Primer combination of rice blast resistance gene Pijx functional marker and application thereof

Abstract

The invention discloses a primer combination of a rice blast resistance gene Pijx functional marker as well as a kit and application of the primer combination. The primer combination as well as the kit and the method thereof disclosed by the invention can be used for cultivating rice blast resistant rice varieties. The invention provides a primer combination and a kit for detecting the functional marker of the rice blast-resistant gene Pijx or the rice blast-sensitive gene Pijx, and the genotype of the rice blast-resistant gene Pijx or the rice blast-sensitive gene Pijx in a sample can be quickly determined through simple PCR (Polymerase Chain Reaction) detection. The functional marker is high in specificity, high in amplification efficiency, simple in operation step, free of false positive amplification, high in detection efficiency, low in cost and high in practical value, the functional marker primer combination and the kit can rapidly and accurately distinguish the genotype of the rice blast resistance gene Pijx or the rice blast susceptible gene Pijx, a large amount of tedious phenotype identification is avoided, the cost is saved, and the method is suitable for popularization and application. The breeding process of the rice blast-resistant rice variety is accelerated.

Description

Technical Field

[0001] The present invention belongs to the field of crop molecular breeding, and particularly relates to a primer combination for a functional marker of the rice blast resistance gene Pijx and its application. Background Art

[0002] Rice blast is one of the three major diseases endangering the safe production of rice. In recent years, the continuous outbreak of rice blast has brought great harm to the safe production of rice. Utilizing blast resistance genes and breeding blast-resistant rice varieties is the most effective method to solve such diseases.

[0003] Conventional methods for breeding blast-resistant rice require a large amount of phenotypic identification work for rice blast, which is time-consuming, laborious, unstable, and inefficient, greatly limiting the application of excellent blast resistance genes. Molecular marker-assisted selection is an effective technical method to improve the breeding efficiency of blast-resistant rice, which requires scientists to develop and design efficient and accurate functional markers for blast resistance genes. Recent studies have shown that the gene Pijx has broad-spectrum resistance to rice blast. The 4007th base of the genome of the blast resistance gene Pijx is G, and the 4007th base of the genome of the blast-susceptible gene pijx is A. Developing efficient functional markers for this gene functional locus will accelerate the breeding process of blast-resistant rice. Summary of the Invention

[0004] Object of the Invention: The technical problem to be solved by the present invention is to design and develop corresponding functional markers based on the functional sequences of this gene in the blast-susceptible variety Nipponbare and the blast-resistant variety Xiushui 134, which can quickly and effectively detect the genotypes of the blast resistance gene Pijx or the blast-susceptible gene pijx.

[0005] Another technical problem to be solved by the present invention is to provide a kit for the functional marker of the rice blast resistance gene Pijx.

[0006] Another technical problem to be solved by the present invention is to provide the application of the primer combination or the described kit in identifying or screening the genotype of the rice blast gene Pijx or in breeding blast-resistant rice.

[0007] The last technical problem to be solved by the present invention is to provide a method for identifying or screening blast-resistant rice varieties.

[0008] Technical Solution: To solve the above technical problems, the primer combination for the functional marker of the rice blast resistance gene Pijx of the present invention, the primer combination includes 2 groups of primer pairs:

[0009] The first group of primer pair: upstream primer P1-F and downstream primer G2-R;

[0010] The second group of primer pair: upstream primer P1-F and downstream primer A2-R;

[0011] The sequence of the upstream primer P1-F is: TGCCTAAGGGTAAACAGT,

[0012] The sequence of the downstream primer G2-R is: CTCAGACACTGGAACCCATAAC,

[0013] The sequence of the downstream primer A2-R is: CTCAGACACTGGAACCCATAAT.

[0014] Among them, the primer combination is designed based on the 4007th base of the genomic sequence of the rice blast resistance gene Pijx.

[0015] The present invention also includes a kit for functional markers of the rice blast resistance gene Pijx, and the kit includes the above-mentioned primer combination.

[0016] Among them, the volume ratio of the upstream primer to the downstream primer in the primer pair in the kit is 1:1.

[0017] Among them, the kit also includes GC Buffer, Taq PCR Master MIX and ddH 2 O.

[0018] The present invention also includes the application of the above-mentioned primer combination or the above-mentioned kit in identifying or screening the genotype of the rice blast gene Pijx or cultivating rice blast-resistant rice breeding.

[0019] Among them, the rice blast genotypes include G or A at the 4007th site of the genomic sequence of the rice blast gene Pijx.

