Molecular marker loci associated with dairy cattle body size traits and applications

By identifying molecular markers associated with body shape traits in dairy cows and applying marker-assisted selection, the problem of slow improvement in body shape traits in dairy cow breeding has been solved, enabling rapid progress in dairy cow genetic improvement and increased economic benefits.

CN120138165BActive Publication Date: 2026-05-12NINGXIA UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NINGXIA UNIVERSITY
Filing Date
2025-02-20
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively use genetic methods to improve the body shape traits of dairy cows, especially molecular markers that affect the lactation system, resulting in slow progress and insufficient economic benefits in dairy cow breeding.

Method used

By using genotyping and correlation analysis strategies, molecular markers that are significantly associated with the body shape traits of dairy cows were identified. Using marker-assisted selection and genomic selection, homozygous CC individuals were eliminated, while homozygous TT or heterozygous CT individuals were retained. The frequency of dominant genes was increased generation by generation, thereby improving the attachment width of the hind udder and the quality of milk production in dairy cows.

Benefits of technology

It has accelerated the process of genetic breeding and improvement of dairy cows, improved the milk quality and economic benefits of offspring dairy cows, and enhanced the market competitiveness of breeding enterprises.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138165B_ABST
    Figure CN120138165B_ABST
Patent Text Reader

Abstract

The application provides a molecular marker site related to a body shape trait on chromosome 6 of a dairy cow, and the site of the molecular marker is a SNP mutation of C>T at the 36700265 site on chromosome 6 of the dairy cow. Through the advantage allele of the above-mentioned marker, the application can increase the frequency of the advantage allele generation by generation, improve the body shape trait of the dairy cow, accelerate the genetic improvement process of the dairy cow, and thus effectively improve the economic benefits of the dairy cow breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to molecular markers on bovine chromosomes that are related to bovine body size traits and their applications. Background Technology

[0002] The dairy industry plays a vital role in my country's livestock development, representing a leading sector and serving as a significant indicator of a nation's agricultural advancement. Body conformation traits in dairy cows are correlated with milk production, reproduction, and longevity. Body conformation traits are quantitatively assessed within 30-180 days after the first calving. Each body conformation trait is scored on a linear scale according to the range of biological variation, using a 9-point scale, including total body size score and scores for five body parts: body mass, rump, limbs, lactation system, and dairy characteristics. Most body conformation traits show a positive genetic correlation with milk production traits. Hind udder attachment height and width are positively correlated with milk yield, while they are negatively correlated with milk fat percentage and milk protein percentage. Strengthening the selection of body conformation traits, especially hind udder traits and total body size score, is beneficial for improving the productive performance of dairy cows. Currently, the general trend in dairy cow breeding is to maintain excellent genetic traits such as milk yield and milk composition while also considering the comprehensive genetic performance of dairy cows, including body structure, hoof health, lifespan, and reproductive performance, in order to maximize the economic benefits of dairy farming. Numerous studies both domestically and internationally have shown a certain genetic correlation between body type traits and milk production traits in dairy cows. DeGroot et al. studied the correlation between body type traits, milk production traits, and milk duct score (SCS). DeHaas et al. reported a strong positive genetic correlation between rump width, milk texture, and body depth traits and milk production traits. Dube et al. conducted a correlation study between udder traits and SCS, finding a strong negative correlation between udder depth and teat position and SCS. Samoré et al. reported that, except for udder depth and heel depth, all other body type traits were positively genetically correlated with milk yield. These findings indicate that selecting for body type traits is beneficial to improving the overall health and milk production of dairy cows.

[0003] In dairy cattle breeding, the importance of genetic improvement work related to milk production is self-evident due to its extremely high economic value. The accuracy of quantitative trait locus (QTL) mapping is crucial for breeders to identify genes or regions influencing milk production. Accurate QTL mapping effectively improves selection accuracy, provides a scientific basis for breeding work, and accelerates the breeding process. Therefore, using genetic methods to improve the body conformation of resource cattle populations is feasible. Identifying new molecular markers affecting body conformation, especially those affecting the lactation system, and incorporating those with significant effects into marker-assisted selection (MAS) and genomic selection (GS) can accelerate the genetic improvement of dairy cattle populations, thereby improving the production performance of economically important traits and increasing the economic benefits for dairy farms. Summary of the Invention

[0004] To address the problems of existing technologies, this invention provides molecular markers that are significantly associated with the body shape traits of dairy cows, identified through genotyping and correlation analysis strategies. These markers can be used in marker-assisted selection and genomic selection to select favorable genotypes for breeding, thereby increasing the gene frequency of dominant alleles generation by generation. This can accelerate the process of genetic breeding improvement of dairy cows and bring huge economic benefits to local dairy farming.

