Application of potato StSS5 gene in regulating tuber and starch particle size thereof

Abstract

The invention discloses application of a potato StSS5 gene in regulating tubers and starch particle sizes thereof, and belongs to the technical field of gene engineering. An StSS5 gene editing strain is obtained through a CRISPR / Cas9 gene editing technology, the tuber size, the starch particle size and the starch particle number in powder making body of the StSS5 gene editing strain are analyzed, the functional mechanism of the StSS5 gene in adjustment of the tuber size and the starch particle size is disclosed, a new gene resource is provided for improvement of potato starch characteristics, and the method is suitable for industrial production. And a new thought is provided for functional research of starch particle starting related genes.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of the potato StSS5 gene in regulating tuber and its starch granule size. Background Art

[0002] The regulation of potato tuber and its starch granule size has important scientific significance and application value in agriculture and the food industry. Tuber size directly affects potato yield, harvest efficiency and market adaptability. Larger tubers usually have higher yields per unit area, but overly large tubers may lead to increased mechanical damage, affecting storage, transportation and the consumer market; while smaller tubers are more suitable for processing and specific cooking methods, meeting the needs of different consumers and increasing market competitiveness. Starch granule size is a key factor determining the physicochemical properties of potato starch. Smaller starch granules usually have a higher specific surface area and faster gelatinization rate, which are suitable for food processing that requires rapid gelation. Regulating starch granule size can not only improve the processing performance and sensory quality of food, but also expand the application potential of potato starch in non-food fields (such as biomaterials, pharmaceutical carriers). By breeding techniques to regulate tuber and its starch granule size, an optimal balance can be achieved between yield and quality. Therefore, in-depth study of the regulation mechanism of tuber and its starch granule size is of great significance for improving the economic value and functional properties of potatoes.

[0003] Starch synthesis includes two distinct stages: the initiation process and the synthesis process itself. The process of synthesizing starch polymers, including amylopectin and amylose, is relatively well-defined, and the gene functions involved are conserved across different species and organs. It mainly involves starch synthase (SS) genes, including granule-bound starch synthase (GBSS) responsible for amylose synthesis and soluble starch synthases (SS1 - SS4) responsible for amylopectin synthesis and the elongation of amylopectin chain lengths. The understanding of starch granule initiation mainly comes from the fact that genes such as AtSS4, AtSS5, AtPTST2, and AtMRC in the model plant Arabidopsis thaliana regulate the formation of starch granules in chloroplasts through their synergistic actions. However, the initiation process of starch granule formation in amyloplasts of sink organs (such as seeds, tubers, etc.) and the factors regulating the number, size, and shape of granules in each amyloplast are species-dependent. For example, amyloplasts in potato tubers usually contain only a single simple starch granule, while amyloplasts in plants such as rice and wheat form multiple granules or compound granules. This difference indicates that the formation pattern of starch granules has significant species and organ specificities. Homologous genes of AtSS4, AtSS5, AtPTST2, and AtMRC that regulate starch granule formation in Arabidopsis thaliana chloroplasts in different species show differentiation in starch granule initiation and starch synthesis in their sink organs. Especially in potato research, StSS4, StPTST2, and StMRC do not regulate starch granule initiation in tubers. StSS5 is predominantly expressed in potato tubers and its expression level increases with tuber development. Therefore, it is very important to study the function of StSS5 in potato tuber development and starch granule initiation. Existing reports have disclosed that the AtSS5 gene can promote the formation of starch granules in Arabidopsis thaliana leaf chloroplasts. However, due to the differentiation of starch granule formation in tubers from that in chloroplasts. Therefore, studying the function of the StSS5 gene is of great significance for improving plant starch characteristics and enhancing industrial application value. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide the application of the potato StSS5 gene in regulating the size of tubers and their starch granules, so as to achieve the technical effect of synergistically regulating the size of potato tubers and their starch granules.

[0005] To achieve the above object, the technical solution adopted by the present invention is to provide the application of the potato StSS5 gene in regulating the size of tubers and their starch granules, and the nucleotide sequence of the StSS5 gene is as shown in SEQ ID NO: 1.

