Nucleic acid multiple detection micro-fluidic chip and detection method thereof
By setting exhaust channels, waterproof and breathable membranes and valve blocks in the reaction chamber and detection chamber of the microfluidic chip, combined with the principle of atmospheric pressure balance, the problem of complex structure and cumbersome operation in the nucleic acid multiple detection in the prior art is solved, and the efficient, convenient and low-cost nucleic acid multiple detection effect is achieved.
Patent Information
- Application Number
- CN202311719955.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-06-17
AI Technical Summary
When implementing multiple nucleic acid detection, existing microfluidic chips have complex structures, cumbersome operations, high costs, and are difficult to effectively use in environments with limited resources.
By setting exhaust passages and waterproof and breathable membranes in the reaction chamber and the detection chamber respectively, and adding a valve block between the reaction chamber and the detection chamber, the temperature-raising phase change performance of the valve block and the characteristics of the waterproof and breathable membrane are used, combined with the principle of internal and external balance of atmospheric pressure, the controllable transfer of the sample to be tested is achieved and the sample is prevented from flowing back.
It realizes the simplicity, convenience, low cost and high efficiency of nucleic acid multiple detection, and is suitable for use in more simple detection environments, reducing reagent consumption, and improving detection sensitivity and specificity.
Smart Images

Figure CN120158355A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microfluidic control, and in particular to a nucleic acid multiple detection microfluidic chip and a detection method thereof. Background Art
[0002] Microfluidic chip technology can integrate complex liquid flow operations on a tiny chip of a few square centimeters. The microchannel structure makes the liquid flow controllable, and the sample detection process is concentrated on the tiny chip, which can greatly reduce the requirements for the site, personnel and equipment of the detection process. With the continuous maturity of design and preparation technology, microfluidic chips can not only integrate multiple biochemical detection reactions, but also integrate multiple nucleic acid detection processes such as nucleic acid extraction, reaction detection and result interpretation. Therefore, it has great potential in the field of nucleic acid sample detection.
[0003] Isothermal amplification has gained increasing attention in the field of instant testing due to its fast reaction speed and low requirements for instruments and equipment. However, due to the complexity of the samples to be tested, such as blood, sputum, urine, tissue, etc., it is usually necessary to react with detection reagents to amplify the signal after isothermal amplification to achieve accurate detection, which is called nucleic acid multiplex detection. Nucleic acid multiplex detection requires the sample to be tested to be controllably transferred in multiple reaction chambers, and can prevent cross-influence caused by sample reflux. Most existing microfluidic chips only have one reaction chamber for nucleic acid amplification and detection, which makes it difficult to achieve nucleic acid multiplex detection.
[0004] At the same time, existing microfluidic chips generally require external pressure devices, centrifugal force, and siphon action as driving forces. The use of external pressure devices, such as negative pressure vacuum pumps, injection pumps, etc., has a strong driving force, but needs to be externally connected to the chip, making the detection platform structure complex. Using centrifugal force as a drive has the problem of dependence on electricity and centrifugal equipment. Although the liquid flow drive method of siphon action does not require equipment, the driving force is small, and there is a problem of volatilization during the sampling process. In order to realize multiple nucleic acid detection, there is currently also a method of controlling multiple detections through an external pressure supply device, and its operation process is complicated and has high requirements. For example, the patent with publication number CN113736643 provides a microfluidic chip that can realize multiple nucleic acid detection, but it needs to provide an external pressure supply device for sampling, and a hydrophobic valve and a membrane valve need to be specially arranged between the reaction amplification chamber and the detection chamber. When the external pressure provides positive pressure, the membrane valve and the hydrophobic valve are closed, and when the positive pressure is released, the membrane valve and the hydrophobic valve are opened. At the same time, an electromagnetic valve is required to control the external pressure supply device. In addition, the microfluidic chip has a complex structure and high cost, which greatly limits the use of microfluidic chips in resource-limited environments.
[0005] Therefore, there is an urgent need to find a nucleic acid multiplex detection microfluidic chip with a simpler structure, more convenient operation, lower instrument requirements, low cost, and integration. Summary of the invention
[0006] To solve the above problems, the present invention provides a nucleic acid multiplex detection microfluidic chip and its detection method. By respectively arranging an exhaust channel and a waterproof and breathable membrane in the reaction chamber and the detection chamber, and adding a valve block between the reaction chamber and the detection chamber, using the temperature-induced phase change performance of the valve block and the characteristics of the waterproof and breathable membrane, combined with the principle of internal and external atmospheric pressure balance, the controllable transfer of the sample to be tested in different chambers is cleverly realized, and the backflow of the sample can be effectively prevented. The positional relationship and shape of each flow channel between the reaction chamber and the detection chamber are designed and improved, and a simple pressure application device is added to enable the sample to be tested to smoothly enter or exit the corresponding chamber and stably remain and react in the chamber. The microfluidic chip has a simple structure, a small volume, and convenient operation, adapts to more simple detection environments, truly achieves low-cost integration, and is suitable for large-scale production applications.
[0007] On the one hand, the present invention provides a microfluidic chip, and the microfluidic chip includes a reaction chamber for sample pretreatment and a detection chamber for detecting the sample;
[0008] The reaction chamber is provided with a first exhaust channel, and a first waterproof and breathable membrane is provided at the outlet of the first exhaust channel for controlling the communication state between the reaction chamber and the outside atmosphere;
[0009] The detection chamber is provided with a second exhaust channel, and a second waterproof and breathable membrane is provided at the outlet of the second exhaust channel for controlling the communication state between the detection chamber and the outside atmosphere;
[0010] A valve block is provided between the reaction chamber and the detection chamber for controlling the fluid communication state between the reaction chamber and the detection chamber.
[0011] The microfluidic chip provided by the present invention is provided with multiple groups of detection units. Each group of detection units is arranged in multiple levels on the chip body. Each group of detection units is provided with a reaction chamber and a detection chamber, and can be suitable for the simultaneous detection of multiple different target analytes to be tested, such as the detection of multiple different nucleic acid targets, and each group of detection units can achieve nucleic acid multiplex detection. Of course, it can be understood that the microfluidic chip of the present application is not only used for nucleic acid multiplex detection, but also applicable to the detection of other types of molecules such as proteins and antibodies. The reaction chamber can be used for sample pretreatment, and the detection chamber is used for sample detection.
[0012] During the use of the microfluidic chip, it needs to be kept in a vertical state with the inlet facing up. In some ways, the microfluidic chip can be inserted into a supporting detection device to keep the microfluidic chip vertically placed with the inlet facing up, and the detection device can provide a heat source to heat specific positions of the microfluidic chip (such as the reaction chamber, the valve block, etc.); in some ways, the detection device can also detect the fluorescent substances generated after the reaction of the sample in the microfluidic chip and read the detection results.
[0013] Furthermore, the valve block has two forms: solid state and liquid state; when the valve block is in the solid state, the reaction chamber and the detection chamber cannot be in fluid communication; when the valve block is in the liquid state, the detection chamber is in fluid communication with the reaction chamber.
[0014] In existing nucleic acid multiplex detection microfluidic chips, multiple valves usually need to be set. For example, after controlling the test sample to enter the detection chamber from the reaction chamber, the valve needs to be closed to prevent the sample from flowing back. Even in some cases, a valve needs to be set in front of the reaction chamber, and the valve also needs to be closed after the test sample enters the reaction chamber to prevent the sample from flowing back.
[0015] The microfluidic chip provided by the present invention, by respectively arranging exhaust channels in the reaction chamber and the detection chamber, and at the same time providing a valve block between the reaction chamber and the detection chamber, utilizing the temperature-rising phase change performance of the valve block, and combining with the principle of internal and external pressure balance of the atmospheric pressure, can ensure that after the test sample enters the corresponding chamber, it can be stably retained in the chamber, without backflow phenomenon and without flowing into other chambers, so as to ensure that each step of the reaction can be successfully completed until accurate detection is finally achieved.
[0016] The setting of the first waterproof and breathable membrane and the second waterproof and breathable membrane can discharge the gas in the reaction chamber or the detection chamber, but the liquid cannot pass through. When the exhaust channel is filled with liquid, the waterproof and breathable membrane will lose its breathable function, so that the whole system is in a closed state and the liquid in the system stops flowing. Therefore, the waterproof and breathable membrane can help the sample in the reaction chamber or the detection chamber establish internal and external pressure balance, can regulate the liquid flow direction, and prevent the sample in the reaction chamber or the detection chamber from flowing back. In some embodiments, the waterproof and breathable membrane is prepared from a polymer material.
[0017] The flow process of the test sample in the microfluidic chip mainly has two steps: the first step, the test sample enters the reaction chamber for reaction; the second step, after the reaction is completed, the test sample flows out of the reaction chamber and enters the detection chamber for reaction and detection.
[0018] In the first step, the process of the sample entering the reaction chamber is also the process of the gas in the reaction chamber being discharged outward through the first exhaust channel. When the sample has completely entered the reaction chamber (blocked by the valve block and unable to enter the detection chamber), all the excess gas in the reaction chamber is also discharged. At this time, two situations will occur. One is that the sample fills the reaction chamber and also enters the first exhaust channel and contacts the waterproof breathable membrane, causing the first waterproof breathable membrane to lose its breathable function, and the entire system is in a closed state, and the liquid in the reaction chamber will not show a backflow state. The other is that the sample is all in the reaction chamber, does not enter the first exhaust channel, or partially enters the exhaust channel but does not contact the waterproof breathable membrane, and the waterproof breathable membrane can still ventilate, that is, only the first exhaust channel of the entire microfluidic chip is connected to the atmosphere, and the rest are in a sealed state, achieving pressure balance inside and outside. The sample in the reaction chamber cannot flow to other areas because flowing out of the reaction chamber will inevitably require a large pressure to break the established internal and external pressure balance. Therefore, all the samples will remain in the reaction chamber for reaction.
