Construction method of donor fragment for gene insertion
Through Gibson assembly and PCR methods, the problems of high failure rate and high mutation possibility in traditional donor fragment construction methods are solved, and a higher construction success rate and shorter construction time are achieved.
Patent Information
- Application Number
- CN202411990367.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-06-13
AI Technical Summary
Traditional donor fragment construction methods have high failure rates when constructing longer homologous arms and high possibility of mutation, resulting in a low success rate of gene insertion.
Using a Gibson assembly and PCR-based approach, recombinant plasmids were gradually constructed by designing appropriate primers and performing multiple rounds of PCR to reduce mutation risk and improve construction success rate.
It effectively reduces the risk of mutation during the construction of donor fragments, improves the construction success rate, and can complete the initial construction of insertion fragments in as fast as 2 rounds of PCR, significantly shortening the construction time of donor fragments.
Smart Images

Figure CN120138010A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering, and particularly to a method for constructing a donor fragment for gene insertion. Background Art
[0002] Homologous Recombination refers to the recombination that occurs between non-sister chromatids or between or within DNA molecules containing homologous sequences on the same chromosome. Genome editing based on homologous recombination has advantages such as few or no off-target effects and no residues.
[0003] In the field of Escherichia coli genetic engineering, the red homologous recombination system based on the λ phage red operon is one of the most widely used homologous recombination systems.
[0004] When using the Escherichia coli red system homologous recombination system for gene insertion in Escherichia coli, it is necessary to construct a donor fragment. For the traditional method of constructing a donor fragment, if a long homologous arm is to be constructed, it is necessary to separately amplify the upstream fragment, downstream fragment, and insertion fragment by PCR, and then construct the upstream fragment, downstream fragment, and insertion fragment into a complete donor fragment by overlap-PCR.
[0005] The failure rate of the construction process is high, and the possibility of mutation is large. Summary of the Invention
[0006] The present invention proposes a method for constructing a donor fragment required for homologous recombination for knockout and knock-in based on Gibson assembly and PCR, which can effectively reduce the risk of mutation of the donor fragment during the construction process of the donor fragment, improve the success rate of constructing the donor fragment, and can complete the preliminary construction of the insert fragment in as fast as 2 rounds of PCR, that is, within 3 days.
[0007] To achieve the above objectives, the present invention adopts the following technical solutions:
[0008] A method for constructing a donor fragment for gene insertion, comprising the following steps,
[0009] (1) Design primers 1 and 2 according to the genomic sequence, perform PCR on the genome to obtain the upstream and downstream fragments of the insertion site;
[0010] (2) Design primers 3 and 4 according to the plasmid sequence, perform PCR on the plasmid or the target cell carrying the plasmid to obtain a linearized plasmid;
[0011] (3) Purify the upstream and downstream fragments of the insertion site in (1) and the linearized plasmid in (2) by a purification kit, and then obtain a recombinant plasmid through Gibson assembly;
[0012] (4) Screen the target cells transformed with the recombinant plasmid to obtain transformants with successful recombination;
[0013] (5) Design primer 5 and primer 6 to perform PCR amplification on the transformants obtained in (4), design primer 7 and primer 8 to amplify the DNA fragment to be inserted, and after purification by a purification kit, assemble the fragments amplified by primer 5 and primer 6, and primer 7 and primer 8 through Gibson assembly;
[0014] (6) Transform the fragment in (5) into target cells and screen to obtain transformants carrying the donor fragment;
[0015] (7) Obtain the donor fragment from the transformants in (6) by PCR or restriction enzyme digestion.
[0016] According to the embodiments of the present invention, if the plasmid after extraction is used as a PCR template to obtain a linearized plasmid in step (2) or (5), the PCR product should be digested with DpnI enzyme after purification to avoid a high proportion of false positives in the transformants.
[0017] According to the embodiments of the present invention, the design basis of primer 1 and primer 2 in step (1) is the requirement of genome site-directed insertion. 1 / 2 primers should be designed within the segments on both sides of the designed insertion site that meet the length requirements of homologous arm design; Gibson assembly relies on homologous arms, and this homologous arm can be set on the inserted fragment (note: in this case, primer 1 / 2 carries the homologous arm of the fragment to be inserted), or it can be set on the plasmid backbone (note: in this case, primer 3 / 4 carries the homologous arm of the plasmid).