[0006] On the basis of the above technical solution, the present invention can also be improved as follows:

[0007] Furthermore, by inhibiting or knocking out the StSS5 gene, the regulation of plant tubers and the size of their starch granules is achieved, and the gelatinization temperature of tuber starch is reduced.

[0008] Furthermore, by inhibiting or knocking out the StSS5 gene, the size of plant tubers and the average starch granule size are reduced, and the proportion of small starch granules is increased, so as to achieve the regulation of plant tubers and the size of their starch granules, and reduce the gelatinization temperature of tuber starch.

[0009] Furthermore, the tuber size includes the fresh weight of the tuber.

[0010] Furthermore, the traits of starch granule size include the particle size of tuber starch granules and the number of starch granules in amyloplasts.

[0011] Furthermore, the plant is a dicotyledonous plant.

[0012] Furthermore, the plant is potato.

[0013] The beneficial effects of the present invention are as follows:

[0014] 1. By knocking out the StSS5 gene in the present invention, it is found that the tubers of the StSS5 gene-edited lines become smaller, meeting the needs of different consumers and increasing the market competitiveness. The particle size of tuber starch granules decreases, and the number of small particle starches increases. The small particle size starches can better bind to water, improving the stability and water retention of food, reducing the phenomenon of water separation, and performing better in aspects such as thickening, gelling, and stabilizing, which is suitable for the development of a variety of functional foods.

[0015] 2. The starch gelatinization temperature of the StSS5 gene-edited lines is reduced. The low-temperature gelatinization shortens the heating time and speeds up the production speed, especially suitable for foods that require rapid processing. The above results provide new gene resources for the improvement of potato starch characteristics and new ideas for the functional research of starch synthesis-related genes. Description of the Drawings

[0016] Figure 1 It is a schematic diagram of the editing vector PTX041-StSS5;

[0017] Figure 2 It is the nucleic acid sequence of the sgRNA editing site;

[0018] Figure 3 It is the identification result of allelic variation of the edited lines;

[0019] Figure 4 It is the relative mRNA expression level of each amylase gene in the edited lines;

[0020] Figure 5 It is the detection result of soluble amylase activity in the edited lines;

[0021] Figure 6 For editing the phenotype of mini-tubers of the strain;

[0022] Figure 7 For the average weight of a single mini-tuber;

[0023] Figure 8 For the representative picture of iodine staining of mini-tubers;

[0024] Figure 9 For the starch content of mini-tuber tubers;

[0025] Figure 10 For the representative picture of starch granule detection of mini-tubers;

[0026] Figure 11 For the starch granule size distribution of mini-tuber tubers;

[0027] Figure 12 For the average effective diameter of starch granules in mini-tuber tubers;

[0028] Figure 13 For the phenotype of the development of soil-grown tubers of the edited strain;

[0029] Figure 14 For the average number of tubers of the edited strain;

[0030] Figure 15 For the weight of tubers per plant of the edited strain;

[0031] Figure 16 For the distribution of tubers of different weights of the edited strain;

[0032] Figure 17 For the dry matter content of tubers of the edited strain;

[0033] Figure 18 For the starch content of tubers of the edited strain;

[0034] Figure 19 For the soluble sugar content of tubers of the edited strain;

[0035] Figure 20 For the representative picture of the size of starch granules in soil-grown tubers;

[0036] Figure 21 For the starch granule size distribution of soil-grown tubers;

[0037] Figure 22 For the average effective diameter of starch granules in soil-grown tubers;

[0038] Figure 23 For the determination of the chain length of amylopectin in soil-grown tubers;

[0039] Figure 24 For the representative picture of the number of starch granules in amyloplasts of soil-grown tubers;

[0040] Figure 25 For the starch granule number distribution in the amyloplasts of soil-cultivated tubers;

[0041] Figure 26 For the representative pictures of the starch granule numbers in the chloroplasts of the edited lines' leaves;

[0042] Figure 27 For the starch granule number distribution in a single chloroplast of the edited lines;

[0043] Figure 28 For the representative iodine-stained pictures of the edited lines' leaves before darkness and before light;

[0044] Figure 29 For the starch content of the edited lines' leaves before darkness and before light. Detailed implementation manners

[0045] The following describes the detailed implementation manners of the present invention to facilitate those skilled in the art of this technology to understand the present invention. For those conditions not specified in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For the reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase. However, it should be clear that the present invention is not limited to the scope of the detailed implementation manners. For those ordinary skilled in the art of this technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions and creations using the concept of the present invention are within the scope of protection.

