Method for promoting foot and mouth disease virus replication based on CBr3 gene knockout and application

By knocking out the CBr3 gene in the host cell, changing the cellular microenvironment and promoting foot-and-mouth disease virus replication, the problems of low efficiency, high cost and variability of traditional vaccine production technology are solved, and efficient and safe vaccine production is achieved.

CN120158451APending Publication Date: 2025-06-17CHINA AGRI VET BIO SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510251363.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-04
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

Traditional foot-and-mouth disease virus vaccine production technology has problems such as low efficiency, high cost and variability, which is difficult to meet the needs of large-scale production and affect the quality and safety of the vaccine.

Method used

Gene editing technology specifically knocks out the CBr3 gene in host cells, changes the microenvironment in the cells, and creates conditions conducive to the replication of foot-and-mouth disease viruses, thus providing a new vaccine production strategy.

Benefits of technology

It has achieved significant promotion of foot-and-mouth disease virus replication, increased the production volume of vaccines and antigen expression, improved the efficiency of vaccine production, reduced production costs, and provided high-quality, safe and effective vaccine production channels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158451A_ABST
    Figure CN120158451A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of gene engineering, and particularly relates to a method for promoting foot and mouth disease virus replication based on CBr3 gene knockout and application. Firstly, it is found that inhibition of CBr3 gene expression in host cells can promote replication of foot-and-mouth disease viruses; secondly, the invention provides sgRNA specifically targeting CBr3, the CBr3 gene is knocked out, and the obtained monoclonal cell line can remarkably promote the replication of the foot and mouth disease virus and improve the production quantity and the antigen expression quantity of the foot and mouth disease virus vaccine, and can be used as a production cell line of the foot and mouth disease virus vaccine, so that the vaccine production efficiency is improved, and the production cost is reduced; meanwhile, high specificity and controllability are achieved, a new technical approach is provided for producing high-quality, safe and effective foot-and-mouth disease vaccines, and the method is expected to play an important role in the field of foot-and-mouth disease prevention and control.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to a method and application for promoting the replication of foot-and-mouth disease virus based on CBr3 gene knockout. Background Art

[0002] Foot-and-Mouth Disease (FMD) is an acute, febrile, highly contagious disease caused by foot-and-mouth disease virus (FMDV), which mainly infects cloven-hoofed animals such as cattle, pigs, sheep, etc. The disease spreads extremely fast and has a high incidence rate. Once it breaks out, it often brings catastrophic economic losses to the livestock industry, and at the same time poses a serious threat to food safety and public health security. Therefore, effective prevention and control of foot-and-mouth disease is crucial for ensuring the healthy and stable development of the livestock industry.

[0003] Currently, vaccination is the main means of preventing and controlling foot-and-mouth disease. However, traditional vaccine production technologies have certain limitations in terms of efficiency, cost, and quality. For example, the traditional cell culture method has low production efficiency and is difficult to meet the needs of large-scale vaccine production; at the same time, the production cost is high, which limits the wide application of vaccines. In addition, the foot-and-mouth disease virus has variability, which makes the research and production of vaccines face greater challenges, and new technologies and methods need to be continuously explored to improve the production efficiency and quality of vaccines. In the research on the virus replication mechanism, with the continuous development of molecular biology technology, people have a deeper understanding of the molecular mechanism of the interaction between the virus and host cells. It has been found that many genes and signaling pathways in host cells play important roles during virus infection.

[0004] Among them, the Cbr3 (Carbonyl Reductase 3) gene, as a key gene in cells, participates in various physiological processes and metabolic pathways. The carbonyl reductase Cbr3 catalyzes the reduction of many carbonyl compounds with biological and pharmacological activities to the corresponding alcohols. This enzyme is classified as a nadph-dependent monomeric oxidoreductase. Cbr3 consists of 3 exons with a length of 11.2 kb and is closely related to another carbonyl reductase gene Cbr1. Prostaglandin E2 (PGE2) plays an important role in immune and inflammatory responses.

[0005] Existing studies have shown that the gene expression and functional status of host cells can significantly affect the process of virus infection and replication. By regulating the genes of host cells, it is possible to change the replication environment of the virus in cells, thereby affecting the replication efficiency of the virus, providing potential targets and theoretical basis for the development of new vaccine production technologies. Summary of the Invention

[0006] In view of the above problems, the present invention is based on the research on the method and application of promoting the replication of foot-and-mouth disease virus by knocking out the CBr3 gene. The aim is to specifically knock out the CBr3 gene in host cells through gene editing technology, change the intracellular microenvironment, create conditions conducive to the replication of foot-and-mouth disease virus, provide a brand-new strategy for the production of foot-and-mouth disease vaccines, and provide a new technical approach for the production of high-quality, safe and effective foot-and-mouth disease vaccines. The specific contents are as follows:

[0007] In the first aspect, the present invention provides the application of a reagent for inhibiting or silencing the expression of the CBr3 gene in the preparation of a foot-and-mouth disease virus or a production cell line of a foot-and-mouth disease virus vaccine.