[0005] The primary objective was to identify SNP molecular markers that influence body size traits in dairy cows. These markers are located on chromosome 6 (NC_037333.1), the reference sequence of the dairy cow genome.

[0006] The SNP site of the molecular marker corresponds to the C>T mutation at position 36700265 on chromosome 6 (NC_037333.1) of the bovine ARS-UCD1.2 genome.

[0007] The molecular marker is located in the following sequence SEQ ID NO.4:

[0008] 5'-CTTTTCCCTCCCTCTACGTTTTCATGGGCCCTCTAGATGCCCTTCCAGGATGCTGGAAGTCAGTGCTATG

[0009] AACAAAAAAAGATAGTTAGTGATATTGTACATAAGTAATGTTTTAACTTTAACTAGCAGGGTAGTGGGTG

[0010] TTTGTGTGCGTGTGCGCGTGTGTGTGTGCCTGTGTTTGTTCTGTGACCACAAAACCAGAGGGGGAAGTGT

[0011] GGGAGCAAGTGGGCTGGGTAGTGGCAAAATGCCCCATGACACATCTCTCCGCCC[C / T]CTGTGTAGGTGGAGAGCATCTGGAGCAGCCTTTAAATTCTGGGAGATCCTGGTTGTCAGCAGCAGGGAGAGCAGGCCAGGAG GGCAGCACTGAGCACTGCATCAGCATCACAGGGGACTGGACTCTTCTCGCCGCCGCAGACCAAGGTAAGCCTGCAGTTTGCTACAGACTCCTGTCCTCTCTGTGCGCTGCCTCATTTCATTGGGAAGGTCAATTTGTAA-3'

[0012] Another object of the present invention is to provide a primer and probe set for detecting the above-mentioned molecular markers, characterized in that the base sequence of the primer and probe set is as follows:

[0013] SEQIDNO.1:5'-ACGTTGGAATGAATGCCCCATGACACATCTC-3'

[0014] SEQIDNO.2: 5'-ACGTTGGATGTGACAACCAGGATCTCCCAG-3'

[0015] SEQIDNO.3: 5'-GGCACATCTCTCCGCCC-3'

[0016] Another object of the present invention is to provide a kit for detecting the above-mentioned molecular markers, the kit comprising the aforementioned primer and probe set.

[0017] Another objective of this invention is to provide the application of the aforementioned molecular markers in screening dairy cows for superior body conformation traits. Specifically, this involves detecting the genotype at the 36700265th base site on chromosome 6 (NC_037333.1) of the ARS-UCD1.2 dairy cow genome, and eliminating individuals with a homozygous CC genotype at this site.

[0018] In a preferred embodiment, individuals whose chromosome 6 (NC_037333.1) locus 36700265 is homozygous TT or heterozygous CT are retained.

[0019] In another preferred embodiment, individuals with heterozygous TT type at locus 36700265 on chromosome 6 (NC_037333.1) of dairy cows are retained.

[0020] Another objective of this invention is to provide an application of the above-mentioned time-of-flight mass spectrometry primer and probe set or detection kit in identifying genotypes at loci associated with bovine body size traits. Specifically, the above-mentioned primer and probe set or kit is used to detect the genotype at locus 36700265 on bovine chromosome 6 (NC_037333.1), and individuals at this locus who are homozygous for the CC type are eliminated.

[0021] In a preferred embodiment, individuals whose chromosome 6 (NC_037333.1) locus 36700265 is homozygous TT or heterozygous CT are retained.

[0022] In another preferred embodiment, individuals with heterozygous TT type at locus 36700265 on chromosome 6 (NC_037333.1) of dairy cows are retained.

[0023] Furthermore, the above-mentioned primer and probe sets or detection kits will be applied in the genomic selection breeding of dairy cows. Specifically, the above-mentioned primer and probe sets or kits will be used to detect the genotype at locus 36700265 on chromosome 6 (NC_037333.1) of dairy cows, and individuals with homozygous CC type at this locus will be eliminated.

[0024] Another object of the present invention is to provide a method for genetic improvement of dairy cows, the method comprising: determining the genotypes of the aforementioned molecular marker loci related to the body shape trait in breeding cows within a core dairy cow resource population, and making corresponding selections based on the genotypes of the molecular markers: culling individuals in the dairy cow resource population with a homozygous CC genotype at locus 36700265 on chromosome 6 (NC_037333.1), thereby increasing the frequency of homozygous TT or heterozygous CT genotypes at this locus generation by generation, thereby increasing the hind udder attachment width of offspring dairy cows. The dairy cow population includes Holstein cows and their synthetic lines.

[0025] In a preferred embodiment, individuals whose chromosome 6 (NC_037333.1) locus 36700265 is homozygous TT or heterozygous CT are retained.