[0046] The nucleotide sequence of the potato StSS5 gene is as follows:

[0047] ATGGTTCTTACCAGTTTGATTGGCAGCAAGGAGGCATCAGAATTTAGATGGCTGGT

[0048] CATGGATTCAATAGGTAGTATAGCTGATTATTTCTCTGAGAAAATGCATAAACAGGACAC

[0049] TGAGCTTCTGGTAGAGCTGCGCCACTTCCCCCGGAAAAGTAGAAAGTCAGGTTACCACA

[0050] TAATCCACATTTGTACTGAAATGGCACCAGTGGTATCAGTTGGATCTTTGGCACCATATGT

[0051] AACTGGATTATCTCGTGCCTTGCAAAGAAAGGGAAATCTGGTCGAGGTTATCTTACCCA

[0052] AATATGCTAGCCTAAATTTAAATGAAGTTCATGGATTACGAGAAGTTGAGGCAGAGTTCC

[0053] ATTCATACTTTAATGGTCAACTGCATGGAAACAGAATCTGGACTGGGGTTGTCTGTGGCA

[0054] TTGGAGTGACTTTCATAGAACCTCTCTACTATTCAGCATTTTTCGGCTGTGAGAACATATA

[0055] TGGCTACTCAAATGATTTTGAACGATTCACCTACTTCTCTCGTGCTTCATTGGATTATATAA

[0056] TTAAAGCAGGAAAGCACCCGGATGTGCTTCATATACACAACTGGGAAACATCTATTGTTG

[0057] GTCCACTGTTTTGGGATGTTTTTGTAAATCAGGGACTTGGAGGTACCAGGATAATGTTGA

[0058] CATGTCAAAGCTTTGAGTCTCAGTGTGTAGAGCAACCTGAAAAGTTAGCCCTATGTGGG

[0059] CTTGATCCTTATGGACTACATTGTTCTGACCGTCTGCAAGATAACAACAAATCCCATCTTG

[0060] TCAATGTTTTGAAGGCTGGAGTGGTTTACTCCAACAATGTTATCATAATGTCATCCATGCA

[0061] AACAAAAGGGCAGATAATTCATGCTACGAGCCATGGTCTTGAGCCCACCTTAACTATACA

[0062] CAAGGACAAGTTAGTAGTTGCTCCTCCTGGATTCGACAGTTCAGCTTGGGATCCTTCAGT

[0063] AGATATGTTTCTACCACAAAACTATAGTGCAGATTTGAAGGGGAAATCTGTCTGCAAAGT

[0064] TTCGTTGCAGCAGCATCTGGGGTTGCAGGAGAAAGCATCCATTGTTCTTGTAGGTTTTAC

[0065] TCTGGTTGAAGATTTACCTGCAAAAGTTTATAACCAAACACTATTGATGGGGATTTCTCA

[0066] AAGATTATCTCTTCTTTTAGCTTTTTCTTTATGA(SEQ ID NO:1).

[0067] Example 1 Construction of the StSS5 gene editing vector

[0068] Using PTX041 as the CRISPR / Cas9 editing vector, two target sites were designed for its 5'UTR region and the first exon region to construct a gene editing vector. The vector was driven by the StU6 promoter and the 2×CaMV35S promoter to express sgRNA and Cas9 protein respectively ( Figure 1 ). After extracting RNA from potato tubers and reverse transcribing it into DNA using a kit, the amplified fragment of StSS5 was obtained. According to the amplified sequence, two sgRNA target sites were screened on the CRISPR 2.0 website according to the following principles: the target site starting with G was placed first; the GC content was 40%-80%; TSL = 3; GSL = 0; TBPS < 12; CB PS < 7; IBPS < 6. The two sgRNA (sgRNA1 and sgRNA2) target sites, one was located in the 5'UTR region and the other was located in the Exon region ( Figure 2 ). The sequence of sgRNA1 was: TGTTCCGGAGAGTTTGCATG (SEQ ID NO: 2); the sequence of sgRNA2 was: TCTCGTGCCTTGCAAAGAAA (SEQ ID NO: 3).

