, 33 cycles; 72 °C, re-annealing for 5 min; store at 10 °C.

6. The application according to claim 4, wherein, in step (2), the ligation program is: the PCR reaction program is: 95 °C, pre-denaturation for 30 s; 95 °C, denaturation for 30 s; 55 °C, annealing for 30 s; 72 °C, extension for 2 min, 35 cycles; 72 °C, final extension for 7 min.

7. The application according to claim 3, wherein, using the wild-type target maize plant as a negative control, identifying the homozygous line of maize overexpressing the ZmNAC77 gene, and the identification primers are: ZmNAC77-OE-F: TGCACCATCGTCAACCACTACAT; ZmNAC77-OE-R: AGAAACCCACGTCATGCCAGT.

8. The application according to claim 3, wherein, using the wild-type target maize plant as a negative control, identifying the homozygous line of maize edited for the ZmNAC77 gene, and the identification primers are: ZmNAC77 cas9 -F-1: CTGATCCGGTCCGATGATCC; ZmNAC77 cas9 -R-1: AGAAACCCACGTCATGCCAGT.

9. The application according to claim 3, wherein, for the construction of the expression vector containing the target sequence of the ZmNAC77 gene, the following steps are adopted: (1) Select a target sequence by homologous alignment according to the nucleotide sequence of the ZmNAC77 gene, design primers using the target sequence, and synthesize double-stranded DNA that can transcribe sgRNA with cleavage activity; (2) Connect the double-stranded DNA in step (1) with plasmid pUC19-U3 to obtain a recombinant plasmid vector pUC19-ZmNAC77; (3) Double-digest pUC19-ZmNAC77 in step (2) to obtain a ZmNAC77 target sequence fragment, and connect the fragment with the expression vector pCAMBIA1302 to obtain the expression vector containing the ZmNAC77 target sequence fragment.

10. The application according to claim 9, characterized in that, in step (1), the target sequence is CACCTGACAACCTAGAGGCG, and the primers are: ZmNAC77 cas9 -F: GGGTGCTCTGTCGAAGTACTGAAG; ZmNAC77 cas9 -R: AAACCYYCAGTACTTCGACAGAGC; in step (3), the ZmNAC77 target sequence fragment is as shown in SEQ ID NO: 4.

Images