[0019] In the second step, after the sample has completed the reaction in the reaction chamber, the valve block is heated and melted, and the flow channel between the reaction chamber and the detection chamber is connected. Since the detection chamber is provided with a second exhaust channel, the initial pressure balance is broken, and the sample flows out of the reaction chamber and enters the detection chamber. At this time, the melted valve block has a lower density. After flowing into the detection chamber together with the sample to be measured, it will condense near the second exhaust channel and block the second exhaust channel (since the sample is quantitative, at least it can reach near the exhaust port of the detection chamber, but it is difficult to ensure that it can fill the exhaust channel). At this time, two situations will also occur. One is that the liquid in the first exhaust channel has flowed away, so there is only the first exhaust channel connected to the atmosphere, and the rest are in a sealed state, and the pressure balance is also achieved in the detection chamber, making the sample in the detection chamber unable to flow out of the detection chamber anymore and all remaining in the detection chamber for reaction and detection. The other is that there is still liquid in the first exhaust channel. At this time, the entire system is in a closed state, and the liquid in the detection chamber will not show a backflow state.
[0020] It can be seen that the valve block can serve multiple purposes in the present invention, such as controlling the connection state between the reaction chamber and the detection chamber, controlling the connection state among the reaction chamber, the detection chamber, and the atmosphere, controlling the connection state between the detection chamber and the atmosphere, preventing the sample from flowing out of the detection chamber, and so on.
[0021] Furthermore, when the valve block is in a solid state, it is located in the flow channel connecting the reaction chamber and the detection chamber to prevent the sample to be measured in the reaction chamber from flowing into the detection chamber; when the valve block is in a liquid state, it will flow to the second exhaust channel of the detection chamber to prevent the liquid in the detection chamber from flowing back.
[0022] In some embodiments, the valve block is located on the sample outlet flow channel of the reaction chamber or the sample inlet flow channel of the detection chamber.
[0023] In some embodiments, the sample outlet channel of the reaction chamber and the sample inlet channel of the detection chamber are fluidically connected, and the valve block is located at a connecting or crossing position between the sample outlet channel of the reaction chamber and the sample inlet channel of the detection chamber.
[0024] In some embodiments, a cavity for placing a valve block is provided at the intersection of the sample outlet channel of the reaction chamber and the sample inlet channel of the detection chamber, and the valve block in a solid state is fixed in the cavity, thereby isolating the sample outlet channel of the reaction chamber and the sample inlet channel of the detection chamber.
[0025] Furthermore, the valve block is paraffin or lipid material, which is solid at room temperature and melts into liquid after heating; the density of the valve block is less than that of water.
[0026] The lipid substances include n-hexadecane, n-octadecane, paraffin, stearic acid, palmitic acid and the like.
[0027] The density of the valve block is less than that of water, so that after the valve block is converted into liquid, it can always float above the sample to be tested, which helps to condense at the exhaust port at the top of the detection chamber.
[0028] If the density of the valve block is greater than that of water, when the valve block turns into liquid and flows into the detection chamber together with the sample, it is easy to accumulate at the injection port of the detection chamber, causing the injection port to be blocked. Therefore, the density of the valve block must be less than that of water.
[0029] In some embodiments, the valve block is paraffin.
[0030] Paraffin wax can achieve phase change at a certain temperature threshold between 50 and 90°C.
[0031] Furthermore, the reaction chamber is provided with a first sample inlet and a first sample outlet, and the first sample outlet is located higher than the first sample inlet.
[0032] In the microfluidic chip, the first sample inlet and the first sample outlet of the reaction chamber are designed. The first sample inlet is located at a lower position on one side of the reaction chamber, and the first sample outlet is located at a higher position on the other side of the reaction chamber. The purpose of this design is to ensure that the sample can smoothly enter the reaction chamber, and during the reaction process, it is easier to stay in the reaction chamber, not easy to return to the main flow channel, and not easy to flow into the branch flow channel from the sample outlet. When a specific volume of the sample to be tested is added from the sample addition area, through the pressure provided during the process of tightening the bottle cap to seal, it can prompt the sample to enter the reaction chambers of each detection unit from the main flow channel. The first sample inlet of the reaction chamber is at a low position, which can enable the sample to quickly flow into the reaction chamber and gradually fill it. However, at this time, the sample will not flow out of the reaction chamber from the first sample outlet because the first sample outlet is at the top of the reaction chamber. Unless the sample is very much and completely fills the reaction chamber, there will be an overflow situation. Otherwise, the sample will be stably retained in the reaction chamber. Moreover, since the sample outlet is connected to the exhaust port, if the sample enters the first exhaust channel and causes the waterproof breathable membrane to be unable to breathe, the sample will stop flowing and stay in the reaction chamber for reaction. Even if the sample volume does not fill the reaction chamber and fails to enter the first exhaust channel, due to the internal closure of the microfluidic chip, a pressure balance state is reached, making it difficult for the sample to return to the main flow channel from the sample inlet under the state of internal and external pressure balance, so it will always stay in the reaction chamber for reaction.
[0033] Further, the first sample inlet is located at the lower position of the reaction chamber and is in fluid communication with the first sample inlet channel.
[0034] Further, the microfluidic chip further includes a main flow channel. The first sample inlet channel is in fluid communication with the first branch port of the main flow channel. The first sample inlet channel is an upwardly arched arc-shaped channel. The first sample inlet and the first branch port are respectively located at the low points on both sides of the arc-shaped channel. The first branch port is in communication with the main flow channel.
[0035] The sample to be tested needs to flow into the reaction chamber through the first sample inlet channel. Therefore, the shape design of the first sample inlet channel also plays a very crucial role. When using an upwardly arched arc-shaped channel, the sample needs to overcome a certain pressure to enter the reaction chamber, and it is also significantly more difficult to return from the reaction chamber to the main flow channel. Moreover, because the process of the sample entering the reaction chamber is also the process of the gas in the reaction chamber discharging outward. After the sample completely enters the reaction chamber, the excess gas in the reaction chamber is also completely discharged, and the sample inlet is completely covered by the sample in the reaction chamber, and the internal and external reach pressure balance. At this time, the sample in the reaction chamber cannot return to the main flow channel from the upwardly arched arc-shaped channel anymore because returning requires overcoming the pressure brought by the upwardly arched arc-shaped channel and also requires a relatively large pressure to break the established internal and external pressure balance. Therefore, all the samples will stay in the reaction chamber for reaction. In addition, if the sample can directly fill the first exhaust channel and make the first waterproof breathable membrane no longer breathable, and the system is completely closed, the sample will also directly stop flowing.
[0036] Further, the first sample outlet is located at the upper position of the reaction chamber and is connected to the first sample flow channel. The first sample flow channel is an upwardly arched arcuate flow channel, and the first sample outlet is located at the lower point on one side of the arcuate flow channel; the first exhaust channel is in fluid communication with the first sample flow channel.
[0037] After the test sample completes the reaction in the reaction chamber, it needs to flow out from the first sample flow channel and into the detection chamber. However, before the reaction in the reaction chamber is completed, it is not desired for the sample to easily enter the first sample flow channel. Therefore, the shape design of the first sample flow channel also plays a crucial role. When the first sample flow channel adopts an upwardly arched arcuate flow channel, it makes it more difficult for the sample to flow out of the reaction chamber, and a greater pressure needs to be overcome to enter the detection chamber.
[0038] In some embodiments, the cross-section of the reaction chamber is circular.
[0039] The cross-sectional shape of the reaction chamber is set to be circular, so that there are no dead corners during the reaction and discharge process of the test sample in the reaction chamber, and it is not easy to leave residues during the inflow and outflow processes.
[0040] Further, the reaction chamber is used for target nucleic acid amplification, and a nucleic acid amplification reagent is disposed in the reaction chamber.
[0041] It can be understood that the solid reagents disposed in the reaction chamber and the detection chamber can be flexibly set according to needs. Different reaction reagents are disposed in different chambers. For example, different amplification primers for different targets are disposed in the reaction chamber and different detection probes are disposed in the detection chamber, so as to achieve multiplex detection of nucleic acids.
[0042] In some embodiments, the reaction chamber can be used as an ERA amplification chamber, and the detection chamber can be used as an ERA detection chamber.
[0043] In some embodiments, the reaction chamber can be used as an ERA reaction chamber, and the detection chamber can be used as a CRISPR detection chamber.
[0044] In some embodiments, the reaction chamber can be used as an ERA reaction chamber, and the detection chamber can be used as an Ago detection chamber.
[0045] In some embodiments, the reaction chamber can be used as an ERA reaction chamber, and the detection chamber can be used as an RNase H detection chamber.
[0046] In some ways, the microfluidic chip is used for multiplex detection of (DNA and / or RNA) nucleic acids. The reaction chamber is used for nucleic acid amplification, and nucleic acid amplification reagents need to be pre-placed in the reaction chamber. The nucleic acid amplification reagents are solid amplification reagents obtained by freeze-drying or drying. The nucleic acid amplification reagents are common temperature-variable or isothermal nucleic acid amplification reagents, including but not limited to ERA (Enzymatic Recombinase Amplification), RPA (Recombinase Polymerase Amplification), LAMP (Loop-mediated Isothermal Amplification), NEAR (Nicking enzyme-Assisted Reaction), NASBA (Nuclear acid sequence-based amplification), HDA (helicase-dependent amplification), etc.
[0047] Further, the detection chamber is provided with a second sample inlet and an exhaust port, and the position of the exhaust port is higher than that of the second sample outlet.
[0048] After the sample to be tested completes a reaction beneficial to detection (such as reacting with a detection reagent to amplify a signal, etc.) in the detection chamber, the result is directly detected in the detection chamber. One side of the detection chamber is made of a transparent film, and the detection instrument can detect substances such as fluorescence generated by the reaction through the film and read the detection result.