[0069] Example 2 Obtaining of the StSS5 gene editing lines

[0070] The constructed CRISPR / Cas9-StSS5 vector was transformed into potato plants to obtain gene-edited strains, and the editing efficiency was identified by sequencing. The Agrobacterium containing the PTX041 knockout vector of sgRNA was infected into potato tubers, and resistant buds were screened with kanamycin. PTX-F: ATGCTTCCGGCTCGTATGTT (SEQ ID NO: 4); PTX-R: GACCTGCAGGCATGCAAGCT (SEQ ID NO: 5) were used as primers, and DNA of 70 transgenic rooting strains was used as a template for PCR amplification. The rooting strain that could amplify a 750bp fragment was used as the transgenic strain, and CR8 and CR28 were detected as full allele editing strains by ACT-PCR. The sequencing sequences are shown in Figure 3 As shown, it is clear that it is a biallelic edited genotype.

[0071] By measuring the mRNA level of amylase gene and soluble amylase activity in the edited transgenic strains, it was found that the mRNA level of the enzyme in the StSS5 gene-edited strain was reduced, while the mRNA levels of other enzymes remained unchanged ( Figure 4 ), the total amylase activity of the edited lines did not change significantly ( Figure 5 ).

[0072] Example 3 Tuber development and starch properties analysis

[0073] The obtained StSS5 gene-edited lines (CR8 and CR28) were cultured in single stem segments and soil at the same time as normal potatoes (wild type WT), and the tuber development and starch characteristics were analyzed after harvest.

[0074] 1. The StSS5 gene-edited strain induced a decrease in the fresh weight of microtubers in vitro, a decrease in the starch content of tubers, and a decrease in the size of tuber starch granules.

[0075] (1) Single stem segments of tissue culture seedlings were cut and inserted into 8% MS medium and induced to tuber under the conditions of 8 h light and 16 h dark. Figure 6 As shown in Figure 2, compared with the wild-type (WT) control, the two StSS5 gene-edited lines (CR8 and CR28) produced smaller microtubers. By measuring the fresh weight of the microtubers, it was found that the fresh weight of the StSS5 gene-edited lines was significantly reduced ( Figure 7 ).

[0076] (2) To test the starch content of potato samples, weigh 5 g of potassium iodide and 2.5 g of iodine and dissolve them in a small amount of distilled water. Stir thoroughly and dilute to 50 mL. Titrate the prepared solution quantitatively onto potato slices and stain the mini potato slices for starch. Figure 8As shown, it can be seen from the figure that the staining of the two StSS5 gene - edited lines (CR8 and CR28) is significantly lighter than that of the wild - type, indicating that the starch content in CR8 and CR28 is significantly lower than that of the wild - type. Measuring the starch content of micro - tubers also shows consistent results( Figure 9 ).

[0077] (3) Analyze the morphology of starch granules extracted from micro - tubers and tubers grown in soil by scanning electron microscopy (SEM). Observe the morphology of starch granules. The specific steps are as follows: Weigh an appropriate amount of peeled potatoes, dice them, and then use a tissue blender to add water or grind them by hand. Filter through an 80 - mesh sieve and keep the filtrate. Let the filtered liquid stand for 2 - 3 h, discard the supernatant, repeat 2 - 3 times, place the precipitate in an oven at 40 °C for drying, and after drying, pass through an 80 - mesh sieve to obtain starch granules. Analyze the starch granule crystals with a scanning electron microscope. Fix the starch grains on a circular conductive aluminum sheet, sputter - coat with gold, and perform this experiment with a ZEISS Gem (ZEISS, Germany) electron microscope scanner at a voltage of 1.00 kV.

[0078] The results show( Figure 10 ) that the starch granules of each sample of micro - tubers cover different sizes, but the typical round or oval shape with smooth edges is maintained. The starch granules in the StSS5 gene - edited lines seem to be slightly smaller than those in the wild - type (WT).

