Direct-RAA-RDB gene detection method and thalassemia detection kit

Abstract

The invention discloses a direct isothermal-RDB gene detection method, and particularly relates to a Direct-RAA-RDB gene detection method, which is based on the detection principle of direct isothermal RAA combined with reverse dot hybridization, comprises the following steps: pretreating a sample to be detected by using a sodium hydroxide solution, amplifying a specific fragment by using an RAA specific primer, and detecting the specific fragment by using a reverse dot hybridization method. According to mutation sites of all genotypes, corresponding amplification primers and probes are designed, biotin is used for labeling the primers, amino is used for labeling the probes, a gene chip is used as a substrate, the probes are fixed on the gene chip, then an RAA product and the probes are hybridized, and gene detection is carried out through interpretation of a signal color box. Meanwhile, the method disclosed by the invention is applied to detection of the thalassemia gene, and a thalassemia gene detection kit consisting of the primer, the probe, a gene chip and the like is developed. The method has the characteristics of simplicity and convenience in operation, rapidness in typing, low cost, intuitiveness in result interpretation and the like.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and particularly relates to a direct isothermal-RDB gene detection method, especially a method for Direct-RAA-RDB gene detection and a kit for detecting thalassemia. Background Art

[0002] Recombinase Aided Amplification (RAA) is based on the principle of recombinase-mediated isothermal amplification and uses specific primers to accurately amplify target nucleic acid sequences. The recombinase can bind to primer DNA at room temperature to form an aggregate of the enzyme and the primer. When the primer searches for a complementary sequence that exactly matches the template DNA, the double-stranded structure of the template DNA can be unfolded with the help of single-stranded DNA binding protein, resulting in the formation of a new complementary DNA strand under the action of DNA polymerase, and the amplification product grows exponentially. In short, RAA can amplify DNA / RNA in a relatively short time (5 - 30 minutes) and under isothermal conditions (37 - 42°C). RAA does not require a sophisticated PCR instrument, and can be completed with just a constant temperature water bath or a metal bath instrument, and does not significantly reduce the overall sensitivity or specificity, making it a rapid and simple POCT method. However, like ordinary PCR, nucleic acid extraction is also required in the sample preparation stage of RAA. In this process, nucleic acid extraction reagents and instruments are needed for repeated adsorption and elution. Establishing a detection method that does not require an extraction process and shortens the detection time has become a desideratum.

[0003] Reverse dot blot (RDB) technology uses the principle of molecular hybridization to design specific probes for each site to detect the amplified products. The amplified products are biotin-labeled and covalently bound to streptavidin labeled with HRP, which catalyzes TMB to produce a color reaction to visualize the results. Since one avidin molecule can bind multiple biotin molecules and their extremely high affinity, it makes it possible to amplify the detection signal of the system. Multiple gene probes can be loaded on one membrane in RDB to simultaneously detect multiple sites in one tube, and can distinguish heterozygotes and homozygotes of point mutations. Therefore, RDB realizes a high data throughput reaction that can detect multiple target sequences in one hybridization reaction.

[0004] Thalassemia is a hereditary hemoglobinopathy that threatens global public health. There is currently no good treatment for thalassemia. Prenatal diagnosis to reduce the birth of children with severe thalassemia is the best prevention and control measure. Therefore, more accurate and easier-to-implement detection methods are needed to increase the detection rate of thalassemia. Several established detection methods for non-deletion thalassemia still need to be improved in terms of operability, sensitivity, and on-site applicability. Gene sequencing is considered the "gold standard" for detecting thalassemia, but it relies on expensive detection equipment and specialized laboratory conditions, is not suitable for rapid large-scale detection, and is more suitable for detecting rare or new mutations. The ARMS-PCR method can also be applied to the detection of point mutations, but designing specific primers for the target sequence is complex and difficult. PCR-RDB has become a widely used method, which has high requirements for laboratories and equipment and is not suitable for implementation in remote medical units with poor experimental conditions and a lack of instruments. Summary of the Invention

[0005] In view of the above deficiencies, the present invention discloses a Direct-RAA-RDB gene detection method, which can directly use the processed sample in the amplification reaction. This step not only saves the time required for DNA extraction, saves the reagent cost and instrument cost required for DNA extraction, but also reduces the possibility of sample cross-contamination caused during the extraction process. At the same time, the method is applied to the detection of thalassemia-related genes, and a thalassemia detection kit is provided, which has the advantages of simple operation, rapid typing, low cost, and intuitive result interpretation.