[0049] Therefore, the detection chamber does not need a sample outlet, but an exhaust port must be additionally provided. The present invention also designs the positions of the sample inlet and the exhaust port of the detection chamber. The sample inlet is at the lower position of the detection chamber, and the exhaust port is at the upper position of the detection chamber. The purpose of this is to ensure that after the sample smoothly enters the detection chamber from the reaction chamber by overcoming a certain pressure, it can stay more stably in the detection chamber and prevent backflow.
[0050] Further, the second sample inlet is located at the lower part of the detection chamber and is connected to the first sample outlet channel through a second sample inlet channel; the exhaust port is located at the upper part of the detection chamber and is in fluid communication with the second exhaust channel.
[0051] Further, the exhaust port is located at the top of the detection chamber; a cavity for accommodating a valve block is provided between the second sample inlet channel and the first sample outlet channel for setting the valve block.
[0052] In some ways, the cross-section of the detection chamber is in the shape of a water droplet, and the exhaust port is located at the top of the water droplet.
[0053] The cross-section of the detection cavity is in the shape of a water droplet, which helps the liquid paraffin to converge upward, making it easier to condense near the exhaust hole.
[0054] In some ways, after the amplification reaction of the sample to be tested is completed in the reaction cavity, the paraffin is melted from solid to liquid by heating and enters the detection cavity together with the sample to be tested. At the same time, air is exhausted through the exhaust port. Since the density of paraffin is less than that of water, it will float above the sample to be tested and close to the exhaust port. Due to the low temperature of the sample to be tested, the paraffin will eventually condense near the exhaust port and block the exhaust port. At this time, the sample to be tested has completely entered the detection cavity from the bottom, the exhaust port is closed, and the first exhaust flow channel of the reaction cavity starts to communicate with the atmosphere due to the outflow of the liquid. Therefore, after the internal and external pressures of the sample to be tested reach equilibrium under the action of the external atmospheric pressure, all of it remains in the detection cavity and cannot flow out from the second injection flow channel anymore.
[0055] Furthermore, the detection cavity is used to detect the quantity of the amplified product of the target nucleic acid, and a detection reagent is placed inside the detection cavity.
[0056] In some ways, the microfluidic chip is used for multiplex detection of (DNA and / or RNA) nucleic acids. The detection cavity is used for fluorescence detection reaction between the amplified sample and the detection reagent. The detection reagent includes but is not limited to ERA (Enzymatic Recombinase Amplification), RPA (Recombinase Polymerase Amplification), LAMP (Loop-mediated Isothermal Amplification), NEAR (Nicking enzyme-Assisted Reaction), CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) detection system, and various probe detection systems established based on Ago, RNase H, etc.
[0057] Furthermore, the microfluidic chip further includes a pressure application area, which is located on one side of the sample addition area and is used to increase the pressure of the liquid in the reaction cavity so that the liquid in the reaction cavity flows into the detection cavity.
[0058] In some ways, the pressure application area can be in the form of a cavity filled with air inside. Pressure can be applied by pressing to further provide pressure to the sample pool, driving the liquid to transfer from the reaction cavity to the detection cavity.
[0059] In some ways, the pressing area is an airbag. In its initial state, the airbag bulges outwards. When the airbag is pressed, its volume decreases and the gas inside the airbag is discharged, so as to inject pressure into the internal flow channels of the closed microfluidic chip and drive the flow of the liquid inside the microfluidic chip.
[0060] In some ways, the pressing area is arranged at the upper left or upper right of the microfluidic chip. Since the microfluidic chip is vertically inserted into the supporting instrument, the pressing area at the upper left or upper right is more convenient for pressing; the pressing area needs to be arranged on one side of the sample loading area. Firstly, it is convenient for pressing when needed. Secondly, it can provide a greater air flow pressure.
[0061] In the present invention, the purpose of setting the pressing area is for: when the sample to be tested completes reactions such as amplification in the reaction chamber, the valve block melts, and the sample to be tested needs to enter the detection chamber completely from the reaction chamber. At this time, it is necessary to overcome certain air pressure and the pressure brought by the upward bending of the flow channel, etc. Therefore, the pressing area needs to provide sufficient pressure to drive the sample to be tested from the reaction chamber into the detection chamber. If the pressing area is set on the sample loading area or the tube cap, although it can also provide a certain pressure, due to the limited volume at the upper end of the sample loading area or the tube cap, the provided air flow pressure is very limited, and the pressing operation is inconvenient. When tightening the tube cap, it is also easy to accidentally touch the airbag on the tube cap, resulting in the premature release of the air flow from the airbag. Therefore, the pressing area needs to be set at the upper left or upper right of the microfluidic chip, and at the same time, it should reach a specific volume (specifically, it can be calculated according to the size of the microfluidic chip and the required pressure size, so as to set an airbag with a suitable volume), so as to provide a more accurate air flow pressure during the pressing process to drive the sample to be tested from the reaction chamber into the detection chamber.
[0062] Pressing the airbag in the pressing area can be manual pressing or pressing the airbag by providing a specific force through the supporting detection device.
[0063] In some ways, the pressing area can be connected to the sample pool through a shunt channel. By pressing, air flow is discharged into the microfluidic chip from the shunt channel to the sample pool.
[0064] Furthermore, the microfluidic chip further includes a sample loading area, and the sample loading area includes a sample pool and a tube cap. The sample pool is used to accommodate the sample to be tested, and the tube cap is used to seal the microfluidic chip.
[0065] The tube cap can be prepared in the form of a plug or by making the cover surface of the tube cap concave downward. When the tube cap is tightened to seal the microfluidic chip, it can provide a downward pressure to promote the sample to flow into the reaction chambers of each group of detection units respectively.
[0066] On the other hand, the present invention provides a nucleic acid detection method, which uses the microfluidic chip as described above for detection, and includes the following steps:
[0067] (1) Add the sample to be tested into the sample pool of the microfluidic chip;
[0068] (2) Vertically insert the microfluidic chip into the detection device;
[0069] (3) The sample to be tested enters the reaction chamber of the nucleic acid detection microfluidic chip from the sample loading area for nucleic acid amplification;
[0070] (4) Heat to transform the valve block from solid state to liquid state;
[0071] (5) Squeeze the pressure application area to make the sample to be tested that has completed nucleic acid amplification enter the detection chamber for reaction;
[0072] (6) Read the detection result.
[0073] In step (3), the nucleic acid amplification is isothermal amplification, and a heating device is required to provide the appropriate temperature for isothermal amplification (such as 20 - 37 °C) to the reaction chamber.
[0074] In step (4), the detection device needs to heat the valve block (paraffin) (such as 50 - 90 °C) to reach its phase change temperature and melt into a liquid.
[0075] The nucleic acid multiplex detection microfluidic chip provided by the present invention has the following beneficial effects:
[0076] 1. By respectively arranging exhaust channels and waterproof breathable membranes in the reaction chamber and the detection chamber, and adding a valve block between the reaction chamber and the detection chamber, using the temperature - rise phase - change performance of the valve block and the characteristics of the waterproof breathable membrane, combined with the principle of internal and external atmospheric pressure balance, the controllable transfer of the sample to be tested in different chambers is cleverly realized, and sample back - flow can be effectively prevented;
[0077] 2. Design and improve the positional relationship and shape of each flow channel between the reaction chamber and the detection chamber to enable the sample to be tested to smoothly enter or flow out of the corresponding chamber and stably stay and react in the chamber;
[0078] 3. Add a simple pressure application device to help drive the sample to smoothly enter the detection chamber from the reaction chamber;
[0079] 4. There is no need to use a liquid transfer device such as a pipette for sample addition, nor is it necessary to connect an external pressure supply device. Simply pressing the pressure application device on the chip can drive the liquid transfer, and there is no risk of sample back - flow;
[0080] 5. Achieve high - throughput detection of pathogens. One test can detect up to 10 or more pathogens; it can achieve "sample in - result out", effectively reducing the risks brought by improper operation and improper use, reducing reagent consumption, and having high detection sensitivity and specificity;
[0081] 6. It has a simple structure, is small in size, convenient to operate, realizes on-site multiplex instant detection of nucleic acids in the simplest way, adapts to more simple detection environments, has low-cost integration, is easy to promote, and has important practical application value and social and economic benefits for clinical diagnosis or rapid on-site screening. Description of the Drawings
[0082] Figure 1 It is the back view of the microfluidic chip in Example 1;
[0083] Figure 2 It is the front view (without the tube cap) of the microfluidic chip in Example 1;
[0084] Figure 3 It is the side view (without the tube cap) of the microfluidic chip in Example 1;
[0085] Figure 4 It is the schematic structural diagram of the detection unit of the microfluidic chip in Example 1;
[0086] Figure 5 It is the qPCR verification result diagram of various respiratory pathogen species in Example 5. Detailed Description of the Embodiments
[0087] The preferred embodiments of the present invention will be further described in detail below with reference to the accompanying drawings. It should be noted that the following embodiments are intended to facilitate the understanding of the present invention and do not limit it in any way. The raw materials and equipment used in the specific embodiments of the present invention are known products and are obtained by purchasing commercially available products.
[0088] In the description of the present invention, it should be understood that the orientation or positional relationship indicated by the terms "upper", "lower", "front", "rear", "left", "right", "vertical", "horizontal", "top", "bottom", "inner", "outer", etc. is based on the orientation or positional relationship shown in the drawings, and is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of the present invention. In addition, the terms "first", "second", etc. are only used for descriptive purposes and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Thus, the features defined with "first", "second", etc. may explicitly or implicitly include one or more of such features. In the description of the present invention, unless otherwise specified, the meaning of "a plurality" is two or more.
[0089] In the description of the present invention, it should be noted that, unless otherwise clearly specified and defined, the terms "connected" and "coupled" should be understood in a broad sense. For example, it may be a fixed connection, a detachable connection, or an integral connection; it may be a mechanical connection or an electrical connection; it may be directly connected or indirectly connected through an intermediate medium, and it may be the communication inside two components. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood through specific circumstances.
