Molecular marker related to thorn covering character of eggplant sepals and application of molecular marker

By developing molecular markers and KASP markers related to the prickly traits of eggplant sepals, the problem of the field screening of thornless eggplant materials is easily affected by environmental and human factors, and rapid and accurate screening is achieved, and breeding efficiency is improved.

CN120138201AActive Publication Date: 2025-06-13TIANJIN ACAD OF AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510306074.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-14
Publication Date
2025-06-13
Estimated Expiration
2045-03-14

AI Technical Summary

Technical Problem

In the prior art, the field screening of thornless eggplant materials requires judgment after the eggplant appears, which is susceptible to environmental and human factors, resulting in large selection errors and labor-consuming.

Method used

A molecular marker related to the sepal trait of eggplant sepals was developed, and through specific primer and KASP labeling techniques, PCR amplification and fluorescent probe detection, quickly identifying whether eggplant has spiny-free characteristics.

Benefits of technology

Through molecular marker assisted screening of spiny-free eggplant materials, environmental and artificial operation errors can be eliminated, screening efficiency can be improved, land use and labor costs can be saved, and breeding efficiency can be improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138201A_ABST
    Figure CN120138201A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological breeding, and provides a molecular marker related to the thorn covering character of eggplant sepals and application of the molecular marker, the sequence of the molecular marker related to the thorn covering character of eggplant sepals is SEQ ID NO: 1, T-C mutation occurs at the 100bp position of the SEQ ID NO: 1, and when the basic group at the 100bp position is T, the eggplant sepals have thorns. One application includes: molecular markers; and / or primers; and / or a KASP primer; and / or the application of the kit in identification of eggplant sepal thorn covering and / or eggplant breeding. The molecular marker is utilized to assist in screening the thorn-free eggplant material, so that environmental and manual operation errors can be eliminated, batch operation is easy, land and labor cost can be saved through seedling stage selection, and the breeding efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomolecular detection and breeding, and specifically relates to molecular markers related to the trait of calyx thorns in eggplants and their applications. Background Art

[0002] Kompetitive allele specific PCR (KASP) technology is a method of designing two primers at both ends for allelic SNP sites, using real-time fluorescence PCR technology to amplify substrates. The corresponding fluorescence probes can bind to the corresponding primer binding sites, and the genotype of the amplification products is determined according to the detected fluorescence colors. It is a new, rapid, simple and convenient method without electrophoresis.

[0003] Thorns, as appendages of plants, especially as fruits mature, most thorns gradually harden and become dangerous, causing inconvenience to field farming operations, storage and transportation, and consumers. They are generally considered as poor agronomic traits.

[0004] In related breeding technologies, screening thornless eggplant materials in the field requires judgment during the period when the eggplants have large buds, which is easily affected by environmental temperature and other factors, resulting in large selection errors. Summary of the Invention

[0005] In view of this, the present invention provides a molecular marker related to the trait of calyx thorns in eggplants and its applications, so as to solve the problems in the prior art that screening thornless eggplant materials in the field requires judgment after the eggplants have buds, which is easily affected by environmental and human factors, resulting in large selection errors and consuming a lot of man-hours.

[0006] In the first aspect, the present invention provides a molecular marker related to the trait of calyx thorns in eggplants. The sequence of the molecular marker is SEQ ID NO:1. Among them, a mutation of T→C occurs at the 100th bp of SEQ ID NO:1. When the base at the 100th bp is T, the calyx of the eggplant has thorns.

[0007] In an optional embodiment, when the base at the 100th bp of SEQ ID NO:1 is C, the calyx of the eggplant is thornless.

[0008] In the second aspect, the present invention also provides a primer suitable for specifically amplifying the molecular marker related to the shape of calyx thorns in eggplants.