[0006] The present invention is implemented by the following technical solutions: A Direct-RAA-RDB gene detection method, which includes the following steps: (1) Take the test sample and add sodium hydroxide solution for treatment to obtain a template solution for amplification. The concentration of the sodium hydroxide solution is 0.1-0.5 mol / L, and the volume ratio of the test sample to the sodium hydroxide solution is 1:(1-5); (2) Take the template solution obtained in step (1) to prepare an amplification system and perform an isothermal amplification reaction. The amplification system includes recombinase, single-stranded binding protein, DNA polymerase, buffer, magnesium ions, primers, template solution, and sterile distilled water. Among them, the template solution accounts for one-tenth of the total volume of the amplification system, and the final concentration of each primer is 0.1-0.4 μmol / L; the temperature of the isothermal amplification reaction is 25-65 °C, and the time is 15-90 min; (3) Dilute the specific probe with a sodium bicarbonate solution at a concentration of 0.5 mol / L to obtain a working solution, and then drop the working solution on the chip substrate in a dot matrix array manner to prepare a chip for detection. The chip substrate includes any one of a glass slide, a silica wafer, a nylon membrane, a nitrocellulose membrane, a polypropylene membrane, and a microscale magnetic bead; (4) Dissolve 20 g of SDS (sodium dodecyl sulfate) in 180 ml of pure water, adjust the pH value to pH 7.0 with 1N HCl, and finally make up the volume to 200 ml to obtain a 10% SDS solution, and store it at room temperature; Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 750 ml of pure water, adjust the pH value to pH 7.0 with concentrated hydrochloric acid, and finally make up the volume to 1000 ml to obtain a 20× SSC solution. Then, after autoclaving, store it at room temperature; Mix the 10% SDS solution and the 20× SSC solution to prepare Hybridization Solution I and Hybridization Solution II respectively. Hybridization Solution I contains 1 - 6× SSC and 0.1 - 1% SDS, and Hybridization Solution II contains 0.1 - 1× SSC and 0.1 - 1% SDS; Dissolve 294 g of sodium citrate in 700 ml, adjust the pH value to pH 5.0 with concentrated HCl, and finally make up the volume to 1000 ml to obtain a 1M sodium citrate solution. Take the 1M sodium citrate solution and make up the volume to 1000 ml with pure water to obtain Hybridization Solution III, and store it at room temperature; Take 19 mL of Hybridization Solution III, add 1 mL of TMB (3,3',5,5'-tetramethylbenzidine) and 2 μL of a 30% H 2 O 2 to obtain a color development solution; (5) Place the chip obtained in step (3) into a centrifuge tube, add Hybridization Solution I and the amplification product obtained through the isothermal amplification reaction in step (2). Then, tighten the tube cap and place the centrifuge tube in a boiling water bath and heat for 10 minutes. Take it out, tighten the cap, and place it in a hybridization oven for hybridization at 35 - 65°C. The hybridization time is more than 1.5 hours but not more than 4 hours. At the same time, take a plastic tube, add Hybridization Solution II, and place it in a hybridization oven or a constant temperature water bath for preheating to 48 - 52°C; After the hybridization treatment is completed, take out the chip and place it in the plastic tube, and gently shake and wash it at 48 - 52°C for 15 minutes; (6) Prepare the incubation solution according to the ratio of hybridization solution I:POD (peroxidase) of 2000:1. Take the chip treated in step (5) and soak it in the incubation solution, gently shake it at room temperature for 30 minutes, take out the chip and then place it in the hybridization solution I, gently shake and wash it twice at room temperature, 5 minutes each time. Then wash the chip with the hybridization solution III at room temperature for 1-2 minutes. Then soak the chip in the color development solution and develop the color in the dark for 6-12 minutes. Discard the color development solution, wash the chip twice with distilled water, 2-3 minutes each time. Then blot the water on the surface of the chip with absorbent paper, and then directly judge the result with the naked eye or scan and record the result on a scanner.

[0007] Further, the test sample includes freshly collected anticoagulated peripheral blood, old anticoagulated peripheral blood stored at -20°C to -80°C without repeated freezing and thawing, cultured amniotic fluid cells, villi, amniotic fluid, cord blood, peripheral blood, DBS samples and / or samples treated similar to DBS, saliva, genetic material of embryos (including gametes such as sperm or eggs), blastomeres of cleavage-stage embryos, trophectoderm cells of blastocysts (i.e., blastocyst cells, multiple cells or single cells), exfoliated cells, throat swabs, etc.

[0008] Further, the temperature of the isothermal amplification reaction is 38-48°C and the time is 15-30 min.

[0009] Further, the chip substrate is a nylon membrane. Soak the nylon membrane in 1% hydrochloric acid for pre-activation for 5-10 minutes, then place it in a 10% EDAC solution for activation for 30 minutes, then wash it with pure water and air-dry it at room temperature. Then drop the working solution on the nylon membrane in a dot matrix array, 0.5 μL per drop. Then place the nylon membrane at room temperature for reaction for 20-60 minutes, then immerse it in a 0.1 mol / L sodium hydroxide solution for treatment to stop the reaction. Then wash the nylon membrane 3 times with pure water, 1 minute each time. Finally, air-dry it to obtain the chip for detection.