[0020] Among them, when the 4007th site of the genomic sequence of the rice blast gene Pijx is G, the rice is a rice blast-resistant variety, and when the 4007th site of the genomic sequence of the rice blast gene Pijx is A, the rice is a rice blast-susceptible variety.

[0021] The present invention also includes a method for identifying or screening rice blast-resistant rice varieties, comprising the following steps:

[0022] 1) Extract the genomic DNA of the rice to be detected or identified as a template, and perform PCR amplification on the above-mentioned 2 groups of primer pairs respectively;

[0023] 2) Separate the PCR products by agarose gel electrophoresis, and check the band sizes for comparison to determine the genotype;

[0024] If a 545bp band can be amplified by the upstream primer P1-F and the downstream primer G2-R, but cannot be amplified by the upstream primer P1-F and the downstream primer A2-R, then it is a rice variety resistant to rice blast.

[0025] If a 545bp band can be amplified by the upstream primer P1-F and the downstream primer A2-R, but cannot be amplified by the upstream primer P1-F and the downstream primer G2-R, then it is a rice variety susceptible to rice blast.

[0026] Among them, the rice varieties include Nipponbare, the rice blast-resistant variety Xiushui 134, Lianjing 4, Lianjing 6, Xudao 3, Huajing 6, Huaidao 5, Ningjing 4, Nanjing 46, Wuyunjing 7, Zhendao 18, Nanjing 9108, Wuyunjing 23, Jinjing 818, Jinxiangyu 2, Nanjing 5055, Huajing 5, Huaidao 8, Yangfujing 8, Ningjing 1, Nanjing 45, Zhendao 88, Zhendao 99, Suken 118, Nanjing 59, or one or more of them.

[0027] Beneficial effects: Compared with the prior art, the present invention has the following advantages: The present invention provides functional markers for detecting the rice blast resistance gene Pijx or the rice blast susceptibility gene pijx. Through simple PCR detection, the genotypes of the rice blast resistance gene Pijx (the 4007th site in the genome is G) or the rice blast susceptibility gene pijx (the 4007th site in the genome is A) in the sample can be quickly determined. This functional marker has strong specificity, high amplification efficiency, simple operation steps, no false positive amplification, high detection efficiency, low cost, and strong practical value. The primer combination and kit of this functional marker can quickly and accurately distinguish the genotypes of the rice blast resistance gene Pijx or the rice blast susceptibility gene pijx, avoiding a large number of cumbersome phenotypic identifications, saving costs, and accelerating the breeding process of rice varieties resistant to rice blast. Description of the Drawings

[0028] Figure 1 It is a comparison result diagram of the functional sequences of this gene for the rice blast susceptible variety Nipponbare and the rice blast resistant variety Xiushui 134; the 4007th site of the pijx genome of the rice blast susceptible variety Nipponbare is A, and the 4007th site of the Pijx genome of the rice blast resistant variety Xiushui 134 is G.

[0029] Figure 2PCR amplification result diagram of the 4007A / G functional site of the pijx gene without primer combination; M is DL2000 DNA Marker, from large to small are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp; 1-12 are primer pairs P1-F / G1-R, P1-F / G3-R, P1-F / G4-R, P1-F / G5-R, P1-F / G6-R, P1-F / G2-R, P1-F / A1-R, P1-F / A3-R, P1-F / A4-R, P1-F / A5-R, P1-F / A6-R, P1-F / A2-R respectively; 13-24 are primer pairs P1-F / G1-R, P1-F / G3-R, P1-F / G4-R, P1-F / G5-R, P1-F / G6-R, P1-F / G2-R, P1-F / A1-R, P1-F / A3-R, P1-F / A4-R, P1-F / A5-R, P1-F / A6-R, P1-F / A2-R respectively.

[0030] Figure 3 Sequencing peak diagram result diagram of the functional sequence site of this gene in different varieties; Nanjing 46 contains the rice blast susceptible gene pijx(4007A); Suxiu 867 contains the rice blast resistant gene Pijx(4007G).

[0031] Figure 4 PCR detection result diagram of the 4007A / G functional site of this gene in different varieties by functional markers; M is DL2000 DNA Marker, from large to small are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp; 1-24 are Lianjing 4, Lianjing 6, Xudao 3, Huajing 6, Huaidao 5, Ningjing 4, Nanjing 46, Wuyunjing 7, Zhendao 18, Nanjing 9108, Wuyunjing 23, Jinjing 818, Jinxiangyu 2, Nanjing 5055, Huajing 5, Huaidao 8, Yangfujing 8, Ningjing 1, Nanjing 45, Suxiu 867, Zhendao 88, Zhendao 99, Suken 118, Nanjing 59 respectively. Detailed implementation method

[0032] The following examples facilitate a better understanding of the present invention, but do not limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all obtained from regular biochemical reagent stores unless otherwise specified.