[0009] In the third aspect, the present invention also provides a KASP primer for amplifying the molecular marker related to the trait of calyx thorns in eggplants. The KASP primer includes a first upstream primer, a second upstream primer and a downstream primer. Among them, the sequence of the first upstream primer is SEQ ID NO:2, the sequence of the second upstream primer is SEQ ID NO:3, and the sequence of the downstream primer is SEQ ID NO:4.

[0010] In a fourth aspect, the present invention also provides a kit, which is suitable for detecting the molecular marker related to the trait of calyx thorns of eggplant; and / or detecting the primer; and / or detecting the KASP primer.

[0011] In a fifth aspect, the present invention also provides a method for identifying the trait of calyx thorns of eggplant, including: extracting genomic DNA from eggplant leaves, using the genomic DNA as a template, designing primers, and performing PCR amplification to obtain the product shown in SEQ ID NO: 1; analyzing or sequencing the product; when the base at the 100th bp of SEQ ID NO: 1 is T, the eggplant has thorns, and when the base at the 100th bp of SEQ ID NO: 1 is C, the eggplant has no thorns.

[0012] In a sixth aspect, the present invention also provides a method for predicting the calyx thorn performance of eggplant, including: extracting genomic DNA from eggplant leaves, using the genomic DNA as a template, designing primers, and performing PCR amplification to obtain the product shown in SEQ ID NO: 1; analyzing or sequencing the product; when the base at the 100th bp of SEQ ID NO: 1 is T, the eggplant has thorns, and when the base at the 100th bp of SEQ ID NO: 1 is C, the eggplant has no thorns.

[0013] In a seventh aspect, the present invention also provides an application, including: the application of the molecular marker; and / or the primer; and / or the KASP primer; and / or the kit in identifying the calyx thorns of eggplant and / or eggplant breeding.

[0014] The beneficial effects of the present invention are as follows:

[0015] By using molecular marker-assisted screening of thornless eggplant materials, the present invention can eliminate environmental and human operation errors, is easy to operate in batches, and seedling stage selection can save land and labor costs, improving the breeding efficiency. Description of the Drawings

[0016] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for use in the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention, and those of ordinary skill in the art can obtain other drawings based on these drawings without creative efforts.

[0017] Figure 1 It is a diagram of a thorned eggplant showing the separation of calyx thorns of the molecular marker related to the trait of calyx thorns of eggplant in the embodiment of the present invention;

[0018] Figure 2 It is the thornless figure in the schematic diagram of the separation of eggplant thorns related to the molecular marker of the calyx thorn trait of the embodiments of the present invention;

[0019] Figure 3 It is the F2 thorn separation figure of the molecular marker related to the calyx thorn trait of the embodiments of the present invention;

[0020] Figure 4 It is the SNPDelta-index distribution figure of the eggplant genome of the molecular marker related to the calyx thorn trait of the embodiments of the present invention;

[0021] Figure 5a It is one of the primer information figures of the embodiments of the present invention;

[0022] Figure 5b It is the second of the primer information figures of the embodiments of the present invention;

[0023] Figure 6 It is the genotyping figure of the test population of the embodiments of the present invention, wherein the blue dots represent the thorned genotype of eggplant.

[0024] Figure 7 It is the genotyping figure of the test population of the embodiments of the present invention, wherein the red dots represent the thornless genotype, and the green dots in the middle represent the heterozygous genotype. Detailed implementation manners

[0025] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts fall within the protection scope of the present invention.

[0026] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] Relevant data shows that most eggplant calyces are thorny, and they gradually become hard with the ripening of the fruits, which is dangerous and brings inconvenience to field farming operations, storage and transportation, and consumers. It is considered an undesirable agronomic trait. There is an urgent need for thornless eggplant breeding technology and new varieties in production. The thornless eggplant breeding in China is still in its initial stage, and currently there is little research on genes related to the thorn trait of eggplant and breeding technology. This patent uses genome resequencing combined with the BSA method, comprehensively applies bioinformatics to predict candidate genes, and uses its SNP sites to develop KASP markers, and verifies them in a known genotype population, with a view to developing KASP marker-assisted breeding linked to the thorn trait.