[0008] Preferably, the reagent is an sgRNA targeting the CBr3 gene.

[0009] In the second aspect, the present invention provides the application of a CBr3 gene knockout cell line as a production cell line of a foot-and-mouth disease virus or a foot-and-mouth disease virus vaccine.

[0010] Preferably, the CBr3 gene knockout cell line is a BHK-21 cell line with the CBr3 gene knocked out.

[0011] Preferably, the construction method of the BHK-21 cell line with the CBr3 gene knocked out includes the following steps:

[0012] (1) Prepare an sgRNA specifically targeting the CBr3 gene;

[0013] (2) Anneal and ligate the sgRNA prepared in step (1) to the PX459 plasmid to obtain a recombinant vector that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence;

[0014] (3) Transfect the recombinant vector prepared in step (2) into BHK-21 cells, and screen with puromycin to obtain a CBr3 gene function-deficient cell line.

[0015] Preferably, the target sequence of the sgRNA targeting the CBr3 gene is: ATCTCAGCTTGAATGTCGAA.

[0016] Preferably, the complementary oligonucleotides of the sgRNA are as follows:

[0017] F: CACCGAGGCTGTGTATCGCGAGCC;

[0018] R: AAACGGCTCGCGATACACAGCCTC.

[0019] In a third aspect, the present invention provides an sgRNA specifically targeting the CBr3 gene, and the target sequence of the sgRNA is: ATCTCAGCTTGAATGTCGAA.

[0020] In a fourth aspect, the present invention provides the use of the sgRNA described in the third aspect above in the preparation of a reagent or kit for targeted knockout of the CBr3 gene or a CBr3 gene knockout cell line.

[0021] In a fifth aspect, the present invention provides the use of the CBr3 gene in the preparation of a drug for inhibiting foot-and-mouth disease virus infection.

[0022] The beneficial effects of the present invention are as follows: ① The present invention first discovers that inhibiting the expression of the CBr3 gene in host cells can promote the replication of foot-and-mouth disease virus; ② The present invention provides an sgRNA targeting the CBr3 gene, which can specifically target the CBr3 gene, and combined with the CRISPR-Cas9 technology, knockout of the CBr3 gene in host cells can be achieved, with accurate targeting and high knockout efficiency; ③ The present invention provides a method for transfecting the sgRNA into host cells by the CRISPR-Cas9 technology to construct a cell line with loss of function of the protein encoded by the CBr3 gene; ④ The monoclonal cell line obtained according to the method of the present invention can significantly promote the replication of foot-and-mouth disease virus, improve the production amount of foot-and-mouth disease virus vaccine and the antigen expression amount, can be used as a production cell line for foot-and-mouth disease virus or virus vaccine, thereby improving the efficiency of vaccine production and reducing the production cost; at the same time, it has high specificity and controllability, provides a new technical approach for the production of high-quality, safe and effective foot-and-mouth disease vaccines, and is expected to play an important role in the field of foot-and-mouth disease prevention and control. Description of the Drawings

[0023] Figure 1 Cbr3 gene knockout strategy; wherein, A is a chromatogram schematic diagram of sgRNA targeting the Cbr3 gene region; B is an analysis diagram of gene deletion mutants of the BHK-21-KO-Cbr3 knockout cell line.

[0024] Figure 2 Results of detecting the protein level of the Cbr3 gene in the BHK-21-KO-Cbr3 knockout cell line by Western Blotting.

[0025] Figure 3 Growth curves of wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells.

[0026] Figure 4 Relative expression levels of viral mRNA after wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells are infected with foot-and-mouth disease virus.

[0027] Figure 5 Content of viral antigen 146s in wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells after infection with foot-and-mouth disease virus

[0028] Figure 6 FMDV VP1 protein level in wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells after infection with foot-and-mouth disease virus

[0029] Figure 7 Detection results of virus titer in wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells after infection with foot-and-mouth disease virus Specific implementation manners

[0030] To make the objectives, technical solutions and advantages of the present invention clearer, the following will elaborate on each embodiment of the present invention with reference to the accompanying drawings. However, those of ordinary skill in the art can understand that in each embodiment of the present invention, many technical details are provided to help readers better understand the present application. However, even without these technical details and various changes and modifications based on the following embodiments, the technical solutions claimed in the present application can still be implemented.

[0031] Definitions

[0032] The term "sgRNA" refers to guide RNA, which is a small non-coding RNA that guides the insertion or deletion of uridine residues into kinetoplastids during RNA editing.