[0090] Embodiment 1. Structure of the nucleic acid multiplex detection microfluidic chip
[0091] The structure of the nucleic acid multiplex detection microfluidic chip provided in this embodiment is as Figures 1 to 4 shown, where Figure 1 is the back view of the microfluidic chip, Figure 2 is the front view (without the tube cap) of the microfluidic chip; Figure 3 is the side view (without the tube cap) of the microfluidic chip; Figure 4 is the schematic diagram of the detection unit structure.
[0092] As Figures 1 to 3 shown, the nucleic acid multiplex detection microfluidic chip 28 provided in this embodiment includes a sample loading area 1 and a detection area 2. The sample loading area 1 includes a sample pool 3 and a tube cap 4. The sample pool 3 is used to accommodate the sample to be tested. When the sample is added to the microfluidic chip 28, it first stays in the sample pool 3. The tube cap 4 is used to seal the microfluidic chip 28. The tube cap 4 in this embodiment contains a stopper 5. When the tube cap 4 is tightened downwards, the stopper 5 can provide a downward pressure to promote the sample to flow from the main channel 6 into the detection area 2. The channels in the microfluidic chip 28 include a main channel 6 and a plurality of branch channels 27. The width of the channels is 50 μm to 500 μm. In this embodiment, the width of the main channel is preferably 300 μm and the depth is 250 μm.
[0093] The detection area 2 can be provided with any number of detection units 7 according to the project requirements, so as to simultaneously detect multiple targets. In this embodiment, preferably, ten groups of detection units 7 are provided, arranged in two columns, with five groups of detection units 7 in each column. Each group of detection units 7 includes a reaction chamber 8 and a detection chamber 9 connected to the reaction chamber 8. Both the reaction chamber 8 and the detection chamber 9 are provided with exhaust holes 29 that can communicate with the atmosphere, and a waterproof and breathable membrane 30 is covered on the exhaust holes 29. The reaction chamber 8 is used to perform a pretreatment reaction on the sample to be tested. The reaction chamber 8 is provided with a first exhaust channel 10, and a first waterproof and breathable membrane 11 is provided at the outlet of the first exhaust channel 10 for controlling the communication state between the reaction chamber 8 and the outside atmosphere; the detection chamber 9 is used for detecting the sample to be tested. The detection chamber 9 is provided with a second exhaust channel 12, and a second waterproof and breathable membrane 13 is provided at the outlet of the second exhaust channel 12 for controlling the communication state between the detection chamber 9 and the outside atmosphere. The settings of the first waterproof and breathable membrane 11 and the second waterproof and breathable membrane 13 can enable the gas in the reaction chamber 8 to be discharged, but the liquid cannot pass through. When the first exhaust channel 10 is filled with liquid, the first waterproof and breathable membrane 11 will lose its breathable function, so that the entire system is in a closed state and the liquid in the system stops flowing. Therefore, the waterproof and breathable membrane can help establish an internal and external pressure balance for the sample in the reaction chamber 8 or the detection chamber 9, can regulate the liquid flow direction, and prevent the sample in the reaction chamber 8 or the detection chamber 9 from flowing back. In some ways, the waterproof and breathable membrane is made of a polymer material, such as a high-grade synthetic rubber, with good sealing performance, no back glue and residue, and does not react with the reaction reagent or the detection reagent. In this embodiment, the waterproof and breathable membrane is preferably made of a material (manufacturer: Membrane; product number: VET022H60).
[0094] In the microfluidic chip 28 provided in this embodiment, a valve block 14 is provided between the reaction chamber 8 and the detection chamber 9 for controlling the communication state between the reaction chamber 8, the detection chamber 9 and the outside atmosphere. The valve block 14 has two states: solid and liquid; when the valve block 14 is in a solid state, it condenses and fixes in the flow channel connecting the reaction chamber 8 and the detection chamber 9, blocking the flow channel to prevent the sample to be tested in the reaction chamber 8 from flowing into the detection chamber 9; when the valve block 14 is in a liquid state, it will flow into the second exhaust channel 12 of the detection chamber 9 to promote the liquid in the reaction chamber 8 to flow into the detection chamber 9 and prevent the liquid in the detection chamber 9 from flowing back. By respectively providing exhaust channels on both the reaction chamber 8 and the detection chamber 9, and at the same time providing a valve block 14 between the reaction chamber 8 and the detection chamber 9, using the temperature-rising phase change performance of the valve block 14 and combining with the principle of internal and external atmospheric pressure balance, it can be ensured that after the sample to be tested enters the corresponding chamber, it can stably stay in the chamber, without backflow phenomenon and without flowing into other chambers, so as to ensure that each step of the reaction can be successfully completed until accurate detection is finally achieved.
[0095] Its main principle can be explained from the flow process of the sample to be tested in the microfluidic chip 28. The flow process of the sample to be tested in the microfluidic chip 28 mainly has two steps: The first step is that the sample to be tested enters the reaction chamber 8 for reaction; The second step is that after the reaction is completed, the sample to be tested flows out of the reaction chamber 8 and enters the detection chamber 9 for reaction and detection. In the first step, the process of the sample entering the reaction chamber 8 is also the process of the gas in the reaction chamber 8 being discharged outward through the first exhaust channel 10. When the sample completely enters the reaction chamber 8 and cannot enter the detection chamber 9 blocked by the valve block 14, all the excess gas in the reaction chamber 8 is also discharged. At this time, two situations will occur. One is that the sample fills the reaction chamber 8 and also enters the first exhaust channel 10 and contacts the first waterproof breathable membrane 11, causing the first waterproof breathable membrane 11 to lose its breathable function. The whole system is in a closed state, and the liquid in the reaction chamber 8 stops flowing and will not show a backflow state. At the same time, due to the setting of the flow channel shape, it also makes it more difficult for the sample to flow back and impossible to flow back; The other is that the sample is all in the reaction chamber 8, does not enter the first exhaust channel 10, or partially enters the first exhaust channel 10 but does not contact the first waterproof breathable membrane 11, and the first waterproof breathable membrane 11 can still breathe. That is, only the first exhaust channel 10 of the whole microfluidic chip 28 is connected to the atmosphere, and the rest are in a sealed state, and the internal and external pressures reach equilibrium. The sample in the reaction chamber 8 cannot flow from the reaction chamber 8 to other areas anymore because flowing out of the reaction chamber 8 will inevitably require a large pressure to break the established internal and external pressure equilibrium. Therefore, all the samples will remain in the reaction chamber 8 for reaction. In the second step, after the sample completes the reaction in the reaction chamber 8, the valve block 14 is heated and melted, and the flow channel between the reaction chamber 8 and the detection chamber 9 is connected. Since the detection chamber 9 is provided with a second exhaust channel 12, the initial pressure balance is broken, and the sample flows out of the reaction chamber 8 and enters the detection chamber 9. At this time, the melted valve block 14 has a lower density. After flowing into the detection chamber 9 together with the sample to be tested, it will condense near the second exhaust channel 12 and block the second exhaust channel 12. At this time, two situations will also occur. One is that the liquid in the first exhaust channel 10 has flowed away, so there is only the first exhaust channel 10 connected to the atmosphere, and the rest are in a sealed state, and the pressure in the detection chamber 9 also reaches equilibrium, making the sample in the detection chamber 9 unable to flow out of the detection chamber 9 anymore and all remaining in the detection chamber for reaction and detection; The other is that the first exhaust channel 10 is still filled with liquid. At this time, the first waterproof breathable membrane 11 cannot breathe, and the whole system is in a closed state, and the liquid in the detection chamber 9 will not show a backflow state. It can be seen that the valve block 14 has multiple uses in the microfluidic chip 28 provided in this embodiment. For example, in the initial solid state, it can control the connection state between the reaction chamber 8 and the detection chamber 9 and play a blocking role. After the initial solid turns into a liquid state, it can realize the connection between the detection chamber 9 and the outside atmosphere. When it flows into the detection chamber and re-condenses into a solid state, it can block the second exhaust channel 12 to prevent the sample from flowing out of the detection chamber 9.Of course, if there are more samples, the second exhaust channel 12 can be filled to close the entire system. However, when the sample volume cannot fill the detection chamber 9, it is easy to cause the sample in the detection chamber 9 to flow back. At this time, the paraffin condensation helps to block the second exhaust channel 12 and block the communication state between the detection chamber 9 and the atmosphere, thereby preventing the sample from flowing back from the detection chamber 9.
[0096] Preferably, as Figure 3 shown, the reaction chamber 8 is provided with a first sample inlet 15 and a first sample outlet 16, and the position of the first sample outlet 16 is higher than that of the first sample inlet 15. That is to say, the first sample inlet 15 is at a lower position on one side of the reaction chamber 8, and the first sample outlet 16 is at a higher position on the other side of the reaction chamber 8. The purpose of doing this is to ensure that the sample can smoothly enter the reaction chamber 8 and is more likely to stay in the reaction chamber 8 during the reaction process, not easy to return to the main flow channel 6, and not easy to flow into the branch flow channel from the first sample outlet 16. When a specific volume of the sample to be tested is added from the sample addition area 1, through the pressure provided during the process of tightening and sealing the tube cap 4, the sample to be tested can be promoted to enter the reaction chamber 8 of each detection unit 7 from the main flow channel 6. The first sample inlet 15 of the reaction chamber 8 is at a low position, which can enable the sample to be tested to quickly flow into the reaction chamber 8 and gradually fill it. However, at this time, it will not flow out of the reaction chamber 8 from the first sample outlet 16 because the first sample outlet 16 is at the top of the reaction chamber 8. Unless the sample is very much and completely fills the reaction chamber 8, there will be an overflow of the reaction chamber 8. Otherwise, the sample will be stably retained in the reaction chamber 8. Moreover, since the first sample outlet 16 is connected to the first exhaust channel 10, if the sample enters the first exhaust channel 10 and causes the first waterproof breathable membrane 11 to be unable to breathe, the sample will stop flowing and stay in the reaction chamber 8 for reaction. Even if the sample volume does not fill the reaction chamber 8 and fails to enter the first exhaust channel 10, due to the internal closure of the microfluidic chip 28 and the achievement of the pressure balance state, the sample is also difficult to return to the main flow channel 6 from the first sample inlet 15 under the internal and external pressure balance state, so it can always stay in the reaction chamber 8 for reaction.