[0010] The application of the Direct-RAA-RDB gene detection method is to apply the method to detect thalassemia genes. Among them, the primers used are divided into primer combination A and primer combination B, and the corresponding probe combinations A and probe combinations B are configured for the primer combination A and primer combination B; The primer combination A includes the following primers: Primer A2F: GTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCA (as shown in sequence 1 in the sequence listing); Primer A2R: TTATTCAAAGACCAGGAAGGGCCGGTGCAAG (as shown in sequence 2 in the sequence listing); The probe combination A includes the following probes: Probe WSN: GGGAGGCGTGCACCGCA (shown as Sequence 3 in the Sequence Listing); Probe QSN: GAACTTGTCCAGGGAGGC (shown as Sequence 4 in the Sequence Listing); Probe CSN: GGCTCCAGCTTAACGGTATTT (shown as Sequence 5 in the Sequence Listing); Probe WSM: GGAGGCCTGCACCGCAG (shown as Sequence 6 in the Sequence Listing); Probe QSM: GCCTCCCCGGACAAGTTC (shown as Sequence 7 in the Sequence Listing); Probe CSM: CCAAATACCGTCAAGCTGGA (shown as Sequence 8 in the Sequence Listing); Probe AC: CTCGGTAGCCGTTCCTCCTG (shown as Sequence 9 in the Sequence Listing); Probe NC: ACACCAACCGCATCGTCAT (shown as Sequence 10 in the Sequence Listing); Probe CC: CACATCACACACTCTGCGAC (shown as Sequence 11 in the Sequence Listing); The primer combination B includes the following primers: Primer βIF: ACGGCTGTCATCACTTAGACCTCACCCTGT (shown as Sequence 12 in the Sequence Listing); Primer βIR: TCTCCACATGCCCAGTTTCTATTGGTCTCCTT (shown as Sequence 13 in the Sequence Listing); Primer βIIF: TGATAGGCACTGACTCTCTCTGCCTATTGGTCT (shown as Sequence 14 in the Sequence Listing); Primer βIIR: TCTGTTTCCCATTCTAAACTGTACCCTGTTAC (shown as Sequence 15 in the Sequence Listing); Primer βIIIF: CCCTAATCTCTTTCTTTCAGGGCAATAATG (shown as Sequence 16 in the Sequence Listing); Primer βIIIR: TTGGACAGCAAGAAAGCGAGCTTAGTGATACTTG (shown as Sequence 17 in the Sequence Listing); The probe combination B includes the following probes: Probe 28N: ACTTTTATGCCCAGCCCT (shown as Sequence 18 in the Sequence Listing); Probe 32M: GGGCTGGGAATAAAAGTCAG (shown as Sequence 19 in the Sequence Listing); Probe 30M: TGACTTTTGTGCCCAGCC (shown as SEQ ID NO: 20 in the Sequence Listing); Probe 29M: TGACTTTCATGCCCAGCC (shown as SEQ ID NO: 21 in the Sequence Listing); Probe 28M: CCCTGACTTCTATGCCCA (shown as SEQ ID NO: 22 in the Sequence Listing); Probe Cap+40-43N: CCATGGTGTCTGTTTGAGG (shown as SEQ ID NO: 23 in the Sequence Listing); Probe Cap+40-43M: AGCAACCTCAGACACCATG (shown as SEQ ID NO: 24 in the Sequence Listing); Probe Int M: CAGACACCAGGGTGCATC (shown as SEQ ID NO: 25 in the Sequence Listing); Probe CD17N: GTTCACCTTGCCCCACAG (shown as SEQ ID NO: 26 in the Sequence Listing); Probe CD14-15M: TCACCTTGCCCCACCAG (shown as SEQ ID NO: 27 in the Sequence Listing); Probe CD17M: TGTGGGGCTAGGTGAACG (shown as SEQ ID NO: 28 in the Sequence Listing); Probe CD26N: CCCAGGGCCTCACCAC (shown as SEQ ID NO: 29 in the Sequence Listing); Probe CD26M: GTTGGTGGTAAGGCCCTG (shown as SEQ ID NO: 30 in the Sequence Listing); Probe CD27-28M: GTGGTGAGGCCCCTGG (shown as SEQ ID NO: 31 in the Sequence Listing); Probe IVS-I-1N: TGATACCAACCTGCCCAG (shown as SEQ ID NO: 32 in the Sequence Listing); Probe IVS-I-1M: CCCTGGGCAGATTGGTATC (shown as SEQ ID NO: 33 in the Sequence Listing); Probe IVS-I-5M: GGCAGGTTGCTATCAAGGTTA (shown as SEQ ID NO: 34 in the Sequence Listing); Probe CD31N: CCTTAGGCTGCTGGTGGT (shown as SEQ ID NO: 35 in the Sequence Listing); Probe CD31M: CCCTTAGGTGCTGGTGG (shown as SEQ ID NO: 36 in the Sequence Listing); Probe CD41-42N: ACCCAGAGGTTCTTTGAGTC (shown as SEQ ID NO: 37 in the Sequence Listing); Probe CD41-42M: ACCCAGAGGTTGAGTCCTTT (as shown in SEQ ID NO: 38 in the Sequence Listing); Probe CD43M: AGAGGTTCTTTTAGTCCTTTGG (as shown in SEQ ID NO: 39 in the Sequence Listing); Probe CD71-72N: GCTCGGTGCCTTTAGTGA (as shown in SEQ ID NO: 40 in the Sequence Listing); Probe CD71-72M: TGCCTTTAAGTGATGGCCT (as shown in SEQ ID NO: 41 in the Sequence Listing); Probe IVS-II-654N: TTGCTATTGCCTTAACCCAG (as shown in SEQ ID NO: 42 in the Sequence Listing); Probe IVS-II-654M: TATTGCTATTACCTTAACCCAG (as shown in SEQ ID NO: 43 in the Sequence Listing); Probe IVS-II-5N: TCAGGGTGAGTCTATGGGA (as shown in SEQ ID NO: 44 in the Sequence Listing); Probe IVS-II-5M: TCCCATAGAGTCACCCTGA (as shown in SEQ ID NO: 45 in the Sequence Listing); Probe CD37N: CCTCTGGGTCCAAGGGTAGA (as shown in SEQ ID NO: 46 in the Sequence Listing); Probe CD37M: TCTACCCTTAGACCCAGAGG (as shown in SEQ ID NO: 47 in the Sequence Listing); Probe AC2: TGGCTCACCTGGACAACC (as shown in SEQ ID NO: 48 in the Sequence Listing); Probe AC3: CCTATCAGAAAGTGGTGGC (as shown in SEQ ID NO: 49 in the Sequence Listing); Probe NC: ACACCAACCGCATCGTCAT (as shown in SEQ ID NO: 10 in the Sequence Listing); Probe CC: CACATCACACACTCTGCGAC (as shown in SEQ ID NO: 11 in the Sequence Listing).

[0011] A gene chip for detecting non-deletional α-thalassemia genes, on which the probe combination A is immobilized.

[0012] A gene chip for detecting β-thalassemia, on which the probe combination B is immobilized.

[0013] A kit for detecting thalassemia genes, which includes a gene chip for detecting non-deletion α-thalassemia genes and / or a gene chip for detecting β-thalassemia, primer combination A and / or primer combination B, hybridization solution I, hybridization solution II, hybridization solution III, peroxidase and TMB.

[0014] The technical solution of the present invention has the following beneficial effects compared with the prior art: (1) The present invention aims to establish a rapid detection scheme that does not require nucleic acid extraction and uses a direct isothermal-RDB gene detection method, especially RAA and / or RT-RAA combined with RDB to directly detect gene mutations (genotyping) and / or pathogen nucleic acids. After the sample to be tested is pretreated with sodium hydroxide solution, it is directly used for RAA amplification. The entire detection process does not require expensive nucleic acid extractors and PCR amplifiers and other instruments. Instead, a constant temperature water bath shaker is used. The method of the present invention can be used for the detection of pathogenic microorganisms and gene mutations, and is suitable not only for large medical laboratories, but also for remote medical units and bedside detections, and is suitable for improving the timeliness and scenario applicability of gene detection.