[0028] The following will describe the embodiments of the present invention in conjunction with Figures 1 to 7 , the embodiments of the present invention will be described.

[0029] As Figure 1 and Figure 2 shown, according to the embodiments of the invention, a molecular marker related to the trait of prickles on the calyx of eggplant is provided. The sequence of the molecular marker is SEQ ID NO:1. Among them, a mutation of T→C occurs at the 100th bp of SEQ ID NO:1. When the base at the 100th bp is T, the calyx of the eggplant has prickles.

[0030] In the embodiments of the present invention, the specific sequence of this molecular marker is designated as SEQ ID NO:1. At the 100th base pair position of this sequence, there is an important mutation phenomenon. Specifically, when the base at this position changes from T (thymine) to C (cytosine), it indicates that the prickles on the calyx of the eggplant have changed. In other words, if the base detected at the 100th base pair position of the sequence is T, then it can be inferred that the calyx of this eggplant has prickles.

[0031] Using molecular marker-assisted screening of thornless eggplant materials can eliminate environmental and human operation errors, is easy to operate in batches, and seedling stage selection can save land and labor costs, improving breeding efficiency.

[0032] Furthermore, when the base at the 100th bp of SEQ ID NO:1 is C, the calyx of the eggplant is thornless.

[0033] According to the sequence identification number SEQ ID NO:1, at the position of its length of 100 base pairs (bp), if the base at this position is cytosine (C), then in terms of botanical characteristics, the calyx of the corresponding eggplant variety will show a thornless form.

[0034] According to the embodiments of the invention, a primer is also provided, which is suitable for specifically amplifying a molecular marker related to the trait of prickles on the calyx of eggplant.

[0035] In the embodiments of the present invention, this primer is particularly suitable for specifically amplifying a molecular marker related to the trait of prickles on the calyx of eggplant. The design and use of this primer enable researchers to more accurately identify and analyze the genetic factors affecting the shape of prickles on the calyx of eggplant, thus providing an effective tool for the variety improvement and genetic research of eggplant.

[0036] According to an embodiment of the invention, there is also provided a set of KASP primers for amplifying molecular markers related to the trait of calyx thorns in eggplant. The KASP primers include a first upstream primer, a second upstream primer, and a downstream primer. Among them, the sequence of the first upstream primer is SEQ ID NO:2, the sequence of the second upstream primer is SEQ ID NO:3, and the sequence of the downstream primer is SEQ ID NO:4. By using primers with these specific sequences, researchers can effectively amplify specific DNA fragments related to the trait of calyx thorns in eggplant, thus contributing to the research and improvement of this trait at the molecular level.

[0037] According to an embodiment of the invention, there is also provided a kit, which is suitable for detecting molecular markers related to the trait of calyx thorns in eggplant; and / or detection primers; and / or KASP primers. In the embodiment of the present invention, the kit is particularly suitable for detecting molecular markers related to the trait of calyx thorns in eggplant; in addition, the kit can also be used to detect specific detection primers related thereto; and for detecting specific primers in the KASP (Kompetitive Allele Specific PCR) technique.

[0038] According to an embodiment of the invention, there is also provided a method for identifying the trait of calyx thorns in eggplant, including the following steps:

[0039] Step S101: Extract the genomic DNA of eggplant leaves. Using the genomic DNA as a template, design primers and perform PCR amplification to obtain the product shown in SEQ ID NO:1.

[0040] Step S103: Analyze or sequence the product.

[0041] When the base at the 100th bp of SEQ ID NO:1 is T, the eggplant has thorns; when the base at the 100th bp of SEQ ID NO:1 is C, the eggplant is thornless.