[0097] Preferably, the first sample inlet 16 is located at the lower left or lower right position of the reaction chamber 8 and is connected to the first branch port 18 of the main flow channel 6 through the first sample injection flow channel 17. The first sample injection flow channel 17 is an upwardly arched curved flow channel, and the first sample inlet 15 and the first branch port 18 are respectively located at the low points on both sides of the curved flow channel. The sample to be measured needs to flow into the reaction chamber 8 through the first sample injection flow channel 17. Therefore, the shape design of the first sample injection flow channel 17 also plays a very crucial role. When the first sample injection flow channel 17 adopts an upwardly arched curved flow channel, the sample needs to overcome a certain pressure to enter the reaction chamber 8, and it is also more difficult to return from the reaction chamber 8 to the main flow channel 6. Moreover, during the process of the sample entering the reaction chamber 8, it is also the process of the gas in the reaction chamber 8 being discharged outward. After all the samples enter the reaction chamber 8, all the excess gas in the reaction chamber 8 is also discharged, and the first sample inlet 15 is completely covered by the sample in the reaction chamber 8, achieving pressure balance inside and outside. At this time, the sample in the reaction chamber 8 cannot return to the main flow channel 1 from the upwardly arched curved flow channel because it needs to overcome the pressure brought by the upwardly arched curved flow channel and also requires a large pressure to break the established internal and external pressure balance. Therefore, all the samples will remain in the reaction chamber 8 for reaction; in addition, if the sample can directly fill the first exhaust channel 10, making the first waterproof and breathable membrane 11 no longer breathable and the system completely closed, the sample will also directly stop flowing.
[0098] Preferably, the first sample outlet 16 is located at the upper part of the reaction chamber 8 and is connected to the first sample outlet flow channel 19. The first exhaust channel 10 is connected to the first sample outlet flow channel 19. It can also be said that the first exhaust channel 10 is a branch flow channel branched from the first sample outlet flow channel 19. The first sample outlet flow channel 19 is an upwardly arched curved flow channel, and the first sample outlet 16 is located at the low point on one side of the curved flow channel. After the sample to be measured completes the reaction in the reaction chamber 8, it needs to flow out from the first sample outlet flow channel 19 and into the detection chamber 9. However, before the reaction of the sample in the reaction chamber 8 is completed, it is not desired for it to easily enter the first sample outlet flow channel 19. Therefore, the shape design of the first sample outlet flow channel 19 also plays a certain role. When the first sample outlet flow channel 19 adopts an upwardly arched curved flow channel, it makes it more difficult for the sample to flow out of the reaction chamber 8, and it needs to overcome a greater pressure to enter the detection chamber 9.
[0099] Preferably, the cross-sectional shape of the reaction chamber 8 is circularly arranged, so that there are no dead corners during the reaction and discharge process of the sample to be measured in the reaction chamber, and it is not easy to leave residues during the inflow and outflow processes.
[0100] As Figure 4As shown, the detection chamber 9 is provided with a second sampling inlet 21 and an exhaust port 22, and the position of the exhaust port 22 is higher than that of the second sampling outlet 21. After the sample to be tested completes a reaction conducive to detection (such as reacting with a detection reagent for signal amplification, etc.) in the detection chamber 9, the result is directly detected in the detection chamber 9. One side of the detection chamber 9 is made of a transparent film, and the detection instrument can detect substances such as fluorescence generated by the reaction through the transparent film and read the detection result. Therefore, the detection chamber 9 does not require a sampling outlet, but an exhaust port 22 must be additionally provided. The positions of the second sampling inlet 21 and the exhaust port 22 of the detection chamber 9 are also designed. The second sampling inlet 21 is located at the lower position of the detection chamber 9, and the exhaust port 22 is located at the upper position of the detection chamber 9. The purpose of this is to ensure that after the sample enters the detection chamber 9 smoothly from the reaction chamber 8 by overcoming a certain pressure, it is also difficult to return to the reaction chamber 8, so that it can stay more stably in the detection chamber 9 and prevent backflow.
[0101] Preferably, the second sampling inlet 21 is located at the lower end of the detection chamber 9 and is connected to the first sampling flow channel 19 through the second sampling flow channel 20; the exhaust port 22 is located at the upper end of the detection chamber 9 and is connected to the second exhaust channel 12. Preferably, the exhaust port 22 is located at the top of the detection chamber 9; a valve block 14 is fixed at the intersection of the second sampling flow channel 20 and the first sampling flow channel 19, and a cavity 23 for accommodating the valve block is provided.
[0102] Preferably, the valve block 14 is made of paraffin or lipid substances (such as lipid substances like n-octadecane, stearic acid, palmitic acid, etc.), which is solid at room temperature and melts into a liquid after heating; the density of the valve block 14 needs to be less than that of water. When the valve block 14 turns into a liquid, it can always float above the sample to be tested, which helps to condense at the exhaust port 22 at the top of the detection chamber 9. If the density of the valve block 14 is greater than that of water, when the valve block 14 turns into a liquid and flows into the detection chamber 8 together with the sample, it is easy to accumulate at the second sampling inlet 21 of the detection chamber 8, resulting in blockage of the second sampling inlet 21. Therefore, the density of the valve block 14 must be less than that of water. In this embodiment, paraffin is preferably used as the valve block 14, and paraffin can undergo a phase change at a specific temperature threshold between 50 and 90 °C. In this embodiment, paraffin (manufacturer: Sigma-Aldrich, model: 411663) undergoes a phase change at about 65 °C.
[0103] Preferably, the cross section of the detection chamber 9 is in the shape of a water drop, and the exhaust port 22 is located at the top of the water drop-shaped detection chamber 9. The water drop-shaped detection chamber 9 helps the liquid paraffin to gather upward, so that it is easier to condense near the exhaust port 22. After the sample to be tested completes the amplification reaction in the reaction chamber 8, the paraffin is melted from a solid state to a liquid state by heating, and enters the detection chamber 9 together with the sample to be tested, and is exhausted to the outside through the exhaust port 22. Since the density of paraffin is less than that of water, it will float above the sample to be tested and close to the exhaust port. Since the temperature of the sample to be tested is low, the paraffin will eventually condense near the exhaust port 22 and block the exhaust port 22. At this time, the sample to be tested has completely entered the detection chamber from the bottom. Since the exhaust port 22 is closed, the first exhaust flow channel 10 of the reaction chamber 8 begins to circulate with the atmosphere due to the outflow of liquid. Therefore, the sample to be tested will be completely retained in the detection chamber 9 under the action of the external atmospheric pressure and can no longer flow out from the second sample inlet flow channel 20.
[0104] Preferably, the microfluidic chip 28 provided in this embodiment can be used for multiple detection of nucleic acids (DNA and / or RNA), the reaction chamber 8 is used for nucleic acid amplification, and the detection chamber 9 is used for fluorescence detection reaction between the amplified sample and the detection reagent. The solid reagents built into the reaction chamber 8 and the detection chamber 9 can be flexibly set as needed, and different chambers can be built with different reaction reagents, such as the reaction chamber 8 has built-in amplification primers for different targets and the detection chamber 9 has built-in different detection probes, so that multiple detection of nucleic acids can be achieved. Of course, the microfluidic chip 28 provided in this embodiment can also be used for multiple detection of other target substances, and the solid reagents built into the reaction chamber 8 and the detection chamber 9 can be flexibly selected according to the reagents required for the detection of the target substance.
[0105] A nucleic acid amplification reagent needs to be placed in the reaction chamber 8 in advance. The nucleic acid amplification reagent is a solid amplification reagent that is freeze-dried or dried. The nucleic acid amplification reagent is a common variable temperature or isothermal nucleic acid amplification reagent, including but not limited to ERA (Enzymatic Recombinase Amplification), RPA (Recombinase Polymerase Amplification), LAMP (Loop-mediated Isothermal Amplification), NEAR (Nicking enzyme-Assisted Reaction), NASBA (Nuclear acidsequence-based amplification), HDA (helicase-dependent amplification), etc.
[0106] The detection chamber 9 is used for the fluorescence detection reaction of the amplified sample and the detection reagent. The detection reagent includes, but is not limited to, ERA (Enzymatic Recombinase Amplification), RPA (Recombinase Polymerase Amplification), LAMP (Loop-mediated Isothermal Amplification), NEAR (Nicking enzyme-Assisted Reaction), CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) detection system, and various probe detection systems established based on Ago, RNase H, etc.
[0107] The microfluidic chip 28 provided in this embodiment is sequentially connected to the sample pool 3, the reaction chamber 8, and the detection chamber 9 through a shunt channel 27 with a depth of 250 μm. The reaction chamber 8 contains a pre-embedded solid nucleic acid amplification reagent and can be used to accommodate 50 μL of reaction buffer, including ERA reagent, RPA reagent, LAMP reagent, etc. The detection chamber 9 contains a solid detection reagent and can accommodate 20 μL of detection buffer.
[0108] As Figures 1 to 3 shown, the microfluidic chip 28 provided in this embodiment further includes a pressure application area 24. The pressure application area 24 is located on one side of the sample addition area 1 and is used to increase the pressure of the liquid in the reaction chamber 8 so that the liquid in the reaction chamber 8 flows into the detection chamber 9.
[0109] Preferably, the pressure application area 24 can be in the form of an air bubble, with air stored inside. Pressure can be further provided to the sample pool by pressing, driving the liquid to transfer from the reaction chamber 8 to the detection chamber 9. In this embodiment, the pressure application area 24 is preferably an airbag 25. The airbag 25 is initially convex outward. When the airbag 25 is pressed, the volume of the airbag 25 becomes smaller, and the gas inside the airbag 25 is discharged, so as to inject pressure into the internal flow channels of the closed microfluidic chip 28 and drive the flow of the liquid inside the microfluidic chip 28.