[0033] Example 1 Functional sequence analysis of rice blast resistant gene Pijx and development of functional markers

[0034] Based on the 4007A / G functional site of the gene pijx in the susceptible rice blast variety Nipponbare and the resistant rice blast variety Xiushui 134 in the germplasm resource bank of Jiangsu Academy of Agricultural Sciences ( Figure 1 ), molecular markers were developed, and 12 primer pairs were designed: P1-F / G1-R, P1-F / G3-R, P1-F / G4-R, P1-F / G5-R, P1-F / G6-R, P1-F / G2-R, P1-F / A1-R, P1-F / A3-R, P1-F / A4-R, P1-F / A5-R, P1-F / A6-R, P1-F / A2-R (Table 1), and some primers introduced mismatched bases.

[0035] Cut 0.5 g of leaves from Nipponbare and Xiushui 134 plants, and extract genomic DNA using the CTAB method. Using the genomic DNA of Nipponbare and Xiushui 134 as templates respectively, PCR amplification was carried out with the above 24 primer pairs. The PCR reaction system was: genomic DNA (20 ng / μL) 1.5 μL, upstream primer (2 pmol / μL) 1 μL, downstream primer (2 pmol / μL) 1 μL, GC Buffer 1.5 μL, 2×Taq PCR Master MIX (Nanjing Xibao Biotechnology Co., Ltd., product number M8066) 7.5 μL, ddH 2 O 2.5 μL. The amplification reaction was carried out on a Bio-Rad T100 PCR instrument, and the reaction conditions were: 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 30 s, 33 cycles; 72°C for extension for 5 min to end the reaction. The PCR products were separated by agarose gel electrophoresis and photographed in a gel imaging system. Analysis found that the Xiushui 134 sample containing the rice blast resistance gene Pijx could be amplified by P1-F / G2-R to produce a 545 bp band, and could not be amplified by P1-F / A2-R to produce a 545 bp band; the Nipponbare sample containing the susceptible rice blast gene pijx could be amplified by P1-F / A2-R to produce a 545 bp band, and could not be amplified by P1-F / G2-R to produce a 545 bp band ( Figure 2 ).

[0036] Table 1 Development of functional markers (lowercase letter bases represent mismatched bases, and underlined bases represent functional site bases)

[0037]

[0038] 2. Accuracy detection of Pijx functional markers

[0039] Cut 0.5 g of the leaves of Huai Rice 5, Ningjing 4, Nanjing 46, Wuyunjing 7, Zhendao 18, and Suxiu 867 plants from the germplasm resource bank of Jiangsu Academy of Agricultural Sciences, and extract genomic DNA using the CTAB method. Using the above genomic DNA as templates respectively, perform PCR amplification with the above 2 primer pairs P1-F / G2-R and P1-F / A2-R. The PCR reaction system is as follows: genomic DNA (20 ng / μL) 1.5 μL, upstream primer (2 pmol / μL) 1 μL, downstream primer (2 pmol / μL) 1 μL, GC Buffer 1.5 μL, 2×Taq PCR Master MIX (Nanjing Xibao Biotechnology Co., Ltd., product number M8066) 7.5 μL, ddH 2 O 2.5 μL. The amplification reaction is carried out on a Bio-Rad T100 PCR instrument, and the reaction conditions are: 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 30 s, 33 cycles; 72°C for extension for 5 min to end the reaction. The PCR products are separated by agarose gel electrophoresis and photographed in a gel imaging system. Analysis found that Huai Rice 5, Ningjing 4, Nanjing 46, Wuyunjing 7, Zhendao 18, and Suxiu 867 contain the blast-susceptible genotype pijx(4007A), and Suxiu 867 contains the blast-resistant genotype Pijx(4007G)( Figure 4 ).

[0040] At the same time, using the above genomic DNA as templates, perform PCR amplification with a sequencing primer pair (PIJX1-F: ACTTAGTCACGTCCCTCT, PIJX1-R: CTCTTCTTCATCCCATCT; the PCR fragment size is 641 bp). The amplification reaction is carried out on a Bio-Rad T100 PCR instrument: 95°C for 5 min; 98°C for 10 sec, 55°C for 30 sec, 68°C for 1 min, 33 cycles; 68°C for 5 min. After recovering and purifying the PCR products, they are ligated to peasy-Blunt (TransGen Biotech Co., Ltd.), transformed into Escherichia coli Trans10 competent cells (TransGen Biotech Co., Ltd.), and after selecting positive clones, sequencing is performed. The sequence determination results show that Huai Rice 5, Ningjing 4, Nanjing 46, Wuyunjing 7, Zhendao 18, and Suxiu 867 contain the blast-susceptible genotype pijx(4007A), and Suxiu 867 contains the blast-resistant genotype Pijx(4007G)( Figure 3 , taking the sequencing peak maps of Nanjing 46 and Suxiu 867 as representatives), which is completely consistent with the above functional marker detection results, indicating that the accuracy of this functional marker is extremely high.

