KASP molecular marker and primer for identifying germplasm of yellow-hair strawberry and application of KASP molecular marker and primer

By developing a technology based on KASP molecular marker, using specific primers and fluorescence detection to identify SNP sites in the strawberry genome, the problem of identification of yellow-haired strawberry germplasm resources is solved, and rapid and stable identification and distinction is achieved, which is suitable for a variety of application scenarios.

CN120138211AActive Publication Date: 2025-06-13SHENYANG AGRI UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510426872.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-07
Publication Date
2025-06-13
Estimated Expiration
2045-04-07

AI Technical Summary

Technical Problem

It is difficult for the prior art to effectively distinguish and identify yellow-haired strawberry germplasm resources, especially when their morphological trait variations are abundant and their distribution range is wide.

Method used

A technology based on KASP molecular marker was developed to identify SNP sites in the strawberry genome, especially SNP sites (A or G) at position 101 (A or G) through specific primers and fluorescence detection to identify yellow-haired strawberries.

Benefits of technology

This technology can quickly and stably screen and identify yellow-haired strawberry germplasm resources, significantly distinguish yellow-haired strawberries from other varieties of strawberries, and is not restricted by plant growth status, environment and gene expression. It is suitable for variety identification, genetic diversity assessment and breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138211A_ABST
    Figure CN120138211A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of germplasm resource identification, and particularly relates to a KASP molecular marker and primer for identifying the germplasm of strawberries and application of the KASP molecular marker and primer. The invention provides a fragaria nilgerrensis KASP molecular marker developed based on whole genome re-sequencing and SNP technology and application thereof, the KASP molecular marker can rapidly and stably screen and identify germplasm resources of fragaria nilgerrensis and significantly distinguish germplasm resources of fragaria nilgerrensis from germplasm resources of other varieties of strawberries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of strawberry germplasm resource identification, and more specifically, relates to KASP molecular markers, primers for identifying the germplasm of Fragaria nilgerrensis Schlecht., and their applications. Background Art

[0002] Fragaria nilgerrensis Schlecht. is a perennial herbaceous plant of the genus Fragaria in the Rosaceae family and is widely distributed in China. There are large variations in aspects such as fruit size, quality, fragrance, leaves, and stolons, showing extensive genetic diversity.

[0003] SNP mainly refers to DNA sequence polymorphism caused by single nucleotide variations at the genomic level. Base differences are the smallest structural units of genetic variations in the genome, directly resulting in differences in genetic materials. Detecting such differences using SNP molecular markers can help distinguish different varieties and study the relationships between varieties. The KASP technology is based on the principles of allele-specific primer extension and fluorescence detection, can specifically identify different alleles of target genes, reduce the possibility of non-specific amplification and misjudgment, and has high accuracy in genotyping results; the experimental process is relatively standardized and simplified, requires a short time, and has strong repeatability.

[0004] In the current field of plant genetic breeding, traditional germplasm resource identification methods mainly rely on morphological trait investigations. However, there are rich wild strawberry resources in China, and the distribution areas of different wild species overlap, making it difficult to distinguish these resource species. Moreover, Fragaria nilgerrensis Schlecht. itself has a wide distribution range and rich morphological trait variations. Some wild strawberry resources are difficult to distinguish morphologically, and the phenotypic traits of plants will vary due to the influence of ecological environmental conditions, affecting the results of their genetic analysis. Therefore, it is particularly important to screen out molecular markers that can identify Fragaria nilgerrensis Schlecht. Summary of the Invention

[0005] The purpose of the present invention is to provide KASP molecular markers, primers for identifying the germplasm of Fragaria nilgerrensis Schlecht., and their applications to solve the above technical problems.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The present invention provides a KASP molecular marker for identifying Fragaria nilgerrensis Schlecht., and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1. The 101st position of this sequence is the SNP site, and the polymorphism is A or G. Strawberries with the GG genotype at this site are Fragaria nilgerrensis Schlecht.