[0110] Preferably, the pressure zone 24 is arranged at the upper left or upper right of the microfluidic chip 28. Since the microfluidic chip 28 is vertically inserted into the supporting detection device, the pressure zone 24 is located at the upper left or upper right, which is more convenient for pressing; the pressure zone 24 needs to be arranged on one side of the sample adding area 1, firstly, it is convenient for pressing when needed, and secondly, it can provide a greater airflow pressure. The purpose of setting the pressure zone 24 is to be used for: when the sample to be tested completes amplification and other reactions in the reaction chamber 8, the valve block 14 melts, and the sample to be tested needs to enter the detection chamber 9 from the reaction chamber 8. At this time, it is necessary to overcome a certain air pressure and the pressure caused by the upward bending of the flow channel. Therefore, the pressure zone 24 needs to provide sufficient pressure to drive the sample to be tested from the reaction chamber 8 into the detection chamber 9. If the pressure area 24 is set on the sample adding area 1 or the tube cover 4, although it can also provide a certain pressure, due to the limited volume of the sample adding area 1 or the upper end of the tube cover 4, the airflow pressure provided is also very limited, and the pressing operation is inconvenient. When tightening the tube cover 4, it is easy to accidentally touch the airbag on the tube cover 4, causing the airbag to release the airflow in advance. Therefore, the pressure area 24 needs to be set at the upper left or upper right of the microfluidic chip 28, and it should also reach a specific volume (specifically, it can be calculated according to the size of the microfluidic chip 28 and the required pressure, so as to set the airbag 25 of a suitable volume), so that the pressing process provides more accurate airflow pressure to drive the sample to be tested from the reaction chamber 8 into the detection chamber 9. Pressing the airbag 25 of the pressure area 24 can be done manually, or the airbag 25 can be pressed by a matching detection device to provide a specific force. In this embodiment, the pressure area 24 is connected to the sample pool 3 through the branch channel 27. By pressing, air flow is discharged from the branch channel 27 to the sample pool 3 and into the microfluidic chip 28, thereby driving the sample to be tested from the reaction chamber 8 into the detection chamber 9.
[0111] The main structure of the microfluidic chip 28 provided in this embodiment adopts a material with low cost, easy processing performance and good biocompatibility chip, such as an etched structure on a substrate of polymethyl methacrylate PMMA, and then prepared by polydimethylsiloxane PDMS inverting. The waterproof and breathable membrane is bonded to the chip body to form a sealed space as a whole, effectively preventing liquid leakage. In some embodiments, according to the detection needs, the fixed amplification reagent for nucleic acid amplification in the reaction chamber 8 and the detection substance for detection in the detection chamber 9 include freeze-dried balls, freeze-dried powder or quality control internal standard reagents.
[0112] The volume of the sample pool 3 is 100 μL to 2000 μL. The sample pool 3 is connected to the main channel 6. When the test kit is not in use, the sample pool 3 is sealed by an easy-to-remove film, which can be an easy-to-remove aluminum film. When the test kit is used, the easy-to-remove film needs to be removed, and the sample containing the sample release agent is added to the sample pool 3. After the sample pool 3 is covered with the tube cover 4, the sample liquid is in a certain pressure environment, which promotes the sample to flow quickly into the reaction chamber 8.
[0113] The detection device includes a heating module, a power supply, and a power supply control module. The heating module is connected to the power supply, and the power supply is controlled by the power supply control module. The power supply control module controls the power supply to perform a power-on / off cycling operation on the heating module. The heating module contacts the microfluidic chip 28 and heats the microfluidic chip 28 when powered on and cools the microfluidic chip 28 when powered off, so as to realize the heating / cooling cycle of the microfluidic chip 28.
[0114] When performing multiplex nucleic acid detection using the microfluidic chip 28 provided in this embodiment, first, the original sample is lysed with a sample treatment solution (lysis solution), and the lysed sample solution is transferred to the sample pool 3. The sample will enter the reaction chamber 8 through a preset flow channel and then fuse and react with the amplification lyophilized reagent to achieve nucleic acid amplification. After incubating and reacting for a period of time, the valve block 14 undergoes a phase change (such as paraffin dissolution), squeezing the airbag 25 in the pressure application area 24. The reaction amplification reagent enters the detection chamber 9 through a preset flow channel and undergoes a fluorescence color reaction, and the result is observed and read. During the process, the transfer of liquid in different chambers can be achieved by simply squeezing the pressure application area 24, without the need for complex external pressure supply equipment and without the risk of sample backflow, realizing on-site multiplex and instant detection of nucleic acids in the simplest way, which has important practical application value and social and economic benefits for clinical diagnosis or rapid on-site screening.
[0115] Example 2. Preparation method of a multiplex nucleic acid detection microfluidic chip
[0116] The preparation method of the multiplex nucleic acid detection microfluidic chip provided in Example 1 is as follows:
[0117] I. Preparation of solid reagents built into the microfluidic chip
[0118] The solid reagents built into the microfluidic chip can be prepared by different methods such as lyophilization and drying. In this embodiment, it is preferred to prepare the solid reagents in the form of lyophilized beads.
[0119] 1. Preparation of lyophilized beads of solid amplification reagent built into the reaction chamber 8
[0120] Design and synthesis of primer probes: Search for the target sequence gene in the literature through NCBI, use VectorNTI software to compare and find its conserved region, select a partial region of the conserved gene as the target amplification segment, construct it in the vector PUC57, and prepare a positive plasmid. The plasmid is synthesized by Beijing Tsingke Biotechnology Co., Ltd. In this embodiment, a plasmid containing the conserved region gene sequence of Mycoplasma pneumoniae is taken as an example.
[0121] The upstream primer sequence is: GGCAGTCAACAAACCACGTATGATCCC;
[0122] The downstream primer sequence is: CTGGAAGGACGACCCTGGTCC;
[0123] The detection probe series is: CCGGCATGAGTAACGCTTGG;
[0124] Synthesize primers and probes. The 5'-end of the probe is labeled with the FAM fluorescent reporter group, and the 3'-end is labeled with the BHQ1 quenching group.
[0125] Preparation of the primer and probe mixture: Take the primers and probes into a reagent tube and prepare a stock solution with a concentration of 100 μM. Subsequently, place the reagent tube on a vortex mixer, mix for 1 min and then centrifuge quickly again to make the liquid concentrate at the bottom of the tube, and let it stand for 30 min for standby.
[0126] The preparation of the amplification premix is shown in Table 1.
[0127] Table 1. Preparation of the probe premix
[0128] Name Concentration Tris - acetate pH 8.0 30 mM Potassium acetate 100 mM Magnesium acetate 14 mM Polyethylene glycol (molecular weight 20000) 5% ATP 2 mM Phosphocreatine 20 mM Imidazole 20 mM dNTP (25 mM each) 0.45 mM Glycerol 2%
[0129] Preparation of the freeze-dried microspheres of the amplification reagent:
[0130] (1) Mix the solution containing trehalose as the freeze-drying adjuvant with the amplification premix at a ratio of 1:1 to obtain the liquid reagent A;
[0131] (2) Mix the solution containing mannitol as the freeze-drying adjuvant with the primer mixture at a ratio of 1:1 to obtain the liquid reagent B;
[0132] (3) Mix the liquid reagent A and the liquid reagent B, and perform freeze-drying. The obtained freeze-dried beads are the solid amplification reagent.
[0133] The freeze-drying procedure is as follows: Pre-freezing: -55 °C for 30 min; Sublimation drying: -45 °C for 240 min, -35 °C for 360 min, -25 °C for 240 min; Desorption drying: 20 °C for 360 min; Heat preservation: 4 °C.
[0134] 2. Preparation of the freeze-dried beads of the solid detection reagent placed in the detection cavity 9
[0135] (1) Preparation of the probe premix (see Table 1);
[0136] Add a certain volume of 1×TE Buffer to the synthesized probe tube for dissolution to prepare a stock solution with a concentration of 100 μM.
[0137] (2) The preparation of the probe mixture is shown in Table 2.
[0138] Table 2. Preparation of the probe mixture
[0139] Name Concentration Tris - acetate pH 8.0 30 mM Potassium acetate 100 mM Magnesium acetate 14 mM Polyethylene glycol (molecular weight 20000) 5%
[0140] (3) Mix the solution containing trehalose with the probe premix at a ratio of 1:1 as a freeze-drying adjuvant to obtain Liquid Reagent I;
[0141] (4) Mix the solution containing mannitol with the probe mixture at a ratio of 1:1 as a freeze-drying adjuvant to obtain Liquid Reagent II;
[0142] (5) Mix Liquid Reagent I and Liquid Reagent II, add them into a centrifuge tube, and perform freeze-drying at 20 μl / drop. The obtained freeze-dried pellets are the solid detection reagents;
[0143] The freeze-drying procedure includes four steps: pre-freezing, sublimation drying, desorption drying, and heat preservation. The specific freeze-drying temperature-time program is shown in Table 3.
[0144] Table 3. Freeze-drying procedure
[0145]
[0146] Assembly of the microfluidic chip: Fix the freeze-dried nucleic acid amplification reagent and nucleic acid detection reagent in the reaction chambers of the microfluidic chip respectively, and then assemble the microfluidic chip to obtain the microfluidic chip.
[0147] Example 3. Usage method of the nucleic acid multiplex detection microfluidic chip
[0148] The nucleic acid multiplex detection microfluidic chip provided in Example 1 is applicable to a variety of nucleic acid detection methods. Here, taking the nucleic acid detection based on the enzyme-mediated isothermal amplification technology as an example, the usage method of the microfluidic chip device is described as follows:
[0149] 1. Chip sample loading stage: Take out the microfluidic chip from the packaging box, unscrew the lid sealed on the sample pool, aspirate 300 μl of the lysed sample (such as the lysing reagent: Xianda Gene, sample release agent (GD005)) (such as the oral swab of a respiratory patient) and add it to sample pool 3. Then tighten the tube cap 4 of the sample pool. At this time, the liquid in sample pool 3 enters reaction chamber 8.