[0079] (4) Use a particle size analyzer to detect the particle size distribution and average effective particle diameter of starch granules. The specific steps are as follows: Take an appropriate amount of starch granules in water or an organic phase, shake well and let stand for about 24 h to fully balance the sample and achieve a stable system for standby detection. Place the obtained liquid containing starch granules in a cuvette to measure the starch particle diameter, and repeat 3 times. Perform this experiment using DLS + PALS particle size measurement (nanoparticle size and Zeta potential analysis measurement).

[0080] The results show that the size distribution of starch granules in micro - tubers induced by the StSS5 gene - edited lines is different from that of the wild - type. The edited lines show a narrower particle size distribution than the wild - type, and contain a relatively higher proportion of small starch granules( Figure 11 ) and a lower average effective particle diameter( Figure 12 ).

[0081] 2. The fresh weight of tubers harvested from the StSS5 gene - edited lines grown in soil in pots decreases, the starch content decreases, the number of starch granules in amyloplasts increases, and the starch granule diameter becomes smaller.

[0082] To further analyze the in vivo effects of the StSS5 gene - edited lines on starch accumulation and tuber development characteristics, the wild - type (WT) and StSS5 gene - edited lines (CR8 and CR28) were planted in a soil substrate. After 2 months of planting, the number of tubers per plant, the number of tubers per individual plant, and the tuber size distribution were measured at harvest. The harvested tubers were used to determine the dry matter content, starch content, and soluble sugar content, and the morphology of tuber starch granules was observed, and the particle size distribution, effective particle size, and starch chain length distribution were measured.

[0083] (1) Determination of dry matter content: Select fresh potato tubers, cut them into filaments, weigh 50 g, and dry them in an oven until a constant weight (dry weight) is reached. The percentage of dry weight to fresh weight is the dry matter content.

[0084] (2) Determination of starch content:

[0085] ① Preparation of the standard curve: Weigh 0.1 g of soluble starch standard sample, add 2 mL of double - distilled water to fully disperse the starch sample. Add 3.2 mL of 60% perchloric acid solution to the starch dispersion, and make up the volume to 250 mL in a volumetric flask to obtain the stock starch solution. Respectively pipette 0.5, 1.0, 1.5, 2.0, 2.5, and 3.0 mL of the stock solution into 15 - mL graduated test tubes, then add double - distilled water to make the solution volume reach 8 mL. Finally, add 2 mL of the prepared iodine reagent to the test tubes, shake well, and let stand at room temperature for 5 min to obtain the standard solutions. The concentrations of the standard solutions are 20, 40, 60, 80, 100, and 120 μg / mL respectively. Measure the absorbance values of double - distilled water and the standard solutions at a light wavelength of 660 nm, using double - distilled water as the control to prepare the standard curve.

[0086] ② Sample detection: Grind potato tubers with liquid nitrogen, weigh 0.1 g and put it into a 2 - mL centrifuge tube, and at the same time add 200 μL of double - distilled water, and shake the mixture well. Pipette 320 μL of 60% perchloric acid into the well - dispersed mixture, and add double - distilled water to make up the mixture to 10 mL. After standing or centrifuging, take 50 μL of the supernatant and add it to a 2 - mL centrifuge tube, add 300 μL of double - distilled water and 200 μL of iodine reagent, and shake the mixture well. After standing for 5 min, add double - distilled water to make the solution volume reach 1 mL, using distilled water as the control, detect its absorbance value at a wavelength of 660 nm, and calculate the starch content according to the standard curve.

[0087] (3) Determination of soluble sugar content:

[0088] ① Take the dried potato slices, crush them and pass through an 80-mesh sieve. Weigh 0.1g into a 2mL centrifuge tube, add 1mL 80% ethanol, and perform 5 biological replicates for each sample. After 1h in an 80℃ water bath, centrifuge at 13000g for 3min. Carefully aspirate the supernatant into a new centrifuge tube, add 1mL 80% ethanol to the new centrifuge tube, repeat twice and place in an 80℃ oven to dry. Add 1mL deionized water to dissolve the precipitate to obtain a soluble sugar solution, and store at -20℃ for later use.