[0008] The present invention provides a core KASP molecular marker developed based on SNP technology for the identification of Rubus xanthocarpus germplasm resources. It can quickly and stably screen and identify Rubus xanthocarpus germplasm resources, significantly distinguish Rubus xanthocarpus resources, and is not restricted by the growth status of plants, environment, and gene expression. Identification can be carried out at any stage of plant growth. It can be applied to variety identification, genetic diversity assessment, trait association analysis, and molecular marker-assisted selection breeding of Rubus xanthocarpus, providing support for genetic diversity analysis, variety identification, and molecular-assisted breeding of Rubus xanthocarpus.

[0009] The present invention also provides a specific primer for amplifying the above-mentioned KASP marker, and the primer includes upstream primers shown in SEQ ID NO.2 and SEQ ID NO.3, and a downstream primer shown in SEQ ID NO.4.

[0010] The present invention also provides a kit for identifying Rubus xanthocarpus, and the kit includes the above-mentioned primer group, as well as a PCR reaction buffer and a fluorescent probe.

[0011] Further, the kit also includes 2x Taq DNA Polymerase Mix.

[0012] The present invention also provides the application of the above-mentioned KASP marker, primer group, or kit in the identification of Rubus xanthocarpus.

[0013] The present invention also provides the application of the above-mentioned KASP marker, specific primer, or kit in the breeding of Rubus xanthocarpus or in assisting the breeding of Rubus xanthocarpus.

[0014] The present invention also provides a detection method for identifying Rubus xanthocarpus, including the following steps:

[0015] (1) Extract the genomic DNA of the strawberry to be tested;

[0016] (2) Using the extracted DNA as a template, amplify with the above-mentioned specific primer to obtain an amplification product;

[0017] (3) Identify the genotype at the 101st position of the amplification product, and judge whether the strawberry to be tested is Rubus xanthocarpus according to the genotype.

[0018] Further, the method of judgment is: when the genotype locus at the 101st position of the amplification product is the GG genotype, judge that the strawberry to be tested is Rubus xanthocarpus.

[0019] The present invention has the following beneficial effects:

[0020] The present invention provides a Fragaria nilgerrensis KASP molecular marker developed based on whole-genome resequencing and SNP technology, and its application. This KASP molecular marker can quickly and stably screen and identify Fragaria nilgerrensis germplasm resources, and significantly distinguish Fragaria nilgerrensis from germplasm resources of other strawberry varieties. Description of the Drawings

[0021] Figure 1 It is a KASP marker genotyping map. Detailed Embodiments

[0022] The present invention will be described in detail below with reference to specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0023] Example 1: Development of Fragaria nilgerrensis KASP molecular marker.

[0024] 1. Genome-wide association analysis of wild strawberry natural population: Using wild strawberry germplasm materials as the natural population, the genomic DNA of wild strawberries was extracted by the CTAB method. Whole-genome resequencing was performed on 61 wild strawberries. Combining with the previous phenotypic data, genome-wide association analysis was carried out, and a total of 830,537 SNP markers were obtained.

[0025] 2. Screening of KASP molecular markers: The SNP markers and the phenotypic survey data of wild strawberry germplasm resources were used. Through the MLM(QK) model in the gemma software, the population structure matrix corresponding to the optimal K value of Admixture was used as the Q matrix of the corresponding model, and the kinship matrix between samples calculated by the gcta software was used as the K matrix of the corresponding model for correlation analysis. Sequences evaluated as qualified were selected to develop KASP molecular markers. The primer sequences of the KASP molecular markers are shown in Table 1, and the PCR amplification system and reaction program are shown in Tables 2 and 3. The product result is shown in SEQ ID NO.1.

[0026] SEQ ID NO.1: TTCTCCGGCTTGAACCCGTTCATCACCGTCTCGGCCA GCCCGGCTTGCTTTCTTTCAGCGTTTTGAGCAAACCCCTCCATTGTTGGGGTGAGGTTCTTGGMCGCCGAGGCCTCCGACCATGGCTCGCCGAAGACTTGCTCGTAGACGTCTTGGATGGAGTGGCCGGGGTCAGGGTCGACGTAGGCGGAGTTGTCAGCGAAG.