[0150] 2. Amplification stage:
[0151] a. Start the chip nucleic acid amplification analyzer and the computer workstation, open and log in to the supporting software;
[0152] b. Vertically insert the microfluidic chip into the analyzer; after ensuring the correct insertion position, click the "Start" button. The instrument starts to heat up, and the sample liquid mixes with the solid amplification reagent in reaction chamber 8 and undergoes an amplification reaction; during the amplification reaction, the paraffin blocking between reaction chamber 8 and detection chamber 9 also gradually melts.
[0153] c. Detection reaction: After the amplification reaction has proceeded for 10 minutes, the paraffin has melted. Press on the pressure application area 24 to drive the amplified product in the reaction chamber 8 to flow into the detection chamber 9 and mix with the detection reagent, thereby initiating the detection reaction. During the detection process, the detection progress and real-time curve can be viewed.
[0154] d. Reading of detection results: After the detection is completed, the instrument will automatically perform data analysis, display the reaction process curve and detection results, and generate a detection report. For valid detection results, a "+" is displayed in the "Result" column of the software interface, indicating that the pathogen has been detected in the sample; a "-" displayed in the "Result" column of the interface indicates that the pathogen has not been detected in the sample.
[0155] Example 4. Performance detection of the nucleic acid multiplex detection microfluidic chip
[0156] The nucleic acid multiplex detection microfluidic chip provided in Example 1 can be specifically but not limited to nucleic acid detections such as infectious pathogenic microorganism nucleic acid detection, environmental microorganism nucleic acid multiplex detection, animal infectious disease screening, meat source component identification, gene detection, etc. In this example, the infectious pathogenic microorganism nucleic acid detection is specifically used as an example for illustration.
[0157] 1. Accuracy detection
[0158] To verify the accuracy of the chip detection, the prepared chip was used to verify the simulated clinical samples. Through the simulated samples, the types of respiratory pathogens tested specifically include Mycoplasma pneumoniae, adenovirus, parainfluenza virus type 1, parainfluenza virus type 3, Klebsiella pneumoniae, Streptococcus pneumoniae, Chlamydia pneumoniae, Legionella pneumophila, respiratory syncytial virus, Staphylococcus aureus. The chip detection and PCR verification results are shown in Table 4, and the qPCR verification results are as Figure 5 shown.
[0159] Table 4. Verification results of the detection performance of the dual-functional chamber microfluidic chip
[0160]
[0161] From Figure 5 and Table 4, it can be seen that the results of the detection using the dual-functional chamber microfluidic chip are consistent with those of qPCR. For the corresponding detection chambers with qPCR detection Ct < 36 for Mycoplasma pneumoniae and Staphylococcus aureus, the chip can correctly detect them.
[0162] 2. Sensitivity detection
[0163] Using this microfluidic chip for a series of concentrations (10 5 copies / mL, 10 4 copies / mL, 10 3Mycoplasma pneumoniae, adenovirus, parainfluenza virus type 1, parainfluenza virus type 3, Klebsiella pneumoniae, Streptococcus pneumoniae, Chlamydia pneumoniae, Legionella pneumophila, respiratory syncytial virus, and Staphylococcus aureus at concentrations of 10 copies / mL, 10 copies / mL, 10 copies / mL, and 500 copies / mL were detected to verify the sensitivity of the chip. The results are shown in Table 5.
[0164] Table 5. Verification results of the detection performance of the typing microfluidic chip
[0165]
[0166]
[0167] The results showed that the minimum detection limit of the microfluidic chip for the above 10 pathogens could reach 500 copies / mL. Among them, the microfluidic chip was used to detect Mycoplasma pneumoniae cultures with a series of concentrations (10 copies / mL, 10 copies / mL, 10 copies / mL, and 500 copies / mL). From the results, it could be seen that the microfluidic chip at 500 copies / mL could still produce a fluorescence signal that was significantly different from the blank control, indicating that the dual-functional cavity microfluidic chip of the present invention could reach a detection limit of 500 copies / mL. 5 copies / mL, 10 4 copies / mL, 10 3 copies / mL, 500 copies / mL) of Mycoplasma pneumoniae cultures. From the results, it could be seen that the microfluidic chip at 500 copies / mL could still produce a fluorescence signal that was significantly different from the blank control, indicating that the dual-functional cavity microfluidic chip of the present invention could reach a detection limit of 500 copies / mL.
[0168] Example 5. Verification of the detection effect of the nucleic acid multiplex detection microfluidic chip
[0169] In this example, the nucleic acid multiplex detection microfluidic chip device of Example 1 was used, and the nested ERA detection technology (nested enzyme-mediated recombination detection technology) was used to detect the nucleic acids of 10 microorganisms in a concentrated specimen of a water environment (Salmonella, Shigella, enterohemorrhagic Escherichia coli O157, Listeria monocytogenes, Staphylococcus aureus, Pseudomonas aeruginosa, Enterobacter sakazakii, Bacillus subtilis nucleic acid, Vibrio fluvialis, Aeromonas hydrophila), and the qPCR detection method (commercial reagent) was used for comparative verification. The nucleic acids in the water concentrated specimen were lysed using a sample release agent, and the obtained lysate was used as a template. With the same template loading amount, the sample was amplified and detected using the nucleic acid multiplex detection microfluidic chip device and the qPCR detection method respectively. Among them, the nested ERA detection technology preloaded ERA lyophilized microspheres containing specific amplification primers and lyophilized microspheres containing specific nested ERA primer probes in the reaction cavity and detection cavity of the microfluidic chip device respectively. It was determined whether the corresponding pathogenic microorganism nucleic acids were contained in the sample, and the results are shown in Table 6.
[0170] Table 6. List of verification of the detection performance of the nucleic acid multiplex detection microfluidic chip
[0171] Serial number Microbial type Bifunctional - cavity microfluidic chip device qPCR detection method 1 Salmonella + Positive Positive 2 Shigella - Negative Negative 3 Escherichia coli (O157) - Negative Negative 4 Listeria monocytogenes - Negative Negative 5 Staphylococcus aureus + Positive Positive 6 Pseudomonas aeruginosa - Negative Negative 7 Enterobacter sakazakii - Negative Negative 8 Bacillus subtilis + Positive Positive 9 Vibrio fluvialis + Positive Positive 10 Aeromonas hydrophila + Positive Positive
[0172] As can be seen from Table 6, under the condition that other conditions are the same, the microfluidic chip device provided in Example 1 is consistent with the detection results of the qPCR detection method. Moreover, since the microfluidic chip device can achieve multiplex detection, it is more convenient and faster to use, and is more suitable for on-site detection in the wild and special environments.
[0173] Example 6. Verification of the detection effect of the nucleic acid multiplex detection microfluidic chip
[0174] In this example, the nucleic acid multiplex detection microfluidic chip device of Example 1 was used to perform nucleic acid detection of 10 common pathogenic microorganisms in the gill specimens of diseased Litopenaeus vannamei from a certain farm (White Spot Syndrome Virus (WSSV) of shrimp, Taura Syndrome Virus (TSV) of shrimp, Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV) of shrimp, Hepatopancreatic Parvovirus (HPV) of shrimp, Yellow Head Virus (YHV) of shrimp, Baculovirus (BP) of shrimp, Acute Hepatopancreatic Necrosis Disease (AHPND / EMS) of shrimp, Secret Mortality Nodavirus (CMNV) of shrimp, Shrimp Iridescent Virus (SHIV), Enterocytozoon hepatopenaei (EHP)) by using the ERA-CRISPR detection technology (enzymatic recombination detection technology combined with CRISPR detection technology), and the qPCR detection method (commercial reagent) was used for comparative verification. The gill specimens of Litopenaeus vannamei were lysed for nucleic acids using a sample release agent, and the obtained lysate was used as a template. With the same template loading amount, the nucleic acid multiplex detection microfluidic chip device and the qPCR detection method were respectively used to perform amplification detection on the samples. Among them, the ERA-CRISPR detection technology preloaded ERA lyophilized microspheres containing specific amplification primers and Reporter and lyophilized microspheres containing CRISPR nuclease, crRNA, and RNase inhibitor in the reaction chamber and detection chamber of the microfluidic chip device. Whether the corresponding pathogenic microorganism nucleic acid was contained in the sample was determined, and the results are shown in Table 7.
[0175] Table 7. List of verification of the detection performance of the nucleic acid multiplex detection microfluidic chip
[0176]
[0177] As can be seen from Table 7, under the condition that other conditions are the same, the microfluidic chip device provided in Example 1 is consistent with the detection results of the qPCR detection method. Moreover, since the microfluidic chip device can achieve multiplex detection, it is more convenient and faster to use, and is more suitable for on-site detection in the wild and special environments.
[0178] Example 7. Verification of the detection effect of the nucleic acid multiplex detection microfluidic chip
[0179] This example uses the nucleic acid multiplex detection microfluidic chip device of Example 1, and uses the ERA-RNaseH detection technology (enzymatic recombination amplification combined with RNaseH detection technology) to detect the nucleic acids of ten basic infectious pathogens in cats (feline herpesvirus FHV, feline calicivirus FCV, feline coronavirus FCOV, Mycoplasma felis M.felis, Chlamydia felis C.felis, feline parvovirus FPV, rabies virus RV, feline leukemia virus Felv, Toxoplasma gondii TOX, Bordetella bronchiseptica Bb), and uses the qPCR detection method (commercial reagent) for comparative verification. The nasopharyngeal swab specimens of cats are lysed for nucleic acids using a sample release agent, and the obtained lysate is used as a template. With the same template loading amount, the nucleic acid multiplex detection microfluidic chip device and the qPCR detection method are respectively used to amplify and detect the samples. Among them, in the reaction chamber and detection chamber of the nucleic acid multiplex detection microfluidic chip device, the ERA lyophilized microspheres containing specific amplification primers and the lyophilized microspheres containing a specific RNaseH detection system are pre-loaded respectively. It is determined whether the corresponding pathogenic microorganism nucleic acids are contained in the samples, and the results are shown in Table 8.