[0042] According to an embodiment of the invention, there is also provided a method for predicting the calyx thorn performance of eggplant, including the following steps:

[0043] Step S201: Extract the genomic DNA of eggplant leaves. Using the genomic DNA as a template, design primers and perform PCR amplification to obtain the product shown in SEQ ID NO:1.

[0044] Step S203: Analyze or sequence the product.

[0045] When the base at the 100th bp of SEQ ID NO:1 is T, the eggplant has thorns; when the base at the 100th bp of SEQ ID NO:1 is C, the eggplant is thornless.

[0046] According to an embodiment of the invention, first, genomic DNA needs to be extracted from the leaves of eggplants. Next, using the extracted genomic DNA as a template, specific primer sequences are designed. These primers are amplified using PCR (Polymerase Chain Reaction) technology to obtain a specific DNA sequence product, the sequence of which matches the sequence shown in SEQ ID NO:1. The obtained PCR product needs to be further analyzed or sequenced. This step is to ensure the correctness and purity of the product, as well as to provide accurate DNA sequence information for subsequent analysis work. After the analysis and sequencing are completed, a base check can be performed at specific positions of the SEQ ID NO:1 sequence. Specifically, if base T (thymine) is detected at the 100th base position of this sequence, it indicates that this eggplant variety has the characteristic of having prickles; on the contrary, if base C (cytosine) is detected at the same position, it means that this eggplant variety is thornless. Through this method, the prickly performance of eggplants can be effectively predicted, thus providing convenience for agricultural production.

[0047] According to an embodiment of the invention, there is also provided an application, including: the use of molecular markers; and / or primers; and / or KASP primers; and / or kits in the identification of eggplant calyx prickles and / or eggplant breeding.

[0048] In an embodiment of the present invention, this application involves multiple aspects, including but not limited to the use of molecular markers; and / or the use of specific primers; and / or the use of KASP (Kompetitive Allele Specific PCR) primers; and / or the use of kits. These elements play an important role in the identification of eggplant calyx prickly characteristics and in the process of eggplant breeding. Through these technical means, researchers and breeders can more accurately identify and select eggplant varieties with specific traits, thereby improving the breeding efficiency.

[0049] The present invention uses specific KASP markers to assist in screening for the prickly trait of eggplants. The specific KASP marker has an SNP locus at 86557859 on chromosome 6, which is either T or C. The present invention provides an SNP locus closely linked to the prickly trait of eggplants and has developed a KASP marker, which can detect the genotype at 86557859 in a high-throughput manner and is related to the prickly trait. Screening thornless eggplant materials in the field needs to be judged during the flowering period of eggplants, which is easily affected by environmental and human factors, and the selection error is relatively large. Using KASP molecular markers to assist in screening thornless eggplant materials can eliminate environmental and human operation errors, is easy for batch operation, and seedling-stage selection can save land and labor costs, improving the breeding efficiency.

[0050] The present invention mainly solves the problem of thorn trait investigation. The use of specific KASP molecular marker rapid screening technology greatly reduces the field labor intensity and saves human, material and time costs. The positive effects compared with the prior art are as follows:

[0051] (1) Overcoming environmental influence: By screening thornless eggplant varieties and inbred lines through linked markers, the thorn trait can be rapidly identified, thus overcoming environmental influence.

[0052] (2) High screening efficiency and reliable results: Experiments have confirmed that using this method to screen thornless eggplant materials is more efficient and reliable than artificial climate chambers and traditional field tests.

[0053] (3) Low cost: Compared with artificial climate chambers and traditional field investigations, the human, material and time costs are significantly reduced.