[0018] The design basis of primer 3 and primer 4 is to integrate the fragment obtained by PCR of primer 1 and primer 2 into the target plasmid. According to step (2) of the embodiments of the present invention, primer 3 and primer 4 are generally designed at the multiple cloning site of the plasmid, with or without the homologous arms required for Gibson assembly according to the Gibson assembly plan.
[0019] According to the embodiments of the present invention, primer 5 and primer 6 in step (5) carry or do not carry the homologous arms required for Gibson assembly according to the Gibson assembly plan.
[0020] According to the embodiments of the present invention, primer 7 and primer 8 in step (5) carry or do not carry the homologous arms required for Gibson assembly according to the Gibson assembly plan.
[0021] According to an embodiment of the present invention, the target cells are A673 cells, CHO-S cells, CHO cells, vero cells, sf9 cells, 293F cells, HEK293T cells, plant cells, Saccharomyces cerevisiae, Yarrowia lipolytica, tea yeast, Saccharomyces cerevisiae, Lipomyces starkeyi, Xanthophyllomyces dendrorhous, Candida utilis, Brettanomyces anomalus, Schizosaccharomyces pombe, Uvaea uvarum, Wickerhamomyces anomalus, Pichia pastoris, Rhodotorula glutinis, Schizosaccharomyces pombe, Kluyveromyces, Cryptococcus neoformans, Aspergillus oryzae, Aspergillus carbonarius, Cephalosporium acremonium, Botrytis cinerea, Penicillium chrysogenum, Rhizopus nigricans, Rhizopus, Tetraspora elegans, Trichoderma harzianum, Rhizopus microsporus, Pseudotrichoderma, Trichoderma polysporum, Embellisia nepalensis, Aspergillus awamori, Penicillium griseofulvum, Aspergillus ochraceus, Aspergillus fischeri, Trichoderma humidicola, Trichothecium roseum, Mucor, Scopulariopsis brevicaulis, Aspergillus wentii, Aspergillus niger, Agrobacterium, Mutant mold, Trichoderma tomentosum, Trichoderma citrinoviride, Penicillium sclerotiorum, Aspergillus uvae, Penicillium brevicompactum, Penicillium italicum, Penicillium digitatum, Aspergillus flavus, Aspergillus fumigatus, Trichoderma reesei, Monascus purpureus, Aspergillus flavus, Aspergillus nidulans, Streptomyces venezuelae, Streptomyces bottropensis, Streptomyces albus, Streptomyces griseus, Streptomyces albidoflavus, Streptococcus thermophilus, Streptomyces flaveolus, Streptomyces roseosporus, Staphylococcus, Vibrio cholerae, Pseudomonas aeruginosa, Pseudomonas syringae, Listeria monocytogenes, Pseudomonas fluorescens, Porphyromonas gingivalis, Pseudomonas cepacia, Pseudomonas mobilis, Pseudomonas pseudomallei, Pseudomonas stutzeri, Pseudomonas alcaligenes, Pseudomonas putida, Klebsiella pneumoniae, Legionella pneumophila, Enterobacter cloacae, Escherichia coli, Escherichia coli Nissle, Acetobacter pasteurianus, Enterococcus faecalis, Enterobacter citronellol, Brucella, Streptococcus suis, Pectobacterium, Bacillus anthracis, Klebsiella pneumoniae, Corynebacterium glutamicum, Salmonella enteritidis, Serratia marcescens, Salmonella, Lactobacillus rhamnosus, Lactobacillus casei, Clostridium botulinum, Bacillus pumilus, Bacillus alcalophilus, Arthrobacter, Paenibacillus, Bacillus safety, Bacillus licheniformis, Bacillus megaterium, Bacillus thuringiensis, Bacillus subtilis, Chromobacterium violaceum, Bacillus pasteurii, Bacillus cereus, Streptomyces coelicolor, Helicobacter pylori, Candida goat, Candida albicans, Candida parapsilosis, Candida intermedia, Candida