[0015] (2) The present invention uses the detection method to develop primers, probes and gene chips for the detection of non-deletion α and β thalassemia genes, and configures suitable reagents to obtain a kit for detecting thalassemia genes, which has the advantages of simple operation, rapid genotyping, low cost, and intuitive result interpretation. Using this kit, three non-deletion α-thalassemias (αCSα, αQSα, αWSα) can be detected simultaneously, and 19 common β-thalassemia gene mutations (CD41-42, CD43, IVS-II-654, -28, -29, -30, -32, CD71-72, CD26(βE), CD27 / 28, CD17, CD14-15, CD31, IVS-I-1, IVS-I-5, Cap+40-43, Initiation codon, IVS-II-5, CD37) can be detected simultaneously. Moreover, it can be directly and rapidly detected in separate single tubes with closed tubes, without a precision nucleic acid amplifier, reducing contamination and saving instrument costs; the RAA template pretreatment time is 3-5 minutes, and the RAA amplification time is 0.5 hours, saving 2 hours compared with other PCR-RDB methods; it has high sensitivity, and the lowest concentration of genomic DNA that can be stably detected is 0.01 ng / μL. Therefore, the kit of the present invention has the advantages of short detection time, low cost, convenient operation, closed-tube operation, and reduced contamination, and has great significance for carrying out thalassemia population screening, genetic counseling and prenatal diagnosis, and is suitable for the development of remote laboratories, bedside diagnosis and on-site detection. Description of the Drawings

[0016] Figure 1It is the layout diagram of the probes for α-thalassemia gene detection on the gene chip in Example 2.

[0017] Figure 2 It is the layout diagram of the probes for β-thalassemia gene detection on the gene chip in Example 2.

[0018] Figure 3 It is the schematic diagram of the amplified product for α-thalassemia gene detection in Example 1 detected by 2% agarose gel electrophoresis.

[0019] Figure 4 It is the schematic diagram of the amplified product for β-thalassemia gene detection in Example 1 detected by 2% agarose gel electrophoresis.

[0020] Figure 5 It is the scanning record result diagram for α-thalassemia gene detection in Example 4.

[0021] Figure 6 It is the scanning record result diagram for β-thalassemia gene detection in Example 4. Detailed implementation manners

[0022] The present invention is further illustrated by the following examples, which shall not be construed as limiting the present invention. For the specific experimental conditions and methods not specified in the following examples, the technical means adopted are usually the conventional means well known to those skilled in the art.

[0023] Example 1: Application of the Direct-RAA-RDB gene detection method of the present invention in detecting thalassemia genes, in which the design of specific primers for isothermal amplification reaction and the determination of the reaction system are carried out, and at the same time, an oligonucleotide probe combination capable of recognizing the corresponding genotypes is designed; and negative (NC), positive (AC), chromogenic control probes (CC) and blank control (BC) are designed.