[0180] Table 8. Verification list of the detection performance of the nucleic acid multiplex detection microfluidic chip
[0181]
[0182] As can be seen from Table 8, under the condition that other conditions are the same, the nucleic acid multiplex detection microfluidic chip device of Example 1 is consistent with the qPCR detection results. Moreover, since the microfluidic chip device can achieve multiplex detection, it is more convenient and fast to use, and is more suitable for on-site detection in various scenarios.
[0183] Example 8. Verification of the detection effect of the nucleic acid multiplex detection microfluidic chip
[0184] This example uses the nucleic acid multiplex detection microfluidic chip device of Example 1, and uses the ERA-FEN 1 detection technology (enzymatic recombination amplification combined with FEN1 detection technology) to perform nucleic acid typing detection of ten common mycoplasma contaminations on cultured cells (Acholeplasma laidlawii, Mycoplasma fermentans, Mycoplasma hyorhinis, Mycoplasma orale, Mycoplasma arginini, Mycoplasma pneumoniae, Mycoplasma gallisepticum, Mycoplasma synoviae, Spiroplasma citri, Mycoplasma hominis), and uses the qPCR detection method (commercial reagent) for comparative verification. The cultured cells are lysed for nucleic acids using a sample releasing agent, and the obtained lysate is used as a template. With the same template loading amount, the nucleic acid multiplex detection microfluidic chip device and the qPCR detection method are respectively used to amplify and detect the sample. Among them, in the nucleic acid multiplex detection microfluidic chip device, the reaction chamber and the detection chamber are respectively pre-loaded with ERA lyophilized microspheres containing specific amplification primers and lyophilized microspheres containing a specific FEN 1 detection system. It is determined whether the corresponding mycoplasma nucleic acid is contained in the sample, and the results are shown in Table 9.
[0185] Table 9. List of Verification of Detection Performance of Nucleic Acid Multiplex Detection Microfluidic Chip
[0186] Serial number Microbial type Bifunctional - cavity microfluidic chip device qPCR detection method 1 Acholeplasma laidlawii - Negative Negative 2 Mycoplasma fermentans - Negative Negative 3 Mycoplasma hyorhinis - Negative Negative 4 Mycoplasma orale + Positive Positive 5 Mycoplasma arginini + Positive Positive 6 Mycoplasma pneumoniae - Negative Negative 7 Mycoplasma gallisepticum - Negative Negative 8 Mycoplasma synoviae - Negative Negative 9 Spiroplasma citri - Negative Negative 10 Mycoplasma hominis - Negative Negative
[0187] As can be seen from Table 9, under the condition that other conditions are the same, the nucleic acid multiplex detection microfluidic chip device of Example 1 is consistent with the qPCR detection result. Moreover, since the microfluidic chip device can achieve multiplex detection, it is more convenient and faster to use, and is more suitable for on-site detection in various scenarios.
[0188] Example 9. Verification of Detection Effect of Nucleic Acid Multiplex Detection Microfluidic Chip
[0189] This example uses the nucleic acid multiplex detection microfluidic chip device of Example 1, and uses the ERA-Ago detection technology (enzymatic recombination amplification combined with Ago detection technology) to perform 8 kinds of meat component detections on a certain meat specimen (chicken source component, duck source component, pig source component, beef source component, sheep source component, horse source component, mouse source component, human source component), and uses the qPCR detection method (commercial reagent) for comparative verification. After the meat specimen is fully broken, it is lysed for nucleic acids using a sample releasing agent, and the obtained lysate is used as a template. With the same template loading amount, the nucleic acid multiplex detection microfluidic chip device and the qPCR detection method are respectively used to amplify and detect the sample. Among them, in the nucleic acid multiplex detection microfluidic chip device, the reaction chamber and the detection chamber are respectively pre-loaded with ERA lyophilized microspheres containing specific amplification primers and lyophilized microspheres containing a specific Ago detection system. It is determined whether the corresponding pathogenic microorganism nucleic acid is contained in the sample, and the results are shown in Table 10.
[0190] Table 10. Verification List of Detection Performance of Multiplex Nucleic Acid Detection Microfluidic Chip
[0191]
[0192] As can be seen from Table 10, under the condition that other conditions are the same, the multiplex nucleic acid detection microfluidic chip device in Example 1 is consistent with the qPCR detection result. Moreover, since the microfluidic chip device can achieve multiplex detection, it is more convenient and faster to use and is more suitable for on-site detection.
[0193] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.
[0194] Although the present invention is disclosed as above, the present invention is not limited thereto. It can be extended according to its application scope in the microfluidics field. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be subject to the scope defined by the claims.
[0195] The content of the articles, patents, patent applications and all other documents and electronically available information described or cited herein is incorporated herein by reference in its entirety to the extent that each individual publication is specifically and individually indicated to be incorporated by reference. The applicant reserves the right to incorporate any and all materials and information from any such article, patent, patent application or other document into the present application.
Claims
1. A microfluidic chip, characterized in that, It includes a reaction chamber for sample pretreatment and a detection chamber for detecting the sample; The reaction chamber is provided with a first exhaust channel, and a first waterproof and breathable membrane is provided at the outlet of the first exhaust channel for controlling the communication state between the reaction chamber and the outside atmosphere; The detection chamber is provided with a second exhaust channel, and a second waterproof and breathable membrane is provided at the outlet of the second exhaust channel for controlling the communication state between the detection chamber and the outside atmosphere; A valve block is provided between the reaction chamber and the detection chamber for controlling the fluid communication state between the reaction chamber and the detection chamber.
2. The microfluidic chip according to claim 1, characterized in that, The valve block has two states: solid state and liquid state; when the valve block is in the solid state, the reaction chamber and the detection chamber cannot be fluidly connected; when the valve block is in the liquid state, the detection chamber is fluidly connected to the reaction chamber.
3. The microfluidic chip according to claim 2, characterized in that, When the valve block is in the solid state, it is located in the flow channel connecting the reaction chamber and the detection chamber to prevent the sample to be tested in the reaction chamber from flowing into the detection chamber; when the valve block is in the liquid state, it will flow to the second exhaust channel of the detection chamber to prevent the liquid in the detection chamber from flowing back.
4. The microfluidic chip according to claim 3, characterized in that, The valve block is made of paraffin or lipid substances, which are in the solid state at room temperature and melt into the liquid state after heating; the density of the valve block is less than that of water.
5. The microfluidic chip according to claim 1, characterized in that, The reaction chamber is provided with a first sample inlet and a first sample outlet, and the position of the first sample outlet is higher than that of the first sample inlet.
6. The microfluidic chip according to claim 5, characterized in that, The first sample inlet is located at the lower part of the reaction chamber and is connected to the first sample inlet flow channel.
7. The microfluidic chip according to claim 6, characterized in that, The microfluidic chip further includes a main flow channel, the first sample inlet flow channel is fluidly connected to the first branch port of the main flow channel, the first sample inlet flow channel is an upward-arching arc-shaped flow channel, the first sample inlet and the first branch port are respectively located at the low points on both sides of the arc-shaped flow channel, and the first branch port is connected to the main flow channel.
8. The microfluidic chip according to claim 7, characterized in that, The first sample outlet is located at the upper part of the reaction chamber and is connected to the first sample outlet flow channel. The first sample outlet flow channel is an upward-arching arc-shaped flow channel, and the first sample outlet is located at the low point on one side of the arc-shaped flow channel; The first exhaust channel is fluidly connected to the first sample outlet flow channel.
9. The microfluidic chip according to claim 8, characterized in that, The reaction chamber is used for the amplification of target nucleic acid, and nucleic acid amplification reagents are placed in the reaction chamber.
10. The microfluidic chip according to claim 1, characterized in that, The detection chamber is provided with a second sample inlet and an exhaust port, and the position of the exhaust port is higher than that of the second sample outlet.
11. The microfluidic chip according to claim 10, characterized in that, The second sample inlet is located at the lower part of the detection chamber and is connected to the first sample outlet flow channel through the second sample inlet flow channel; the exhaust port is located at the upper part of the detection chamber and is fluidly connected to the second exhaust channel.
12. The microfluidic chip according to claim 11, characterized in that, The exhaust port is located at the top of the detection chamber; a cavity for accommodating the valve block is provided between the second sample inlet flow channel and the first sample outlet flow channel for arranging the valve block.
13. The microfluidic chip according to claim 12, characterized in that, The detection chamber is used for detecting the quantity of the product after the amplification of the target nucleic acid, and detection reagents are placed in the detection chamber.
14. The microfluidic chip according to claim 1, characterized in that, The microfluidic chip further includes a pressure application area, which is located on one side of the sample addition area and is used to increase the pressure of the liquid in the reaction chamber so that the liquid in the reaction chamber flows into the detection chamber.
15. The microfluidic chip according to claim 1, characterized in that, The microfluidic chip further includes a sample addition area, which includes a sample pool and a tube cap. The sample pool is used to accommodate the sample to be tested, and the tube cap is used to seal the microfluidic chip.
16. A nucleic acid detection method, characterized in that, Using the microfluidic chip according to any one of claims 1 to 15 for detection, includes the following steps: (1) Add the sample to be tested into the sample pool of the microfluidic chip; (2) Vertically insert the microfluidic chip into the detection device; (3) The sample to be tested enters the reaction chamber of the nucleic acid detection microfluidic chip from the sample loading area for nucleic acid amplification; (4) Heat is applied to transform the valve block from solid state to liquid state; (5) The pressure application area is squeezed to enable the sample to be tested that has completed nucleic acid amplification to enter the detection chamber for reaction; (6) The detection result is read.
Citation Information
Cited By
Poison mushroom detection equipment based on microfluidic disc
CN122405418A
A microfluidic disc-based amanita phalloides detection device
CN122405418B