[0026] In another preferred embodiment, individuals with heterozygous CT type at locus 36700265 on chromosome 6 (NC_037333.1) of dairy cows are retained.

[0027] Specifically, the following steps are included:

[0028] (1) Extract genomic DNA from the dairy cows to be tested;

[0029] (2) Use the aforementioned primer and probe sets or detection kits to detect the genotype of the dairy cows to be tested;

[0030] (3) Based on the detection results, determine the genotype of the dairy cow to be tested at the molecular marker at position 36700265 on chromosome 6 (NC_037333.1) of the dairy cow reference genome ARS-UCD1.2;

[0031] (4) Eliminate individuals of the same type as the 36700265 locus on chromosome 6 (NC_037333.1) of dairy cows.

[0032] In a preferred embodiment, individuals whose chromosome 6 (NC_037333.1) locus 36700265 is homozygous TT or heterozygous CT are retained.

[0033] In another preferred embodiment, individuals with heterozygous CT type at locus 36700265 on chromosome 6 (NC_037333.1) of dairy cows are retained.

[0034] In a preferred embodiment, the above-mentioned bovine body characteristics are chest width and / or hind udder attachment width.

[0035] The present invention has the following advantages and effects compared with the prior art:

[0036] First, new molecular markers associated with the attachment width of the hind udder in dairy cows were identified, and corresponding mass spectrometry detection primers and probes were developed.

[0037] Secondly, the molecular markers identified in this invention can be applied to the genetic improvement of superior body traits in dairy cows, thereby improving the milk quality of offspring dairy cows and increasing the market competitiveness of breeding enterprises. Attached Figure Description

[0038] The beneficial effects of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0039] Figure 1 These are pooled PCR sequencing results of the 6:g.36700265C>T site in Holstein dairy cows.

[0040] Figure 2 Genotyping results of the 6:g.36700265C>T site on chromosome 6 of the Holstein dairy cow reference genome ARS-UCD1.2. Detailed Implementation

[0041] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0042] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores.

[0043] Example 1: Detection of variant sites:

[0044] 1. Experimental animals and their test characteristics

[0045] The experimental group consisted of 1,114 Chinese Holstein cows from the Pingjibao Dairy Farm No. 2 of Ningxia Helanshan Dairy Company. The feeding conditions and environment of all cows remained largely unchanged. The birth years of this experimental group ranged from 2012 to 2021. The production performance records of the experimental cows included individual number, date of birth, farm number, father number, mother number, maternal grandfather number, calving date, parity, and body type traits (chest width, loin strength, rump width, hoof-heel depth, bone quality, hind limb posterior view, central suspensory ligament, anterior udder attachment, angularity, hind udder attachment height, and hind udder attachment width).

[0046] 2. Extraction of blood DNA

[0047] Blood was collected from the tail stump, and DNA was extracted from the bovine blood using a DNA extraction kit. The quality of the extracted DNA was assessed using agarose gel electrophoresis, and the concentration of the extracted DNA was detected using a micro-nucleic acid and protein analyzer. Forty qualified DNA samples were randomly selected, and 1 μL of each was mixed into a 1.5 mL centrifuge tube to construct a DNA mixing chamber, which was stored at -20°C for subsequent experiments.

[0048] 3. Primer design and PCR amplification

[0049] Using the bovine genome sequence published on NCBI (https: / / www.ncbi.nlm.nih.gov / ), amplification primers were designed using Primer 5.0 software (Table 1) and sent to Shaanxi Qingke Biotechnology Co., Ltd. for synthesis.

[0050]

[0051] The gene amplification system consisted of 50 μL: 6 μL cDNA sample, 2 μL each of forward and reverse primers, 25 μL Taq PCR MasterMix, and 15 μL ddH2O. The PCR amplification program was as follows: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 15 s, annealing for 40 s, extension at 72 ℃ for 1 min, for a total of 35 cycles; 72 ℃ extension for 5 min, and storage at 4 ℃. After 1% agarose gel electrophoresis, the products were sent to Shaanxi Qingke Biotechnology Co., Ltd. for sequencing.

[0052] 4. Sequencing results and screening of polymorphic sites

[0053] Amplified samples meeting the expected criteria were sent to Shaanxi Qingke Biotechnology Co., Ltd. for sequencing. The results were compared with the original sequences using SnapGene and compared with the sequencing peak diagram to identify variant sites in the dairy cow population (see...). Figure 1 ).

[0054] Example 2 Genotyping

[0055] Based on the sequence information of the SNP sites, PCR reactions and single-base expansion primers were designed using the software MassARRAY Assay Design SUITE V2.0. The DNA sequences of the primers are shown below:

[0056]

[0057] The detected SNP loci and complete herd blood samples were submitted to Compson for genotyping using MassARRAY® SNP time-of-flight mass spectrometry. Figure 2 The primers and probes were combined to prepare a detection kit.