[0024] First, the α / β-globin gene sequences are investigated and analyzed, and primers and probes are designed according to the α / β-thalassemia gene point mutation positions, that is, primer A2F for α-thalassemia gene: GTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCA (shown as sequence 1 in the sequence listing); primer A2R: TTATTCAAAGACCAGGAAGGGCCGGTGCAAG (shown as sequence 2 in the sequence listing); probe WSN: GGGAGGCGTGCACCGCA (shown as sequence 3 in the sequence listing); probe QSN: GAACTTGTCCAGGGAGGC (shown as sequence 4 in the sequence listing); Probe CSN: GGCTCCAGCTTAACGGTATTT (as shown in Sequence 5 in the Sequence Listing); Probe WSM: GGAGGCCTGCACCGCAG (as shown in Sequence 6 in the Sequence Listing); Probe QSM: GCCTCCCCGGACAAGTTC (as shown in Sequence 7 in the Sequence Listing); Probe CSM: CCAAATACCGTCAAGCTGGA (as shown in Sequence 8 in the Sequence Listing); Probe AC: CTCGGTAGCCGTTCCTCCTG (as shown in Sequence 9 in the Sequence Listing); Probe NC: ACACCAACCGCATCGTCAT (as shown in Sequence 10 in the Sequence Listing); Probe CC: CACATCACACACTCTGCGAC (as shown in Sequence 11 in the Sequence Listing); and primers βIF for β-thalassemia gene: ACGGCTGTCATCACTTAGACCTCACCCTGT (as shown in Sequence 12 in the Sequence Listing); Primer βIR: TCTCCACATGCCCAGTTTCTATTGGTCTCCTT (as shown in Sequence 13 in the Sequence Listing); Primer βIIF: TGATAGGCACTGACTCTCTCTGCCTATTGGTCT (as shown in Sequence 14 in the Sequence Listing); Primer βIIR: TCTGTTTCCCATTCTAAACTGTACCCTGTTAC (as shown in Sequence 15 in the Sequence Listing); Primer βIIIF: CCCTAATCTCTTTCTTTCAGGGCAATAATG (as shown in Sequence 16 in the Sequence Listing); Primer βIIIR: TTGGACAGCAAGAAAGCGAGCTTAGTGATACTTG (as shown in Sequence 17 in the Sequence Listing); Probe 28N: ACTTTTATGCCCAGCCCT (as shown in Sequence 18 in the Sequence Listing); Probe 32M: GGGCTGGGAATAAAAGTCAG (as shown in Sequence 19 in the Sequence Listing); Probe 30M: TGACTTTTGTGCCCAGCC (as shown in Sequence 20 in the Sequence Listing); Probe 29M: TGACTTTCATGCCCAGCC (as shown in Sequence 21 in the Sequence Listing); Probe 28M: CCCTGACTTCTATGCCCA (as shown in Sequence 22 in the Sequence Listing); Probe Cap+40-43N: CCATGGTGTCTGTTTGAGG (as shown in Sequence 23 in the Sequence Listing); Probe Cap+40-43M: AGCAACCTCAGACACCATG (as shown in Sequence 24 in the Sequence Listing); Probe Int M: CAGACACCAGGGTGCATC (as shown in Sequence 25 in the Sequence Listing); Probe CD17N: GTTCACCTTGCCCCACAG (as shown in Sequence 26 in the Sequence Listing); Probe CD14-15M: TCACCTTGCCCCACCAG (as shown in Sequence 27 in the Sequence Listing); Probe CD17M: TGTGGGGCTAGGTGAACG (as shown in Sequence 28 in the Sequence Listing); Probe CD26N: CCCAGGGCCTCACCAC (as shown in Sequence 29 in the Sequence Listing); Probe CD26M: GTTGGTGGTAAGGCCCTG (as shown in Sequence 30 in the Sequence Listing); Probe CD27-28M: GTGGTGAGGCCCCTGG (as shown in Sequence 31 in the Sequence Listing); Probe IVS-I-1N: TGATACCAACCTGCCCAG (as shown in Sequence 32 in the Sequence Listing); Probe IVS-I-1M: CCCTGGGCAGATTGGTATC (as shown in Sequence 33 in the Sequence Listing); Probe IVS-I-5M: GGCAGGTTGCTATCAAGGTTA (as shown in Sequence 34 in the Sequence Listing); Probe CD31N: CCTTAGGCTGCTGGTGGT (as shown in Sequence 35 in the Sequence Listing); Probe CD31M: CCCTTAGGTGCTGGTGG (as shown in Sequence 36 in the Sequence Listing); Probe CD41-42N: ACCCAGAGGTTCTTTGAGTC (as shown in Sequence 37 in the Sequence Listing); Probe CD41-42M: ACCCAGAGGTTGAGTCCTTT (as shown in Sequence 38 in the Sequence Listing); Probe CD43M: AGAGGTTCTTTTAGTCCTTTGG (as shown in Sequence 39 in the Sequence Listing); Probe CD71-72N: GCTCGGTGCCTTTAGTGA (as shown in Sequence 40 of the Sequence Listing); Probe CD71-72M: TGCCTTTAAGTGATGGCCT (as shown in Sequence 41 of the Sequence Listing); Probe IVS-II-654N: TTGCTATTGCCTTAACCCAG (as shown in Sequence 42 of the Sequence Listing); Probe IVS-II-654M: TATTGCTATTACCTTAACCCAG (as shown in Sequence 43 of the Sequence Listing); Probe IVS-II-5N: TCAGGGTGAGTCTATGGGA (as shown in Sequence 44 of the Sequence Listing); Probe IVS-II-5M: TCCCATAGAGTCACCCTGA (as shown in Sequence 45 of the Sequence Listing); Probe CD37N: CCTCTGGGTCCAAGGGTAGA (as shown in Sequence 46 of the Sequence Listing); Probe CD37M: TCTACCCTTAGACCCAGAGG (as shown in Sequence 47 of the Sequence Listing); Probe AC2: TGGCTCACCTGGACAACC (as shown in Sequence 48 of the Sequence Listing); Probe AC3: CCTATCAGAAAGTGGTGGC (as shown in Sequence 49 of the Sequence Listing); Probe NC: ACACCAACCGCATCGTCAT (as shown in Sequence 10 of the Sequence Listing); Probe CC: CACATCACACACTCTGCGAC (as shown in Sequence 11 of the Sequence Listing).

[0025] Then, the orthogonal test method was used to determine the amplification system and reaction conditions for the isothermal amplification reaction. The kit used was the kit produced by Hangzhou Zhongce Biotechnology Co., Ltd. The obtained reaction system and reaction conditions are shown in Table 1. According to the said reaction system and reaction conditions, good specificity and high amplification efficiency can be achieved. See Figures 3 - 4 , (α) The RAA amplification products were detected by 2% agarose gel electrophoresis. From the electrophoresis results, it can be observed that the target band was successfully amplified: the length of the amplified band fragment was 201 bp. (β) The RAA amplification products were detected by 2% agarose gel electrophoresis. From the electrophoresis results, it can be observed that the target band was successfully amplified: the lengths of the amplified band fragments were 329 bp, 380 bp, and 441 bp, respectively.

[0026] Table 1 Formulation System and Reaction Conditions of the Direct RAA Reaction Solution for Detecting Non-deletional α / β-Thalassemia

[0027] Example 2: The probe described in Example 1 was used and a nylon membrane was taken to prepare a gene chip. First, the probe was diluted with a sodium bicarbonate solution with a concentration of 0.5 mol / L to obtain a working solution. Then, the nylon membrane was immersed in hydrochloric acid with a concentration of 1% for pre-activation for 10 minutes, and then placed in an EDAC solution with a concentration of 10% for activation for 30 minutes. Then, it was washed with pure water 3 times, 2 minutes each time, and then air-dried at room temperature. Then, the working solution was dropped onto the activated nylon membrane in a dot matrix array manner through a micropipette device, with each drop being 0.5 μL. At this time, the amino group reacted with the activated carboxyl group to form a stable covalent bond, thereby fixing the probe on the surface of the nylon membrane. Finally, the nylon membrane was treated with a blocking solution to block the surface carboxyl groups that did not bind the probe, completing the preparation of the membrane chip and storing it at low temperature, that is, the nylon membrane was placed at room temperature for reaction for 30 minutes, then immersed in a sodium hydroxide solution with a concentration of 0.1 mol / L for treatment for 10 minutes, then the nylon membrane was washed 3 times with pure water, with each washing time being 1 minute, and finally air-dried at room temperature to obtain the chip for detection and stored at 4°C.