glabrata, Candida, Acidithiobacillus ferrooxidans, Mycobacterium tuberculosis, Lactobacillus acidophilus, Enterococcus gallinarum, Lactococcus lactis, Lactococcus garvieae, Lactobacillus casei, Rhodococcus, Rhodococcus rhodochrous, Haemophilus parasuis, Mycobacterium smegmatis, Agrobacterium, Lactobacillus brevis, Acidithiobacillus ferrooxidans, Agrobacterium rhizogenes, Pasteurella, Lactobacillus reuteri, Acinetobacter baumannii, Bifidobacterium lactis, Photobacterium phosphoreum, Lactobacillus helveticus, Lactobacillus plantarum, Lactococcus lactis, Lactobacillus, Malassezia koebe, Malassezia, Serratia fonticola, Xanthomonas campestris, Xanthomonas arboricola, Aeromonas veronii, Aeromonas hydrophila, Aeromonas salmonicida, Aeromonas sobria, Xanthomonas oryzae pv. oryzicola, Fusarium oxysporum, Fusarium xylarioides, Fusarium graminearum, Fusarium solani, Fusarium proliferatum, Sinorhizobium meliloti, Bradyrhizobium elkanii, Shigella,Any one of Shigella dysenteriae, Botrytis pilosa, Cryptococcus gattii, Claviceps purpurea, Rheinheimera aquimaris, Ancylobacter cupriphilus, Micrococcus lysodeikticus, Micrococcus luteus, Fusobacterium nucleatum, Aspergillus echinulatus, Streptococcus equi, Echinococcus granulosus, Pediococcus pentosaceus, Beauveria bassiana, Metarhizium anisopliae, Vibrio qinghaiensis, Vibrio harveyi, Vibrio natriegens, Schizochytrium sp., Clostridium difficile, Chlamydomonas reinhardtii, Chlorella vulgaris, Volvox carteri, Synechococcus elongatus, Ehrlichia sp., Proactinomyces sp., Actinosynnema pretiosum, Actinoplanes sp., Amycolatopsis orientalis, Azotobacter chroococcum, Shewanella putrefaciens.
[0022] According to an embodiment of the present invention, the screening method in the step (4) or (6) is any one of antibiotic plate screening, fluorescence screening, gas production screening, and color development screening.
[0023] The beneficial effects of the present invention are as follows:
[0024] 1. The more PCR cycles, the greater the possibility of introducing mutations during vector construction.
[0025] 2. This method can effectively reduce the number of PCR cycles, reduce labor intensity and reagent consumption.
[0026] 3. This method can effectively reduce the number of transformation times. When used for the construction of donor fragments for site-directed editing, the donor fragment preparation can be completed within two rounds of PCR at the fastest, and can significantly shorten the construction time of donor fragments. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 It is a schematic diagram of the construction process of the donor fragment of the method of the present invention.
[0028] Figure 2 It is a schematic diagram of the construction process of the insertion of the penicillin resistance gene of Escherichia coli in Example 1.
[0029] Figure 3 It is the PCR verification electrophoresis result diagram of constructing the PUC57-kan plasmid carrying the upstream and downstream fragments of the insertion site in Example 1.
[0030] Figure 4 It is the PCR verification electrophoresis result diagram of constructing the donor fragment containing the inserted penicillin resistance gene in Example 1 DETAILED DESCRIPTION OF THE INVENTION
[0031] The present invention will be specifically introduced below with reference to the accompanying drawings and specific embodiments.
[0032] As Figure 1 shown, a method for constructing a donor fragment for gene insertion includes the following steps.