[0058] Example 3: Association analysis between genotype and body size traits

[0059] Association analysis was performed between the genotypes of the aforementioned SNP loci and body type traits, and the results are shown in the table below:

[0060]

[0061] Note: The P-value indicates the degree of association between each SNP and the body type trait; different superscript letters indicate the differences between genotypes after multiple comparisons (uppercase letters are used when P < 0.01, and lowercase letters are used when P < 0.05).

[0062] As shown in the table, 6:g.36700265C>T has a significant effect on body size traits in Holstein dairy cows (P<0.05). The dominant genotype affecting chest width is the homozygous TT type, and the dominant genotype affecting hind udder attachment width is the homozygous TT type.

[0063] Example 3: Method for genetic improvement of body shape traits in dairy cows

[0064] A method for genetically improving the body conformation trait of dairy cows, wherein the dairy cow population includes Holstein cows and their synthetic lines, the method comprising the following steps:

[0065] 1) Determine the genotypes of the aforementioned molecular marker loci related to bovine body size traits in the core dairy cattle resource population.

[0066] 2) Make corresponding selections based on the genotypes of the molecular markers: Eliminate individuals with homozygous CC type at locus 36700265 on chromosome 6 (NC_037333.1) in the core dairy cow resource population, so as to increase the frequency of TT and CT genotypes at this locus generation by generation, thereby increasing the attachment width of the hind udder of the offspring dairy cows, and further improving the body performance and milk production capacity of the dairy cows.

[0067] Step 1 includes the following steps:

[0068] 1.1) Extract genomic DNA from the dairy cows to be tested;

[0069] 1.2) Use the aforementioned primer and probe sets or detection kits to detect the genotype of the dairy cows to be tested;

[0070] 1.3) Based on the detection results, determine the genotype of the dairy cow to be tested at the molecular marker at position 36700265 on chromosome 6 (NC_037333.1) of the reference genome ARS-UCD1.2;

[0071] In a preferred embodiment, individuals with a homozygous TT or heterozygous CT locus at position 36700265 on chromosome 6 (NC_037333.1) of dairy cows are retained.

[0072] In another preferred embodiment, individuals with homozygous TT locus at position 36700265 on bovine chromosome 6 (NC_037333.1) are retained.

[0073] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A method for improving the body conformation traits of dairy cows, characterized in that, The method includes the following steps: detecting the genotype at locus 36700265 on chromosome 6 of the ARS-UCD1.2 genome of dairy cows, culling individuals with the homozygous CC genotype at this locus, wherein the dairy cows are Chinese Holstein dairy cows, and the body type traits are chest width and / or hind udder attachment width.

2. The method according to claim 1, characterized in that, The method for detecting the genotype at locus 36700265 on chromosome 6 of the ARS-UCD1.2 bovine genome includes the following steps: (1) Extract genomic DNA from the dairy cow population to be tested; (2) The genotype of the dairy cows to be tested was detected using primer and probe sets or a kit; the base sequences of the primer and probe sets are as follows: SEQ ID NO.1:ACGTTGGAATGAATGCCCCATGACACATCTC, SEQ ID NO.2: ACGTTGGATGTGACAACCAGGATCTCCCAG, SEQ ID NO.3: GGCACATCTCTCCGCCC; (3) Based on the test results, determine the genotype of the cow at locus 36700265.

3. Application of molecular markers in improving the body conformation trait of dairy cows, wherein the molecular markers contain a C>T mutation at position 36700265 on chromosome 6 of the bovine ARS-UCD1.2 genome, and the nucleotide sequence of the molecular markers is shown in SEQ ID NO.4; the dairy cows are Chinese Holstein dairy cows, and the body conformation trait is chest width and / or hind udder attachment width; the dominant genotypes at position 36700265 are CT and TT, and individuals carrying the CT or TT genotype have a greater phenotypic value for the body conformation trait than individuals carrying the CC genotype.

4. Application of primer and probe sets in improving the body size trait of dairy cows, wherein the base sequences of the primer and probe sets are as follows: SEQ ID NO.1:ACGTTGGAATGAATGCCCCATGACACATCTC, SEQ ID NO.2: ACGTTGGATGTGACAACCAGGATCTCCCAG, SEQ ID NO.3: GGCACATCTCTCCGCCC; The genotype of dairy cows was detected using the primer and probe set. Based on the detection results, the genotype of the dairy cows at locus 36700265 on chromosome 6 of the ARS-UCD1.2 genome was determined. The dairy cows are Chinese Holstein dairy cows, and the body type traits are chest width and / or hind udder attachment width; the dominant genotypes at locus 36700265 are CT and TT, and individuals carrying the CT or TT genotype have a higher body type phenotypic value than individuals carrying the CC genotype.