[0089] ② Take 50 μL of the soluble sugar solution obtained above to a 96-well PCR plate. Add 50 μL of DNS solution (21.0 g / L sodium hydroxide, 6.3 g / L dinitrosalicylic acid, 5.0 g / L crystalline phenol, 5.0 g / L sodium sulfite, 185.0 g / L potassium sodium tartrate), place it on a metal bath at 100°C for 5 minutes, and then immediately put it on ice to cool the liquid. Draw 100 μL of double distilled water to dilute the sample, take 100 μL to a 96-well ELISA plate, use an ELISA reader to measure the sample absorbance at a wavelength of 540 nm, and calculate the first content of reducing sugar.

[0090] ③ Pipette 50μL of the soluble sugar solution obtained above, and place 5 biological replicates of each sample on a 96-well PCR plate. Pipette 5μL of 5mol / L hydrochloric acid solution into each sample, let it stand on a 70℃ metal bath for 15min, and then immediately put it on ice to cool the liquid. Add an equal amount of sodium hydroxide solution to neutralize the hydrochloric acid. Add 60μL of an equal volume of DNS solution, repeat the above reducing sugar content determination steps, and obtain the second reducing sugar content. Finally, the sucrose content is calculated, and the calculation formula is as follows:

[0091] C = (AB) × 0.95;

[0092] Wherein, C is the sucrose content, mg / mL; A is the first reducing sugar content, mg / mL; B is the second reducing sugar content, mg / mL.

[0093] ④Soluble sugar content is the total content of reducing sugar content and sucrose content.

[0094] (4) Determination of starch chain length distribution:

[0095] ① Preparation of standard products: weigh 5 mg of DP4-DP7 from the oligosaccharide standard product set, resuspend in 5 mL of double distilled water, boil in a boiling water bath for 60 min, and vortex to mix intermittently; add 50 μL of sodium acetate (0.6 M, pH = 4.4), sodium azide (NaN 3, 10 μL, 2% w / v) and 10 μL isoamylase (1400 U), incubated at 37 °C for 24 h. Add 0.5% (w / v) sodium borohydride solution, vortex and mix well, then leave for 20 h. Take 600 μL and transfer it to a centrifuge tube, dry it under nitrogen at room temperature, then dissolve it in 30 μL of 1 M sodium hydroxide solution for 60 min. After that, add 570 μL of water for dilution, centrifuge at 12000 g for 5 min, and obtain the supernatant of the standard for loading.

[0096] ② Sample treatment: Replace the standard with the sample to be tested (about 10 mg of purified starch), and repeat step ① to obtain the supernatant of the sample to be tested for loading.

[0097] ③ Instrument analysis: Use Dionex TM CarboPac TM PA200 (250 * 4.0 mm, 10 μm) liquid chromatography column, with an injection volume of 5 μL. Mobile phase A: 0.2 M sodium hydroxide solution; Mobile phase B: 0.2 M sodium hydroxide solution / 0.2 M sodium acetate solution, column temperature is 30 °C, and an electrochemical detector is used to analyze and detect the components. The flow rate is 0.4 mL / min; Elution gradient: 0 min A / B (90:10 V / V), 10 min A / B (90:10 V / V), 30 min A / B (40:60 V / V), 50 min A / B (40:60 V / V); 50.1 min A / B (90:10 V / V); 60 min A / B (90:10 V / V).

[0098] ④ Use a Thermo ICS5000 ion chromatography system (ICS500 +, Thermo Fisher Scientific, USA) to analyze and detect starch.

[0099] (5) Observation of starch granules in amyloplasts by transmission electron microscopy (TEM)

[0100] Cut the fresh tuber tissue into small pieces of 1 - 3 mm 3 and quickly immerse them in a physiological solution with pH = 7.6 containing 2.5% glutaraldehyde, fix at 4 °C for 2 h; The samples are rinsed 3 times with 0.1 M phosphate buffer (pH = 7.2), 10 min each time, and then transferred to 1% (w / v) osmium tetroxide (OsO 4)In the solution, fix it for the second time at 4°C for 2 h. Then dehydrate it using gradient ethanol (50% → 70% → 90% → absolute ethanol, 15 min for each step), and gradually immerse it in the mixed solution of epoxy resin and absolute ethanol (volume ratios are 1:3, 1:1, and 3:1 in sequence, 2 min for each step), and finally transfer it to pure resin and let it stand overnight at room temperature. Place the sample in a polymerization mold at 60°C and cure it for 16 h. Cut the resin-embedded block into 70-nm-thick ultra-thin sections using a diamond knife, pick them up onto a copper mesh covered with a film, stain them in 3% (w / v) uranyl acetate solution for 8 min and 2.7% (w / v) lead acetate solution for 8 min in sequence, rinse with distilled water and then dry. Finally, observe the sections and take images using an HT7800 transmission electron microscope (Hitachi, Japan).