[0033] (1) Design primers 1 and 2 according to the genomic sequence, perform PCR on the genome to obtain the upstream and downstream fragments of the insertion site;
[0034] (2) Design primers 3 and 4 according to the plasmid sequence, perform PCR on the plasmid or target cells carrying the plasmid to obtain a linearized plasmid;
[0035] (3) Purify the upstream and downstream fragments of the insertion site in (1) and the linearized plasmid in (2) using a purification kit, and then obtain a recombinant plasmid through Gibson assembly;
[0036] (4) Screen the target cells transformed with the recombinant plasmid to obtain successfully recombinant transformants;
[0037] (5) Design primers 5 and 6 to perform PCR amplification on the transformants obtained in (4), design primers 7 and 8 to amplify the DNA fragment to be inserted, and after purification using a purification kit, perform Gibson assembly on the fragments amplified by primers 5 and 6, and primers 7 and 8;
[0038] (6) Transform the fragments in (5) into target cells and screen to obtain transformants carrying the donor fragment;
[0039] (7) Obtain the donor fragment from the transformants in (6) by PCR or restriction enzyme digestion.
[0040] Example 1
[0041] Construction of an Escherichia coli penicillin resistance gene inserted donor:
[0042] Find a suitable gene insertion site from the genomic database according to the design. In this example, the vector selects the PUC57 plasmid;
[0043] Primer 1: gaattcgagctcggtacctccgaagattccgggctgactaacg
[0044] Primer 2: ggatccgatatctagatgcacagcgcagcgttgatgctatccg
[0045] Primer 3: tgcatctagatatcggatcccgg
[0046] Primer 4: cgcgaggtaccgagctcgaattcac
[0047] Primer 5 (for insertion): caatataggcatagcgcacagacag
[0048] Primer 6 (for insertion): gttaaagtatttagtgacctaagtc
[0049] Primer 7 (for penicillin resistance insertion): gacttaggtcactaaatactttaacttaccaatgcttaatcagtgaggc
[0050] Primer 8 (for penicillin resistance insertion): ctgtctgtgcgctatgcctatattgtaaacaaataggggttccgcg
[0051] The primer concentration of the above primers is 10 pmol / L.
[0052] Gene sequence related to the insertion site:
[0053]
[0054] Penicillin resistance gene:
[0055] Ttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcg。
[0056] PUC57-kan plasmid:
[0057]
[0058] The PCR system is as follows:
[0059] Component Dosage (50 μL system) Final system concentration 5×PrimeSTAR GXL Buffer 10 μL 1× dNTP Mixture (2.5 mM each) 4 μL 200 μM 10 μM forward primer 10 - 15 pmol 0.2 - 0.3 μM 10 μM reverse primer 10 - 15 pmol 0.2 - 0.3 μM Template DNA *1 X μL (50 - 100 ng) / DNA Polymerase 2 μL 1.25 U / 50 μL Sterile water ddH2O (20 - X) μL /
[0060] The PCR program is as follows:
[0061]
[0062] The Gibson assembly system is as follows:
[0063]
[0064] Gibson assembly conditions: Incubate in a 50°C water bath or metal bath for 20 minutes
[0065] As Figure 2 shown, the specific process is as follows:
[0066] (1) Primers 1 and 2 amplify the upstream and downstream fragments of the insertion site containing the full-length thrA gene in Escherichia coli BL21 according to the shown PCR system and reaction conditions.
[0067] (2) Primers 3 and 4 amplify Escherichia coli cells carrying the PUC57-kan plasmid according to the shown PCR system and reaction conditions.
[0068] (3) Gibson assemble the fragments obtained with primers 1-2 and primers 3-4 (the fragments must be purified using a purification kit before assembly).
[0069] (4) Heat shock transform the plasmid obtained in (3) and screen for successfully recombinant colonies on a kanamycin antibiotic plate.
[0070] (5) The colonies obtained in (4) are subjected to PCR verification with the universal primers M13 fwd and M13 rev. If the electrophoresis result length is close to 1050 bp, it is considered that the vector construction is successful. The specific results are as Figure 3 shown.
[0071] (6) Amplify the Escherichia coli transformant cells verified correctly in (5) with primers 5 and 6, amplify the penicillin resistance gene with primers 7 and 8, and Gibson assemble the fragments obtained with primers 5-6 and primers 7-8 (the fragments must be purified using a purification kit before assembly).