[0028] Among them, the probe layout diagram on the gene chip (see Figures 1 - 2 ), each position represents different gene mutations and controls. N represents the normal type, and M represents the mutant type. The relationships between the detected site mutations and the normal controls are shown in Tables 2 and 3.

[0029] Table 2 Relationships between the detected (α) site mutations and the normal controls

[0030] Table 3 Relationships between the detected (β) site mutations and the normal controls

[0031] Example 3: The gene chip described in Example 2 was used for hybridization, color development reaction and result judgment. The specific process is as follows: S1. Take freshly collected anticoagulated peripheral blood as the sample to be tested, then add a sodium hydroxide solution for treatment to obtain a template solution for amplification, and then obtain an amplification product according to the method described in Example 1; the concentration of the sodium hydroxide solution is 0.2 mol / L, and the volume ratio of the sample to be tested to the sodium hydroxide solution is 1:3; S2. Take 20 g of SDS (sodium dodecyl sulfate), dissolve it in 180 ml of pure water, adjust the pH value to pH 7.0 with 1N HCl, and finally make up the volume to 200 ml to obtain a 10% SDS solution, and store it at room temperature; take 175.3 g of NaCl, 88.2 g of sodium citrate and dissolve them in 750 ml of pure water, adjust the pH value to pH 7.0 with concentrated hydrochloric acid, and finally make up the volume to 1000 ml to obtain a 20× SSC solution. Then, after autoclaving, store it at room temperature; mix the 10% SDS solution and the 20× SSC solution to prepare hybridization solution I and hybridization solution II respectively. The hybridization solution I contains 2× SSC and 0.1% SDS, and the hybridization solution II contains 0.5× SSC and 0.1% SDS; take 294 g of sodium citrate, dissolve it in 700 ml, adjust the pH value to pH 5.0 with concentrated HCl, and finally make up the volume to 1000 ml to obtain a 1M sodium citrate solution. Take the 1M sodium citrate solution and make up the volume to 1000 ml with pure water to obtain hybridization solution III, and store it at room temperature; take 19 mL of hybridization solution III, add 1 mL of TMB (3,3',5,5'-tetramethylbenzidine) and 2 μL of 30% H 2 O 2 to obtain the chromogenic solution; S3. Place the gene chip obtained in Example 2 into a 15 mL plastic centrifuge tube, add 5 mL of hybridization solution I and the amplification product obtained in step S1. Then, tighten the tube cap and place the centrifuge tube in a boiling water bath for heating for 10 minutes. Take it out, tighten the cap, and place it in a hybridization oven for hybridization treatment at 48°C for 2 hours. At the same time, take a 50 mL plastic tube, add 40 mL of hybridization solution II, and place it in the hybridization oven or a constant temperature water bath for preheating to 48°C; take out the gene chip after hybridization treatment and place it in the plastic tube, and gently shake and wash it at 48°C for 15 minutes; (6) Prepare the incubation solution according to the ratio of hybridization solution I:POD (peroxidase) of 2000:1. Immerse the chip treated in step S3 in the incubation solution and gently shake it at room temperature for 30 minutes. Take out the chip and place it in the hybridization solution I and gently shake and wash it twice at room temperature, 5 minutes each time. Then, wash the chip with the hybridization solution III at room temperature for 1 - 2 minutes. Then, immerse the chip in the chromogenic solution and develop color in the dark for 6 - 12 minutes, and then the results can be observed. Then, discard the chromogenic solution, wash the chip twice with distilled water, 2 - 3 minutes each time, and then blot the water on the surface of the chip with absorbent paper. Then, directly judge the results with the naked eye or scan and record the results on a scanner.

[0032] The basic method for result reading is as follows: If the corresponding probe position on the chip shows blue, it indicates that there is a corresponding signal on the chip; if only the normal sites and the corresponding quality control control points on the chip have signals, it indicates that the sample to be tested is wild type; if there is a signal at the mutant site on the chip, it indicates that the sample to be tested contains this type of mutation; if the normal control corresponding to this mutant site also has a signal, it indicates that the sample to be tested is a heterozygote of this type of mutation; if the normal control corresponding to this mutant site has no signal, it indicates that the sample to be tested is a homozygote of this type of mutation or has a combined deletion type of thalassemia.

[0033] Quality control: Hybridize with a negative control sample (using water instead of the sample). If there are hybridization spots on the chip except that the CC position shows blue, it indicates that the experiment is contaminated and the experimental results are invalid; at the same time, if there is not a single spot on the chip during sample detection, the experiment of this sample is invalid. Generally, the BC and NC positions show colorless, the AC position shows blue, and the CC position shows blue. If the NC position shows blue, it indicates that the experiment is contaminated and the experimental results are invalid. If the BC and NC positions show colorless, the AC position does not show blue, and the CC position shows blue, it is necessary to consider the possibility of deletion type of thalassemia and / or invalid sample experiment. If the CC position does not show blue, it indicates that there is a problem with the color development system, and the reagent problem should be inquired.

[0034] Blood sample preservation: Anticoagulated whole blood should not be placed at room temperature for more than 24 hours, stored at 2 - 8°C for no more than 7 - 15 days, stored below -20°C for no more than 2 years, and can be stored long-term at -70°C. Repeated freezing and thawing should be avoided during frozen storage; Sample transportation: When transporting anticoagulated whole blood specimens, an ice pot or a foam box with ice packs should be used for sealing. It should be ensured that the ice packs do not thaw, and the transit time limit should not exceed 72 hours. Use it as soon as possible after 3 - 5 minutes of pretreatment.