[0054] Example 1, determination of molecular markers

[0055] 1.1 Experimental materials

[0056] In the spring of 2023, the experimental seeds 24TH4 from the germplasm resource bank of the Tianjin Academy of Agricultural Sciences were used as the female parent, and L154 as the male parent. A combination was made and the F1 hybrid seeds were harvested. In the autumn, the F1 generation was planted and self-crossed to obtain F2 generation seeds. In the spring of 2024, the parental lines 24TH4, L154 and F2 generation seeds were planted simultaneously. Sowing and seedling raising were carried out on February 1st, and transplantation was carried out in a multi-span greenhouse on March 28th. 40 plants of the female parent and the male parent were planted respectively, and 230 plants of the F2 population were planted. The plant spacing was 60 cm × 70 cm, covered with black plastic film, and conventional cultivation management was carried out. As Figure 1 shown, the sepals of 24TH4 are multi-thorned; as Figure 2 shown, the sepals of L154 are spiny; the thorn traits of the F2 population showed segregation, presenting multi-thorned, few-thorned and thornless.

[0057] 1.2 Experimental methods

[0058] 1.2.1 Field experiment and trait investigation

[0059] Investigation of thorns: The agronomic traits of the calyx thorns of eggplant were mainly tested. Thorns could be seen about 2 months after transplantation, and the number of thorns on the calyx was recorded.

[0060] Distribution of thorn numbers: According to the segregation performance of thorns in the parental lines and F2 population of the test materials, the number of thorns was classified and statistically analyzed.

[0061] 1.2.2 Construction of extreme bulks and genotyping

[0062] Forty thorny single plants and forty thornless single plants were selected from the F2 population. Together with the two parents, 24TH4 and L154, 1 g of young plant leaves were taken, and DNA was extracted using the Shanghai Sangon plant DNA extraction kit based on the CTAB method. The DNA of 40 thorny F2 single plants and 40 thornless F2 single plants was mixed in equal amounts respectively to construct a thorny pool and a thornless pool. The DNA of the two pools and the DNA of the two parents were used to construct libraries according to the standard process of Vazyme, and whole-genome resequencing with 30× and 10× coverage was carried out on the two pools and the two parents by illumina HiSeq4000 (pair-end 150 bp). The FastQC software was used for data quality control (default parameters). The adapter and low-quality sequences were removed from the raw sequences obtained by sequencing, and then the sequences were aligned to the eggplant reference genome by the BWA software. The duplicate reads in the alignment results were removed by the rmdup command of SAMTOOLS. The GATK3.3 software was used to detect single nucleotide polymorphisms (SNPs) and insertions and deletions (InDels) in multiple samples, VariantFiltration was used for filtering, and the ANNOVAR software was used to annotate SNPs and InDels.

[0063] 1.2.3 Thorny gene mapping and molecular marker development based on the bulked segregant analysis

[0064] Based on the genotyping results, polymorphic sites with homozygous differences between the parents were screened. Taking the parents as references, the SNP frequency (SNP-index) of the two offspring bulked segregant analysis pools at each polymorphic site was calculated according to the method of TAKAGI et al. To reduce the influence caused by sequencing errors and alignment errors, the polymorphic sites of the parents after calculating the SNP-index were filtered, and the filtering criteria were as follows: (1) Sites where the SNP-index in both offspring was less than 0.3 and the SNP depth was less than 5 were filtered out; (2) Sites where the SNP-index of one offspring was missing were filtered out. Subsequently, the difference in SNP-index (△SNP-index) between the two offspring was calculated. A window of 1 Mb and a step size of 10 kb were selected to map the distribution of △SNP-index on each chromosome, and a 95% confidence level was selected as the screening threshold. Windows above the confidence level were used as candidate intervals.

[0065] 1.3 Experimental results

[0066] 1.3.1 Preliminary genetic analysis of the thorny trait in eggplant

[0067] Through the investigation and statistics of the fruit color under the calyx of 230 F2 segregating populations, 40 were thorny, 136 were less thorny, and 54 were thornless. The overall segregation pattern was a normal distribution, which conformed to the genetic characteristics of quantitative traits, and bulked segregant analysis extreme pool resequencing could be carried out, seeFigure 3 。

[0068] 1.3.2 Construction of extreme population pooling and sequencing data analysis