[0072] (7) Heat shock transform the plasmid obtained in (6) and screen for successfully recombinant colonies on a kanamycin antibiotic plate.
[0073] (8) The colonies obtained in (7) are subjected to PCR verification with the universal primers M13 fwd and M13 rev. If the electrophoresis result length is close to 2050 bp, it is considered that the vector construction is successful. The specific results are as Figure 4 shown.
[0074] (9) The correctly verified transformants, i.e., the transformants carrying the plasmid with the knockout donor fragment, can be used to obtain the donor fragment required for homologous recombination by PCR or restriction enzyme digestion in the subsequent steps.
[0075] The basic principles, main features and advantages of the present invention have been shown and described above. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form. Any technical solutions obtained by using equivalent replacement or equivalent transformation fall within the protection scope of the present invention.
Claims
1. A method for constructing a donor fragment for gene insertion, comprising the following steps: (1) Designing primers 1 and 2 according to the genome sequence, performing PCR on the genome to obtain upstream and downstream fragments of the site to be inserted; (2) designing primers 3 and 4 according to the plasmid sequence, and subjecting the plasmid or target cells carrying the plasmid to PCR to obtain a linearized plasmid; (3) purifying the upstream and downstream fragments of the insertion site in (1) and the linearized plasmid in (2) using a purification kit and then assembling them together by Gibson assembly to obtain a recombinant plasmid; (4) Screening the target cells transformed with the recombinant plasmid to obtain transformants with successful recombination; (5) Designing primers 5 and 6 to perform PCR amplification on the transformants obtained in (4), designing primers 7 and 8 to amplify the DNA fragment to be inserted, and assembling the fragment obtained by amplification of primers 5 and 6, and primers 7 and 8 through Gibson method after purification; (6) transforming the fragment in (5) into target cells and screening to obtain transformants carrying the donor fragment; (7) The transformant in (6) is subjected to PCR or restriction digestion to obtain the donor fragment.
2. The method according to claim 1, characterized in that: If the extracted plasmid is used as a PCR template to obtain a linearized plasmid in step (2) or (5), the PCR product should be cut with DpnI enzyme after purification.
3. The method according to claim 1, characterized in that: The design of primers 1 and 2 in step (1) is required for genome site-specific insertion, and should be within the region on both sides of the designed insertion site and in accordance with the homology arm design length requirements; the homology arms required for Gibson assembly may or may not be designed according to the Gibson assembly plan.
4. The method according to claim 1, characterized in that: Primers 3 and 4 in step (2) are designed based on integrating the fragments obtained by PCR of primers 1 and 2 into the target plasmid; and are designed with or without homology arms required for Gibson assembly according to the Gibson assembly plan.
5. The method according to claim 1, characterized in that: Primer 5 and primer 6 in step (5) are designed with or without homology arms required for Gibson assembly according to the Gibson assembly plan.
6. The method according to claim 1, characterized in that: Primer 7 and primer 8 in step (3) are designed with or without homology arms required for Gibson assembly according to the Gibson assembly plan.