[0035] Example 4: The method of the present invention is used to detect a sample with a known genotype. Among them, a double-blind experiment is adopted. According to the method described in Example 3, the results can be directly judged by the naked eye or scanned and recorded on a scanner. The results are shown in Figures 5 - 6 。

[0036] Meanwhile, with the approval of the Ethics Committee of the People's Hospital of Guangxi Zhuang Autonomous Region and the informed consent of the patients, 10 negative samples and 24 thalassemia samples were collected. The samples were repeated 3 times and detected with 3 batches of products respectively, and the negative and positive coincidence rates were calculated respectively. The results showed the corresponding genotypes, and the research results were completely consistent with those of the thalassemia gene diagnostic kit (PCR method) of Yanneng Biotechnology (Shenzhen) Co., Ltd. The positive and negative coincidence rates of the product both reached 100%. Moreover, the sensitivity analysis of the thalassemia detection sites was carried out with the kit of the present invention. Each sample contained 8 concentration gradients, and the lowest concentration of genomic DNA at which each genotype could be stably detected was determined to be 0.01 ng / μL. Through the interference screening test, EDTA and sodium citrate at the clinical normal dose were not interfering substances of this product; hemolyzed samples did not interfere with the detection results of this kit; triglycerides (14.1 mmol / L) in lipemic samples and jaundiced samples (360.4 mmol / L) did not interfere with the detection of this product. In addition, 8 clinical samples outside the detection range of this product were detected with this product, including 1 α-thalassemia negative sample, 2 β-thalassemia clinical samples, 2 iron deficiency anemia clinical samples, 2 G-6-PD clinical samples, and 1 whole blood sample infected with chlamydia, and there was no cross-reaction. Moreover, different batches of products of the kit of the present invention were used, operated by different people (2 people), done 2 times on the same day, and done for 2 days in total. Each reference product was detected 3 times repeatedly in each test, and the α / β-thalassemia genotypes could be stably detected repeatedly under different experimental conditions, and the results were consistent. Thus, it can be seen that the method of the present invention can detect non-deletion type α / β-thalassemia gene mutations under constant temperature conditions, reduce the temperature variation in amplification, save time and instrument costs, reduce laboratory contamination, and reduce the missed detection and / or false detection rate.

[0037] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A method for direct-RAA-RDB gene detection, characterized in that: The following steps are involved: (1) taking a sample to be tested and adding a sodium hydroxide solution to obtain a template solution for amplification, wherein the concentration of the sodium hydroxide solution is 0.1 to 0.5 mol / L, and the volume ratio of the sample to be tested to the sodium hydroxide solution is 1:(1 to 5); (2) preparing an amplification system with the template solution obtained in step (1) and performing an isothermal amplification reaction, wherein the amplification system includes a recombinase, a single-stranded binding protein, a DNA polymerase, a buffer, magnesium ions, primers, a template solution and sterile distilled water, wherein the template solution accounts for one tenth of the total volume of the amplification system, and the final concentration of each primer is 0.1 to 0.4 μmol / L; the temperature of the isothermal amplification reaction is 25 to 65° C., and the time is 15 to 90 min; (3) taking a specific probe and diluting it with a sodium bicarbonate solution with a concentration of 0.5 mol / L to obtain a working solution, and then dropping the working solution on a chip substrate in a dot matrix array to prepare a chip for detection, wherein the chip substrate includes any one of a glass sheet, a silica gel wafer, a nylon membrane, a nitrocellulose membrane, a polypropylene membrane, and micro-magnetic beads; (4) Dissolve 20 g of SDS in 180 ml of pure water, adjust the pH to pH 7.0 with 1 N HCl, and finally dilute to 200 ml to obtain a 10% SDS solution, which is then stored at room temperature. Dissolve 175.3 g of NaCl and 88.2 g of sodium citrate in 750 ml of pure water, and adjust the pH to pH 7 with concentrated hydrochloric acid. .0, and finally dilute to 1000ml to obtain 20× SSC solution, then sterilize with high pressure and store at room temperature; take the 10% SDS solution and the 20× SSC solution and mix them to prepare hybridization I solution and hybridization II solution respectively, wherein the hybridization I solution contains 1-6× SSC and 0.1-1% SDS, and the hybridization II solution contains 0.1-1× SSC and 0.1-1% SDS; take 294g of sodium citrate and dissolve it with 700ml, then adjust the pH value to pH5.0 with concentrated HCl, and finally dilute to 1000ml to obtain 1M sodium citrate solution, take the 1M sodium citrate solution and add pure water to dilute to 1000ml to obtain hybridization III solution, and store at room temperature; take 19mL of hybridization III solution, add 1mL of TMB and 2μL of 30% H2O2 to obtain a color developing solution; (5) Place the chip obtained in step (3) in a centrifuge tube, add hybridization solution I and the amplification product obtained by the isothermal amplification reaction in step (2), then tighten the tube cap and place the centrifuge tube in a boiling water bath for 10 minutes, take it out, tighten the cap, and place it in a hybridization box for hybridization treatment at 35-65°C. The hybridization treatment time is more than 1.5 hours but not more than 4 hours. At the same time, take a plastic tube, add hybridization solution II, and place it in a hybridization box or a constant temperature water bath to preheat to 48-52°C. After the hybridization treatment is completed, take out the chip and place it in the plastic tube, and gently shake and wash it at 48-52°C for 15 minutes; (6) Prepare an incubation solution at a ratio of 2000:1 of hybridization I solution:POD. Soak the chip treated in step (5) in the incubation solution and shake gently at room temperature for 30 minutes. Take out the chip and place it in hybridization I solution and shake gently at room temperature for two times, each time for 5 minutes. Then wash the chip with hybridization III solution at room temperature for 1 to 2 minutes. Then soak the chip in color development solution in the dark for 6 to 12 minutes. Discard the color development solution and wash the chip twice with distilled water for 2 to 3 minutes. Then use absorbent paper to absorb the water on the surface of the chip. Then read the result directly with the naked eye or scan and record the result on a scanner.