[0033] In the present invention, sgRNA targeting the Cbr3 gene was artificially synthesized; on the basis of directly targeting and splicing the Cbr3 gene, the method of specifically knocking out the Cbr3 gene by combining CRISPR / Cas9 was used. Taking BHK-21 cells as an example, the Cbr3 gene (Cbr3 Gene ID: 106021442) was knocked out, providing a strategy for improving the production efficiency of FMDV vaccines. Although the present invention only knocked out the Cbr3 gene in BHK-21 cells to obtain a gene knockout host cell, the method described in the present invention can be inferred and extended to knock out the Cbr3 gene in other animal cells to construct a gene knockout cell line with enhanced FMDV antigen expression.

[0034] Unless otherwise specified, the experimental methods in the following examples are all conventional methods; unless otherwise specified, the test materials used in the following examples are all purchased from conventional biochemical reagent companies.

[0035] Example 1 Construction of Cbr3 gene knockout BHK-21 cell line

[0036] Query the Cbr3 gene sequence using the NCBI database. According to the CRISPR / Cas9 design principle, design the sgRNA sequence using CRISPR software (the results are as Figure 1 shown)

[0037] The targeting sequence of the sgRNA is: ATCTCAGCTTGAATGTCGAA (shown in SEQ ID NO.1);

[0038] The complementary oligonucleotides are as follows:

[0039] F: CACCGAGGCTGTGTATCGCGAGCC (shown in SEQ ID NO.2);

[0040] R: AAACGGCTCGCGATACACAGCCTC (shown in SEQ ID NO.3).

[0041] 1. Construction method

[0042] (1) Cell culture:

[0043] Culture wild-type BHK-21 cells (ATCC CCL-10) in DMEM medium containing 5% fetal bovine serum (FBS) in a humid environment at 37°C and 5% CO2. Wait until the cell viability is greater than 90% and the confluence is greater than 90% for the next experiment.

[0044] (2) Construct the sgRNA expression plasmid targeting the Cbr3 gene:

[0045] Design the complementary oligonucleotides encoding gRNA (F: CACCGAGGCTGTGTATCGCGAGCC, R: AAACGGCTCGCGATACACAGCCTC). After annealing, clone and insert them into the BsmBI site of the pSpCas9(BB)-2A-Puro (PX459) vector; obtain the pSpCas9(BB)-2A-Puro (PX459)-gRNA expression plasmid.

[0046] (3) Transfect the host cells: Transfect the constructed pSpCas9(BB)-2A-Puro (PX459)-gRNA expression plasmid into BHK-21 cells using Lipofectamine TM 2000 transfection reagent.

[0047] (4) Screening and identification: The transfected cells were screened under pressure with puromycin (6 μl / mL). The culture medium was changed every 3 days and continuously cultured for 7 days. Subsequently, the cells were transferred to a 96-well cell culture plate by the limiting dilution method for culture. When the cell confluence in each well reached 90%, the genomic DNA of the cells was extracted, and the regions 100 bp upstream and downstream of the sgRNA target site were amplified using the designed PCR primers for sequencing verification. At the same time, the expression of Cbr3 protein was detected by Western blot analysis to confirm the Cbr3 gene knockout effect.

[0048] 2. Results

[0049] By transfecting the sgRNA expression plasmid, followed by screening with puromycin and through the monoclonal screening process, finally, the expression of Cbr3 protein was detected by Western blot analysis, and the gene knockout sites were determined. The relevant results are clearly presented in Figure 1 . Among them, a specific gRNA (the forward primer sequence is F: CACCGAGGCTGTGTATCGCGAGCC, and the reverse primer sequence is R: AAACGGCTCGCGATACACAGCCTC) can efficiently knockout 6 bases (CTTCGA) near the target site after transfection.

[0050] The results of Western blot analysis further showed that in the successfully constructed Cbr3 gene knockout cell line BHK-21-KO-Cbr3, the expression level of Cbr3 protein was significantly reduced, almost achieving complete knockout, as shown in Figure 2 .

[0051] To explore the effect of knocking out the Cbr3 gene on cell growth characteristics, we conducted a comparative analysis of the growth curves of wild-type BHK-21 cells and BHK-21-KO-Cbr3 cells. The results showed that their growth curves were basically the same, as shown in Figure 3 .

[0052] Example 2 Infection of FMDV in Cbr3 Gene-Knocked-Out BHK-21 Cell Line

[0053] 1. Method

[0054] The BHK-21-KO-Cbr3 cells and wild-type BHK-21 cells constructed in the embodiment were inoculated with FMDV (O / MYA98 provided by Zhongnong Weite Biotechnology Co., Ltd.) (MOI=0.1), and cell samples were collected at 4h, 8h, 16h and other time points after infection, and total cell RNA was extracted. The mRNA expression level of FMDV was detected by RT-qPCR. Cell samples were collected 16h after infection with FMDV, and the content of FMDV antigen 146S was determined.