[0069] Whole-genome resequencing was performed on the pooling constructed from 40 thorny F2 individuals and 40 thornless F2 individuals, as well as the two parents, and a total of 72.39 G of raw data was obtained. After filtering, the effective sequence data volume of the 4 samples was between 9662.97 - 26582.26 M, and the total data volume was 71.79 G. The sequencing data had Q20 > 97.92%, Q30 > 93.98%, the GC content was between 36.09% - 36.47%, and 99.81 - 99.87% of the sequences of the sequencing data could be successfully aligned to the reference genome. It can be seen that the data volume of all samples was sufficient, the sequencing quality was qualified, the GC distribution was normal, and the alignment result of the sequencing data with the eggplant reference genome was normal, which could be used for subsequent variant detection and gene mapping of traits.

[0070] By comparing the sequencing results of the thorny parent 24TH4 and the thornless parent L154, a total of 1,681,878 SNPs and 312,493 Indels were obtained. The SNPs detected between the parents were significantly more than the Indels. According to the comparison of the positions where the variations occurred, it was found that whether it was SNPs variation or Indels variation, the polymorphic sites in the non-coding region of the gene were significantly more than those in the coding region of the gene. These polymorphic sites showed non-uniform distribution among chromosomes, and chromosome 6 had the most abundant polymorphic sites.

[0071] 1.3.3 Gene mapping of the thorn-covered trait

[0072] The △SNP-index of the 2 pooling was analyzed for gene mapping of the thorn-covered trait in eggplant. The mapping results showed that an extremely significant peak exceeding the critical value level appeared in a region distributed on chromosome 6 of eggplant, indicating that this region might contain genes regulating the thorn-covered trait in eggplant. The distribution of the significantly associated interval on the eggplant genome was Chr6: 85.22 - 88.18 Mb. The chromosome length covered by the significantly associated interval was 2.96 Mb. The peak value at the vertex of the associated interval was the highest, suggesting that this interval might have a major gene causing the thornless phenotype in eggplant, see Figure 4 。

[0073] 1.3.4 Development of molecular markers related to the thorn-covered trait

[0074] One significant associated interval obtained from the detection of the positioning result is distributed within the 2.96 Mb interval of chromosome 6 of eggplant. The peak of the associated interval is the highest, which is the major locus controlling the trait of spiny fruit. By fine mapping, the gene controlling the spiny fruit trait of eggplant was mapped within the physical interval of 86444678 - 86576080. In this interval, there is a SNP mutation site at the 86557859th base, which changes from T to C. Based on this SNP site, a specific KASP marker was developed.

[0075] Example 2 Determination of specific primers for molecular markers

[0076] 2.1 Base information of 100 bp before and after the variant base

[0077] >SNP1→E06 86557659 - 86557859

[0078] SEQ ID NO:1

[0079] TTTATCATCGTGCGGAAATTTTTAGCTCATAAGATATATATGCCCACCAATAAGAGTTGTATTTGATCATGACTCCAACCTTGACCACCCAAACCTCTT[T / C]ATGTGCCTTGACATAGGTAGATAGCTAGTGTTACTCAACAATCTCCCTCCCAATACGCACTTCATATAGCATGTTGCTCGTTGG AATCTACCCCATGACT

[0080] 2.2 Design of KASP primers based on the variant base information

[0081] As Figure 5a and Figure 5b shown, the KASP primers include a first upstream primer, a second upstream primer, and a downstream primer.

[0082] First upstream primer: SEQ ID NO:2

[0083] GAAGGTGACCAAGTTCATGCTAACCTTGACCACCCAAACCTCTTT

[0084] Second upstream primer: SEQ ID NO:3

[0085] GAAGGTCGGAGTCAACGGATTAACCTTGACCACCCAAACCTCTTC

[0086] Downstream primer: SEQ ID NO:4

[0087] GGTAGATTCCAACGAGCAACATGC

[0088] The sequence of the first upstream primer is shown in SEQ ID NO:2, the sequence of the second upstream primer is shown in SEQ ID NO:3, and the sequence of the downstream primer is shown in SEQ ID NO:4.