[0101] The results are as Figures 13 - 19 shown. During the whole plant growth period, there were no obvious differences in the above-ground parts between the StSS5 gene-edited lines and wild-type plants ( Figure 13 ). However, since the tubers produced by the StSS5 gene-edited lines were smaller than those of the wild type ( Figure 13 ), there were no significant differences in the number of tubers ( Figure 14 ), and the fresh weight of tubers per plant was significantly reduced ( Figure 15 and Figure 16 ). Compared with the wild type, the dry matter content decreased ( Figure 17 ), and the starch content of the StSS5 gene-edited lines also decreased significantly ( Figure 18 ). In addition, compared with the wild type, the soluble sugar content in the tubers of the edited lines also decreased ( Figure 19 ). The above results indicate that the StSS5 gene is crucial for potato tuber development / swelling and starch accumulation.

[0102] The results of tuber starch morphology observation were consistent with those of minitubers. The starch granules of each sample covered different sizes, but the typical round or oval shape with smooth edges was maintained ( Figure 20 ), and the starch granules in the StSS5 gene-edited lines seemed to be smaller than those in the wild type (WT).

[0103] The particle size distribution and average effective particle diameter of starch granules were detected using a particle size analyzer. The results showed that the starch granule size distribution in the StSS5 gene-edited lines was different from that of the wild type. The edited lines showed a narrower particle size distribution than the wild type, with a relatively higher proportion of small starch granules ( Figure 21 ) and a smaller average effective starch particle diameter ( Figure 22 ). The determination of the amylopectin chain length distribution showed that the relative peak area ratio curves corresponding to different amylopectin polymerization degrees in the StSS5 gene-edited lines did not change, indicating that editing the StSS5 gene did not affect the amylopectin chain length distribution ( Figure 23 ).

[0104] In addition, by observing the sections of developing tubers through TEM, significant heterogeneity of amyloplasts was found in the StSS5 gene-edited lines. The starch granules in both the wild type (WT) and the edited lines were round or oval with smooth edges. The amyloplasts in the wild type contained only single starch granules, while a few amyloplasts in the StSS5 gene-edited lines contained compound starch granules ( Figure 24 ). The number of independent "granules" observed in the sections of each compound starch granule varied, ranging from 2 to 6 ( Figure 25 ). Taken together, these data indicate that the StSS5 gene-edited lines result in the formation of compound starch granules in amyloplasts, suggesting that the StSS5 gene plays a key role in the initiation of single starch granules in potato tuber amyloplasts.

[0105] 3. The number of starch granules in the chloroplasts of the StSS5 gene-edited lines decreased, and the rate of starch degradation in the leaves at night was reduced.

[0106] When the leaves were taken at 1 month of potato growth and observed by TEM for the starch granules in the chloroplasts of the StSS5 gene-edited lines, leaf segments were cut from the middle of fully expanded leaves for fixation and observation, and fully expanded leaves were stained with iodine and the leaf starch content was measured before the start of light and before the end of darkness.

[0107] Leaf iodine staining: Prepare iodine reagent: Weigh 5 g of potassium iodide and 2.5 g of iodine, dissolve them in a small amount of distilled water, stir well and make up the volume to 50 mL, then store it in a 4 °C refrigerator. The leaves were placed in 95% ethanol and boiled in a water bath for decolorization 3 - 5 times to fully dissolve the chlorophyll in the leaves. The decolorized leaves were stained with iodine in the iodine reagent diluted 160 times for 1 min, and the staining situation of the leaves was observed.

[0108] From Figure 26 and 27 it can be seen that the number of starch granules in the chloroplasts of the StSS5 gene-edited lines decreased compared with the wild type.