[0055] Western blot was performed to analyze the expression of FMDV VP1 protein, and the virus titer (TCID 50 ).

[0056] 2. Results

[0057] The relative expression of viral mRNA in wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells after infection with foot-and-mouth disease virus is shown in Figure 2 Figure 4 As shown, compared with wild-type BHK-21 cells, the relative expression level of 3D mRNA of foot-and-mouth disease virus in Cbr3 gene knockout cells BHK-21-KO-Cbr3 was significantly increased, indicating that Cbr3 gene knockout cells BHK-21-KO-Cbr3 significantly promoted the replication of foot-and-mouth disease virus.

[0058] The results of viral antigen 146s content in wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells infected with foot-and-mouth disease virus are as follows Figure 5 As shown, compared with wild-type BHK-21 cells, the content of foot-and-mouth disease virus antigen 146s in Cbr3 gene knockout cells BHK-21-KO-Cbr3 was significantly increased, indicating that Cbr3 gene knockout cells BHK-21-KO-Cbr3 significantly promoted the replication of foot-and-mouth disease virus.

[0059] The results of FMDV VP1 protein levels in wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells after infection with foot-and-mouth disease virus are shown in Figure 6 As shown, compared with wild-type BHK-21 cells, the content of VP1 protein of foot-and-mouth disease virus in Cbr3 gene knockout cells BHK-21-KO-Cbr3 was significantly increased, indicating that Cbr3 gene knockout cells BHK-21-KO-Cbr3 significantly promoted the replication of foot-and-mouth disease virus.

[0060] The results of virus titer detection after wild-type BHK-21 cells and BHK-21-KO-Cbr3 knockout cells were infected with foot-and-mouth disease virus are shown in Figure 7As shown, compared with wild-type BHK-21 cells, the virus titer of foot-and-mouth disease virus in Cbr3 gene knockout cells BHK-21-KO-Cbr3 increased significantly, indicating that Cbr3 gene knockout cells BHK-21-KO-Cbr3 significantly promoted the replication of foot-and-mouth disease virus.

[0061] In summary, the Cbr3 gene knockout cell line BHK-21-KO-Cbr3 can significantly promote the replication of FMDV.

[0062] The above results indicate that the Cbr3 gene knockout cell line can significantly promote the replication of FMDV, improve the production and antigen expression of foot-and-mouth disease virus vaccines, and can be used as a production cell line for foot-and-mouth disease virus or virus vaccines, thereby improving the efficiency of vaccine production and reducing production costs; at the same time, it has high specificity and controllability, providing a new technical approach for the production of high-quality, safe and effective foot-and-mouth disease vaccines, and is expected to play an important role in the field of foot-and-mouth disease prevention and control.

[0063] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of an agent for inhibiting or silencing CBr3 gene expression in the preparation of a foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell line.

2. The use according to claim 1, characterized in that The reagent is sgRNA targeting the CBr3 gene.

3. Application of CBr3 gene knockout cell line as a cell line for the production of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine.

4. The use according to claim 3, characterized in that The CBr3 gene knockout cell line is a CBr3 gene knockout BHK-21 cell line.

5. The use according to claim 4, characterized in that The method for constructing the CBr3 gene knockout BHK-21 cell line comprises the following steps: (1) Preparing sgRNA that specifically targets the CBr3 gene; (2) annealing the sgRNA prepared in step (1) and connecting it to the PX459 plasmid to obtain a recombinant vector that simultaneously expresses the Cas9 protein gene and the targeting sgRNA sequence; (3) The recombinant vector prepared in step (2) was transfected into BHK-21 cells, and the CBr3 gene function-deficient cell line was obtained by screening with puromycin.

6. The use according to claim 5, characterized in that The target sequence of the sgRNA targeting the CBr3 gene is: ATCTCAGCTTGAATGTCGAA.

7. The use according to claim 6, characterized in that The complementary oligonucleotides of the sgRNA are as follows: F: CACCGAGGCTGTGTATCGCGAGCC; R:AAACGGCTCCGGATACACAGCCTC.

8. A sgRNA specifically targeting the CBr3 gene, characterized in that: The target sequence of the sgRNA is: ATCTCAGCTTGAATGTCGAA.

9. Use of the sgRNA according to claim 8 in preparing a reagent or a kit for targeted knockout of the CBr3 gene or a CBr3 gene knockout cell line.

10. Application of CBr3 gene in the preparation of drugs for inhibiting foot-and-mouth disease virus infection.