[0089] Biological experiments show that the above primer combination can perform gradient PCR specific amplification when the annealing temperature is close to 61°C.

[0090] Furthermore, the KASP primers are labeled with fluorescein.

[0091] Furthermore, the labeled fluoresceins are HEX and FAM.

[0092] Example 3 Verification of Molecular Markers

[0093] 3.1 Test Materials

[0094] The breeding materials in the autumn of 2024, including two types of eggplants, thornless and thorny, with a total of 100 experimental materials.

[0095] 3.2 Test Methods

[0096] (1) Sow the eggplant seeds to be detected, use a 32-hole seedling tray, sow 1 seed in each hole, and conduct conventional cultivation management.

[0097] (2) When there is one new leaf at the seedling stage, take one green cotyledon of the seedling to be detected and transport it back to the laboratory in a 2 mL centrifuge tube.

[0098] (3) Place two steel beads with a diameter of 2 mm in each centrifuge tube, and use a high-throughput tissue grinder (Ningbo Xinzhi Scientz-48) to crush them, with the frequency set at 69 Hz and the time set at 60 s.

[0099] (4) During the DNA extraction process, perform a water bath at 65°C for 60 min.

[0100] (5) Extract with phenol-chloroform-isoamyl alcohol with a volume ratio of 25:24:1, invert and mix 10 times, centrifuge at 12000 rpm for 4 minutes.

[0101] (6) Take 200 uL of the supernatant, add an equal volume of absolute ethanol, let it stand at 4°C for 1 hour, centrifuge at 12000 rpm for 4 minutes.

[0102] (7) Pour off the upper liquid, add 500 ul ddH 2 O, centrifuge at 3000 rpm for 60 seconds and then let it stand for 1 hour.

[0103] (8) After the dissolved DNA is detected for concentration by a nucleic acid protein analyzer, it is uniformly adjusted to 1-10 ng / μL.

[0104] (9) Take 2 μL of DNA and use the self-owned KASP identification system of the Eggplant Research Office of Tianjin Kerun Vegetable Research Institute to conduct linkage marker-assisted screening on eggplant varieties and inbred lines.

[0105] (10) KASP1:

[0106] Forward primer1: GAAGGTGACCAAGTTCATGCTAACCTTGACCACCCAAACCTCTTTForward primer2: GAAGGTCGGAGTCAACGGATTAACCTTGACCACCCAAACCTCTTCReverse primer: GGTAGATTCCAACGAGCAACATGC Synthesized by Tsingke Biotechnology. The marker development method is shown in Example 1 and Example 2.

[0107] (11) Drugs and materials: HiGeno 2x Probe Mix, primers, DNA templates, ddH 2 O, fluorescence quantitative PCR plates and sealing films.

[0108] (12) Use the KASP standard reaction system, a total of 10 μL, including 5 μL Mix (HiGeno 2x Probe Mix of Beijing Jiacheng Biotechnology Co., Ltd.), 2.86 μL ddH2O, 2 μL template DNA (concentration 1-10 ng / μL), and 0.14 μL primer premix (the upstream and downstream primer concentrations are adjusted to 100 pmol / μL, pipette 12 μL Forward primer1, 12 μL Forward primer2, 30 μL Reverse primer and 46 μL ddH2O to prepare 100 μL primer premix).

[0109] (13) The PCR program is pre-denaturation at 95°C for 10 min; 10× cycles (denaturation at 95°C for 20 s, annealing at 61-55°C for 40 s, decreasing 0.6°C per cycle); 40× cycles (denaturation at 95°C for 20 s, annealing at 55°C for 40 s); finally, store at 25°C for standby.

[0110] (14) To ensure the accuracy of genotyping data, in addition to the test samples, 2 known genotype control samples are used on the PCR plate, and the control samples should be clustered in the expected regions of their genotypes.