[0109] To further characterize the characteristics of transient starch metabolism in the leaves of the StSS5 gene-edited lines, the daily / night changes of starch content in the leaves were measured under a 12 h light / 12 h dark photoperiod. Iodine staining of the leaves collected at the end of the night showed that the StSS5 gene-edited lines exhibited a phenotype of excessive starch accumulation ( Figure 28 ), and the starch content measurement in the leaves collected at the end of the night, i.e., before the start of light, showed that the starch content in the leaves of the edited lines was significantly higher than that of the wild type ( Figure 29 ).

[0110] 4. The gelatinization temperature of tuber starch in the StSS5 gene-edited lines decreased.

[0111] After harvesting mature tubers and extracting and purifying starch, a differential scanning calorimeter (DSC) was used to scan the thermal changes of the fully balanced starch sample. The specific steps for determining the gelatinization temperature are as follows:

[0112] (1) Wash fresh potatoes with water to remove dirt and impurities on the surface, then put them into a crusher or grinder, add an appropriate amount of distilled water to crush them into slurry. Then, filter the slurry through a 100-200 mesh sieve to separate the starch milk and fiber residue, and collect the filtrate. Pour the starch milk into a beaker and let it stand for 2-3 hours to allow the starch to precipitate, and carefully pour off the upper liquid. Then, add distilled water to the precipitated starch, stir evenly, and let it stand again for 1-2 hours. Repeat the washing 2-3 times until the upper liquid is clear. Pour the washed starch slurry into a centrifuge tube, centrifuge at 3000-4000 rpm for 10-15 minutes, remove excess water and collect the wet starch. Spread the wet starch evenly on a petri dish or aluminum foil, and dry it in an oven at 40-50°C to constant weight. Finally, sieve the dried starch sample to ensure uniform particles, and store it in a sealed container in a dry place.

[0113] (2) Take 2.5-3.1 mg of starch sample in a 2 mL centrifuge tube, add appropriate amount of deionized water, the mass ratio of starch to water is 1:2, and equilibrate at 16 °C for 24 hours before analysis. Raise the temperature from 0 °C to 90 °C at a rate of 10 °C / min, scan the heat change, analyze the change in sample enthalpy value, and detect the phase change process of the sample with temperature change.

[0114] The initial gelatinization temperature (To), gelatinization peak temperature (Tp), gelatinization final temperature (Tc) and gelatinization enthalpy (ΔH) of starch gelatinization process were analyzed. The results are shown in Table 1. The initial gelatinization temperature and gelatinization peak of starch granules of StSS5 gene-edited strains CR8 and CR28 were significantly lower than those of wild type; the gelatinization final temperature of CR28 was significantly lower than that of wild type; and there was no significant change in gelatinization enthalpy. This indicates that the gelatinization endothermic process of starch granules changes after the normal function of StSS5 gene is lost, and the gelatinization peak temperature and gelatinization final temperature are significantly affected.

[0115] Table 1 Starch gelatinization temperature measurement results

[0116] Strain To(℃) Tp(℃) Tc(℃) ΔH(J / g) WT 65.93±0.06 68.45±0.09 72.42±0.35 2.774±0.34 CR8 64.70±0.27** 67.55±0.19** 72.08±0.36 2.392±0.34 CR28 64.31±0.06** 66.82±0.13** 70.63±0.74* 2.084±0.46

Claims

1. Application of potato StSS5 gene in regulating tuber and starch granule size, characterized in that: The nucleotide sequence of the StSS5 gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: By inhibiting or knocking out the StSS5 gene, the size of plant tubers and their starch granules can be regulated and the gelatinization temperature of tuber starch can be reduced.

3. The use according to claim 2, characterized in that: By inhibiting or knocking out the StSS5 gene, the plant tuber size and the average starch granule size are reduced, and the proportion of small starch granules is increased, so as to regulate the size of plant tubers and their starch granules and reduce the gelatinization temperature of tuber starch.

4. The use according to claim 2 or 3, characterized in that: The tuber size includes the fresh weight of the tuber.

5. The use according to claim 2 or 3, characterized in that: The starch granule size properties include the diameter of tuber starch granules and the number of starch granules in amyloplasts.

6. The use according to claim 2 or 3, characterized in that: The plant is a dicotyledonous plant.

7. The use according to claim 6, characterized in that: The plant is potato.

Images