7. The method according to claim 1, characterized in that The target cells are A673 cells, CHO-S cells, CHO cells, Vero cells, sf9 cells, 293F cells, HEK293T cells, plant cells, Saccharomyces cerevisiae, oleaginous yeast, tea yeast, Saccharomyces cerevisiae, Lipomyces strewingii, Phaffia rhodozyma, Candida ruanensis, Brettia heterotypica, Schizosaccharomyces pombe, Saccharomyces ulmoides, Saccharomyces veyci, Pichia pastoris, Rhodosporium toruloides, Saccharomyces bisporus, Saccharomyces cerevisiae, Cryptococcus albicans, Aspergillus oryzae, Aspergillus carbonicus, Cephalosporium acrosporum, Botrytis cinerea, Penicillium chrysogenum, Rhizopus nigricans, Rhizopus tetrasporus, Trichoderma harzianum, Rhizopus microplus, Trichoderma pseudotrichoderma, Trichoderma polysporum, Aspergillus awamori, Penicillium griseo-yellow, Aspergillus ochraceus, Aspergillus fischeri, Trichoderma deliquescent, Trichothecene pink, Mucor, Aspergillus brevis, Aspergillus weihennii, Aspergillus niger, Agrobacterium, Mutant mold, Trichoderma tomi, Trichoderma citron, Penicillium sclerotium, Aspergillus wuwa, Penicillium brevis, Penicillium italicum, Penicillium citrinum, Aspergillus flavus, Aspergillus fumigatus, Trichoderma reesei, Monascus, Aspergillus flavus, Aspergillus nidulans, Streptomyces venezuelae, Streptomyces posse, Streptomyces albus, Streptomyces griseus, Streptomyces white mustard, Streptococcus thermophilus, Streptomyces microflavus, Streptomyces roseospore, Staphylococcus, Vibrio cholerae, Pseudomonas aeruginosa, Pseudomonas syringae, Listeria monocytogenes, Pseudomonas fluorescens, Porphyromonas gingivalis, Pseudomonas cepacia, Pseudomonas motil, Pseudomonas whitmore, Pseudomonas stutzeri, Pseudomonas alcaligenes, Pseudomonas putida, Klebsiella pneumoniae, Legionella pneumoniae, Enterobacter cloacae, Escherichia coli, Escherichia coli Nissle, Acetobacter pasteurianus, Enterococcus faecalis, Enterobacter citrate, Brucella, Streptococcus suis, Pectinobacillus, Bacillus anthracis, Klebsiella pneumoniae, Corynebacterium glutamicum, Salmonella enteritidis, Serratia marcescens, Salmonella, Lactobacillus rhamnosus, Bacillus coagulans, Clostridium botulinum, Bacillus brevis, Bacillus alkaliphilus, Arthrobacter, Paenibacillus, Bacillus licheniformis, Bacillus megaterium, Bacillus thuringiensis, Bacillus subtilis, Bacillus violaceus, Bacillus pasteurianus, Bacillus cereus, Streptomyces coelicolor, Helicobacter pylori, Candida albicans, Candida paradida, Candida intermedia, Candida glabrata, Candida, Thiobacillus ferrooxidans, Mycobacterium tuberculosis, Lactobacillus acidophilus, Gallina Enterococci, Lactococcus lactis, Lactococcus garvei, Lactobacillus casei, Rhodococcus, Rhodococcus edulis, Haemophilus parasuis, Mycobacterium smegmatis, Agrobacterium, Lactobacillus brevis, Thiobacillus ferrooxidans, Agrobacterium carcinoma, Pasteurella, Lactobacillus reuteri, Acinetobacter baumannii, Bifidobacterium lactis, Photobacterium luminescentis, Lactobacillus helveticus, Lactobacillus plantarum, Streptococcus lactis, Lactobacillus, Malassezia kangpi, Malassezia, Serratia juquanensis, Xanthomonas vesicularis, Xanthomonas arborescens, Aeromonas vernix, Aeromonas hydrophila, Aeromonas salmonicida, Aeromonas sobria, Xanthomonas oryzae, Fusarium lanceolata, Fusarium graminearum, Fusarium solani, Fusarium proliferating, Sinorhizobium, Brachyrhizobium thunbergii, Shigella, Shigella dysenteriae, Botrytis cinerea,Any one of Cryptococcus gattii, Claviceps ergotis, Lysodesella fluvira, Ancylostoma glutinosa, Micrococcus lysodeikticus, Micrococcus luteus, Fusobacterium nucleatum, Echinococcus, Streptococcus equine, Echinococcus, Pediococcus pentosaceus, Beauveria bassiana, Metarhizium anisopliae, Vibrio qinghaiensis, Vibrio harveyi, Vibrio natrii, Schizochytrium, Clostridium difficile, Chlamydomonas, Volvox vulgaris, Synechococcus, Erythrozoon, Proactinomycetes, Actinomycetes precious, Actinomycetes motile, Amycolatopsis orientalis, Azotobacter nitrofusus, and Shewanella putrefaciens.
8. The method according to claim 1, characterized in that The screening method in step (4) or (6) is any one of antibiotic plate screening, fluorescence screening, gas production screening, and colorimetric screening.