[0027] Table 1: Primer Sequences of KASP Molecular Markers

[0028] Primer Sequence 5′-3′ SEQ ID NO. F1 GAAGGTCGGAGTCAACGGATTTTGGGGTGAGGTTCTTGGA 2 F2 GAAGGTGACCAAGTTCATGCTTGGGGTGAGGTTCTTGGG 3 R AAGTCTTCGGCGAGCCAT 4

[0029] Table 2: PCR Reaction System

[0030] Name Addition amount 2x Taq DNA Polymerase Mix 2 μL SNP Primer Mix(4x) 1 μL DNA sample 2 μL

[0031] 2x Taq DNA Polymerase Mix was purchased from Nanjing Novoprotein Science and Technology Co., Ltd., and the product number is P222.

[0032] Table 3: PCR Amplification System

[0033]

[0034] 3. Genotype data acquisition: After the PCR amplification cycle is completed, the fluorescence value is read using a fluorescence quantitative PCR instrument in an environment below 40°C. The genotyping results are as Figure 1 shown. The genotypes of 49 materials are AA, and the genotypes of 13 materials are GG.

[0035] 4. Verification of KASP molecular marker genotyping: The KASP molecular marker was used for genotyping verification on different diploid wild strawberry resources. The detection results are shown in Table 4. The KASP molecular marker of the present invention can significantly distinguish 11 Fragaria nilgerrensis from other wild strawberries.

[0036] Table 4: Verification Results of KASP Molecular Marker Genotyping

[0037]

[0038]

[0039]

[0040] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0041] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0042] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. KASP molecular markers for identifying yellow-haired strawberry germplasm, characterized in that: The molecular marker nucleotide sequence is shown in SEQ ID NO.

1. The A at position 101 of the sequence is a SNP site, and the polymorphism is A or G. The strawberry with the GG type at this site is a yellow-haired strawberry.

2. A specific primer for amplifying the KASP marker according to claim 1, characterized in that: The primers include upstream primers as shown in SEQ ID NO.2 and SEQ ID NO.3, and downstream primers as shown in SEQ ID NO.

4.

3. A kit for identifying yellow-haired strawberry, characterized in that: The kit comprises the specific primer according to claim 2.

4. The kit according to claim 3, characterized in that The kit also includes 2xTaq DNA Polymerase Mix.

5. Use of the KASP marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in identifying yellow-haired strawberry.

6. Use of the KASP marker according to claim 1, the specific primer according to claim 2 or the kit according to claim 3 in yellow-haired strawberry breeding or assisted yellow-haired strawberry breeding.

7. A method for identifying yellow-haired strawberry, characterized in that: The following steps are involved: (1) extracting genomic DNA of the strawberry to be tested; (2) using the extracted DNA as a template and performing amplification using the specific primers described in claim 2 to obtain an amplified product; (3) identifying the genotype of the 101st position of the amplified product, and determining whether the strawberry to be tested is a yellow-haired strawberry according to the genotype.

8. The method for identifying yellow-haired strawberry according to claim 7, characterized in that: The determination method is as follows: when the genotype site at the 101st position of the amplified product is the GG genotype, the strawberry to be tested is determined to be the yellow-haired strawberry.

Citation Information

Patent Citations

  • KASP molecular marker group for identifying five-leaf strawberries and application of KASP molecular marker group

    CN116875728A

  • KASP molecular marker primer group for identifying five-leaf strawberries and application of KASP molecular marker primer group

    CN117025820A

  • Broccoli KASP molecular marker, primer group and application of Broccoli KASP molecular marker and primer group

    CN117187434A

  • SNP (Single Nucleotide Polymorphism) marker combination for identifying strawberry germplasm resources and application of SNP marker combination

    CN119351599A

  • Rotating cosmetic container with matching magnet

    KR102616181B1