2. The method for Direct-RAA-RDB gene detection according to claim 1, characterized in that: The samples to be tested include freshly collected anticoagulated peripheral blood, old anticoagulated peripheral blood stored at -20°C to -80°C without repeated freezing and thawing, cultured amniotic fluid cells, chorionic villi, amniotic fluid, umbilical cord blood, peripheral blood, DBS samples and / or samples similar to DBS treatment, saliva, embryonic genetic material, blastomeres of cleavage-stage embryos, blastocyst trophectoderm cells, exfoliated cells, and throat swabs.

3. The method for Direct-RAA-RDB gene detection according to claim 1, characterized in that: The temperature of the isothermal amplification reaction is 38-48° C. and the time is 15-30 minutes.

4. The method for Direct-RAA-RDB gene detection according to claim 1, characterized in that: The chip substrate is a nylon membrane. The nylon membrane is immersed in 1% hydrochloric acid for pre-activation for 5 to 10 minutes, then placed in a 10% EDAC solution for activation for 30 minutes, then washed with pure water and dried at room temperature, then the working solution is dropped on the nylon membrane in a dot matrix array, each drop is 0.5 μL, then the nylon membrane is placed at room temperature for reaction for 20 to 60 minutes, then immersed in a 0.1 mol / L sodium hydroxide solution to stop the reaction, then washed with pure water 3 times, each washing time is 1 minute, and finally dried to obtain a chip for detection.

5. The use of the Direct-RAA-RDB gene detection method according to any one of claims 1 to 4, characterized in that: The method is applied to the detection of thalassemia gene, wherein the primers used are divided into primer combination A and primer combination B, and the primer combination A and primer combination B are correspondingly configured with probe combination A and probe combination B; The primer combination A includes the following primers: Primer A2F: GTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCA; Primer A2R: TTATTCAAAGACCAGGAAGGGCCGGTGCAAG; The probe combination A includes the following probes: Probe WSN: GGGAGGCGTGCACCGCA); Probe QSN: GAACTTGTCCAGGGAGGC; Probe CSN: GGCTCCAGCTTAACGGTATTT; Probe WSM: GGAGGCCTGCACCGCAG; Probe QSM: GCCTCCCCGGACAAGTTC; Probe CSM: CCAAATACCGTCAAGCTGGA; Probe AC: CTCGGTAGCCGTTCCTCCTG; Probe NC: ACACCAACCGCATCGTCAT; Probe CC: CACATCACACACTCTGCGAC ; The primer combination B includes the following primers: Primer βIF: ACGGCTGTCATCACTTAGACCTCACCCTGT; Primer β IR:TCTCCACATGCCCAGTTTCTATTGGTCTCCTT; Primer βIIF: TGATAGGCACTGACTCTCTCTGCCTATTGGTCT; Primer βIIR: TCTGTTTCCCATTCTAAACTGTACCCTGTTAC; Primer βIIIF: CCCTAATCTCTTTCTTTCAGGGCAATAATG; Primer βIIIR: TTGGACAGCAAGAAAGCGAGCTTAGTGATACTTG; The probe combination B includes the following probes: Probe 28N: ACTTTTATGCCCAGCCCT; Probe 32M: GGGCTGGGAATAAAAGTCAG; Probe 30M: TGACTTTTGTGCCCAGCC; Probe 29M: TGACTTTCATGCCCAGCC; Probe 28M: CCCTGACTTCTATGCCCA; Probe Cap+40-43N: CCATGGTGTCTGTTTGAGG; Probe Cap+40-43M: AGCAACCTCAGACACCATG; Probe Int M: CAGACACCAGGGTGCATC; Probe CD17N: GTTCACCTTGCCCCACAG; Probe CD14-15M: TCACCTTGCCCCACCAG; Probe CD17M: TGTGGGGCTAGGTGAACG; Probe CD26N: CCCAGGGCCTCACCAC; Probe CD26M: GTTGGTGGTAAGGCCCTG; Probe CD27-28M: GTGGTGAGGCCCCTGG; Probe IVS-I-1N: TGATACCAACCTGCCCAG; Probe IVS-I-1M: CCCTGGGCAGATTGGTATC; Probe IVS-I-5M: GGCAGGTTGCTATCAAGGTTA; Probe CD31N: CCTTAGGCTGCTGGTGGT; Probe CD31M: CCCTTAGGTGCTGGTGG; Probe CD41-42N: ACCCAGAGGTTCTTTGAGTC; Probe CD41-42M: ACCCAGAGGTTGAGTCCTTT; Probe CD43M: AGAGGTTCTTTTAGTCCTTTGG; Probe CD71-72N: GCTCGGTGCCTTTAGTGA; Probe CD71-72M: TGCCTTTAAGTGATGGCCT; Probe IVS-II-654N: TTGCTATTGCCTTAACCCAG; Probe IVS-II-654M: TATTGCTATTACCTTAACCCAG; Probe IVS-II-5N: TCAGGGTGAGTCTATGGGA; Probe IVS-II-5M: TCCCATAGAGTCACCCTGA; Probe CD37N: CCTCTGGGTCCAAGGGTAGA; Probe CD37M: TCTACCCTTAGACCCAGAGG; Probe AC2: TGGCTCACCTGGACAACC; Probe AC3: CCTATCAGAAAGTGGTGGC; Probe NC: ACACCAACCGCATCGTCAT; Probe CC: CACATCACACACTCTGCGAC.

6. A gene chip for detecting non-deleted α-thalassemia genes, characterized in that: The gene chip is fixed with the probe combination A as described in claim 5.

7. A gene chip for detecting β-thalassemia, characterized in that: The probe combination B as claimed in claim 5 is fixed on the gene chip.

8. A kit for detecting thalassemia gene, characterized in that: The kit comprises a gene chip for detecting a non-deleted α-thalassemia gene as described in claim 6 and / or a gene chip for detecting β-thalassemia as described in claim 7, a primer combination A and / or a primer combination B as described in claim 5, a hybridization I solution, a hybridization II solution, a hybridization III solution, peroxidase and TMB.

Images