[0041] 3. Application of the Pijx Functional Marker in Rice Breeding

[0042] Using the Pijx functional marker developed above to detect the genotypes of the blast resistance gene Pijx in 24 rice varieties, the results analysis found that Lianjing 4, Lianjing 6, Xudao 3, Huajing 6, Huaidao 5, Ningjing 4, Nanjing 46, Wuyunjing 7, Zhendao 18, Nanjing 9108, Wuyunjing 23, Jinjing 818, Jinxiangyu 2, Nanjing 5055, Huajing 5, Huaidao 8, Yangfujing 8, Ningjing 1, Nanjing 45, Zhendao 88, Zhendao 99, Suken 118, and Nanjing 59 contain the blast-susceptible genotype pijx(4007A), and Suxiu 867 contains the blast-resistant genotype Pijx(4007G). This indicates that this functional marker can quickly and accurately screen and identify the genotypes of the blast resistance gene Pijx, thereby improving the efficiency of blast resistance breeding.

Claims

1. A primer combination for functional marker of rice blast resistance gene Pijx, characterized in that: The primer combination includes 2 sets of primer pair combinations: The first set of primer pairs: upstream primer P1-F and downstream primer G2-R; The second set of primer pairs: upstream primer P1-F and downstream primer A2-R; The sequence of the upstream primer P1-F is: TGCCTAAGGGTAAACAGT, The sequence of the downstream primer G2-R is: CTCAGACACTGGAACCCATAAC, The sequence of the downstream primer A2-R is: CTCAGACACTGGAACCCATAAT.

2. The primer combination for functional marker of rice blast resistance gene Pijx according to claim 1, characterized in that: The primer combination is designed for the 4007th base of the rice blast resistance gene Pijx genome.

3. A kit for functionally marking the rice blast resistance gene Pijx, characterized in that: The kit comprises the primer combination according to claim 1 or 2.

4. The kit according to claim 3, characterized in that The volume ratio of the upstream primer to the downstream primer in the primer pair in the kit is 1:

1.

5. The kit according to claim 4, characterized in that The kit also includes GC Buffer, Taq PCRMaster MIX and ddH2O.

6. Use of the primer combination according to claim 1 or 2 or the kit according to any one of claims 3 to 5 in identifying or screening the genotype of the rice blast gene Pijx or breeding rice blast-resistant rice.

7. The use according to claim 6, characterized in that: The rice blast genotype includes that the 4007th position of the rice blast gene Pijx in the genome is G or A.

8. The use according to claim 6, characterized in that: When the 4007th genome position of the rice blast gene Pijx is G, the rice is a rice variety resistant to rice blast; when the 4007th genome position of the rice blast gene Pijx is A, the rice is a rice variety susceptible to rice blast.

9. A method for identifying or screening rice varieties resistant to rice blast, characterized in that: The following steps are involved: 1) extracting genomic DNA of rice to be detected or identified as a template, and performing PCR amplification using the two sets of primer pairs described in claim 1 respectively; 2) PCR products were separated by agarose gel electrophoresis, and the band sizes were compared to determine the genotype; If the upstream primer P1-F and the downstream primer G2-R can amplify a 545bp band, but the upstream primer P1-F and the downstream primer A2-R cannot amplify a 545bp band, then it is a rice variety resistant to rice blast. If a 545bp band can be amplified by the upstream primer P1-F and the downstream primer A2-R, but a 545bp band cannot be amplified by the upstream primer P1-F and the downstream primer G2-R, then it is a rice variety susceptible to rice blast.

10. The method for identifying or screening rice varieties resistant to rice blast according to claim 9, characterized in that: The rice varieties include one or more of Nipponbare, rice blast-resistant varieties Xiushui 134, Lianjing 4, Lianjing 6, Xudao 3, Huajing 6, Huaidao 5, Ningjing 4, Nanjing 46, Wuyunjing 7, Zhendao 18, Nanjing 9108, Wuyunjing 23, Jinjing 818, Jinxiangyu 2, Nanjing 5055, Huajing 5, Huaidao 8, Yangfujing 8, Ningjing 1, Nanjing 45, Zhendao 88, Zhendao 99, Suken 118, and Nanjing 59.

Images