[0111] (15) Detection was performed using a 7500 Real-Time Fluorescent Quantitative PCR Instrument, and the genotying function was selected for analysis. The HEX and FAM fluorescence signal values were plotted on the x-axis and y-axis respectively. Based on the fluorescence signal values, the samples were clustered, and the genotypes were further determined according to the sample clusters.

[0112] 3.3 Test Results

[0113] The verification results showed that the compliance rate of this marker could reach 95 - 99%, as shown in Table 1, Figure 6 and Figure 7 . It indicates that the molecular marker of the present invention can well assist in screening field breeding materials.

[0114] Table 1 Information of the Verification Population of the Calyx Thorn Linked Molecular Marker

[0115]

[0116]

[0117]

[0118]

[0119]

[0120] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners.

[0121] For those of ordinary skill in the art, other different forms of changes or alterations can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or alterations derived therefrom are still within the protection scope of the present invention.

Claims

1. A molecular marker related to the thorny trait of eggplant sepals, characterized in that: The sequence of the molecular marker is SEQ ID NO: 1, wherein a T→C mutation occurs at the 100 bp of the SEQ ID NO: 1, and when the base at the 100 bp is T, the eggplant sepals have thorns.

2. The molecular marker related to the eggplant sepal covered thorn trait according to claim 1, characterized in that: When the base at the 100th bp of SEQ ID NO: 1 is C, the eggplant sepals are thornless.

3. A primer, characterized in that Suitable for specifically amplifying the molecular marker related to the eggplant sepal covered thorn trait as claimed in claim 1 or 2.

4. A KASP primer for amplifying a molecular marker related to the thorny trait of eggplant sepals, characterized in that: The KASP primers include a first upstream primer, a second upstream primer and a downstream primer, wherein the sequence of the first upstream primer is SEQ ID NO: 2, the sequence of the second upstream primer is SEQ ID NO: 3, and the sequence of the downstream primer is SEQ ID NO:

4.

5. A kit, characterized in that: The kit is suitable for detecting the molecular markers related to the eggplant sepal covered thorn trait as claimed in claim 1 or 2; and / or detecting the primers as claimed in claim 3; and / or detecting the KASP primers as claimed in claim 4.

6. A method for identifying the thorny trait of eggplant sepals, characterized in that: include: Extracting genomic DNA from eggplant leaves, using the genomic DNA as a template, designing primers, and performing PCR amplification to obtain the product shown in SEQ ID NO: 1; analyzing or sequencing the product; When the base at the 100th bp of the SEQ ID NO: 1 is T, the eggplant has thorns, and when the base at the 100th bp of the SEQ ID NO: 1 is C, the eggplant has no thorns.

7. A method for predicting eggplant thorn coverage, characterized in that: include: Extracting genomic DNA from eggplant leaves, using the genomic DNA as a template, designing primers, and performing PCR amplification to obtain a product shown in SEQ ID NO: 1; analyzing or sequencing the product; When the base at the 100th bp of the SEQ ID NO: 1 is T, the eggplant has thorns, and when the base at the 100th bp of the SEQ ID NO: 1 is C, the eggplant has no thorns.

8. An application, characterized in that: include: The molecular marker according to claim 1 or 2; and / or the primer according to claim 3; And / or the KASP primers as claimed in claim 4; and / or the use of the kit as claimed in claim 5 in identifying eggplant sepal covered thorns and / or eggplant breeding.

Citation Information

Patent Citations

  • Molecular marker related to pericarp color under eggplant sepal coverage and application

    CN112813191A

  • KASP molecular marker related to eggplant fruit color and application of KASP molecular marker

    CN116640872A

  • CAPS molecular marker for identifying eggplant skin thorn character and application of CAPS molecular marker

    CN118222756A

  • Group of eggplant whole genome SNP molecular markers and application thereof

    CN119040503A