Ester-producing aroma-producing yeast for making hard liquor as well as preparation method and application thereof
By screening and combining Saccharomyces cerevisiae and Pichia cerevisiae with high esters, the problem of insufficient fragrance production in medium and high temperature Daqu is solved, and the esterification ability of Daqu and the aroma and taste of the liquor are significantly improved.
Patent Information
- Application Number
- CN202510298238.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-13
- Publication Date
- 2025-06-20
AI Technical Summary
The lack of aroma production of Daqu in medium and high temperatures leads to the inability to improve the flavor quality of strong-flavored liquor.
By screening high-ester yielding Saccharomyces cerevisiae and Pichia cerevisiae, fermentation is compounded according to the optimal inoculation ratio, the esterification and aroma generation ability of Daqu are improved.
The content of ethyl acetate, ethyl hexanoate and ethyl lactate in Daqu has been significantly improved, the saccharification, liquefaction, fermentation and esterification are enhanced, and the aroma and taste of liquor are improved.
Smart Images

Figure CN120173686A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of brewing, and in particular to an ester-producing and flavor-generating Daqu and its preparation method and application. Background Art
[0002] As the starting fermentation agent of Chinese Baijiu, Daqu plays a crucial role in the brewing process of Baijiu. Daqu for Baijiu can be divided into three categories according to the highest temperature during the fermentation process: high-temperature Daqu (60 - 65°C), medium-temperature Daqu (50 - 60°C), and low-temperature Daqu (40 - 50°C), which respectively correspond to Maotai-flavor, Luzhou-flavor, and Qingxiang-flavor Baijiu. Luzhou-flavor Baijiu is one of the three main flavors of Baijiu and occupies a very high market share. Medium-high temperature Daqu, as the starting fermentation agent of Luzhou-flavor Baijiu, plays a role in saccharification fermentation and generating flavor during the brewing process. The production of Daqu has to go through steps such as raw material crushing, water addition and stirring, pressing the Qu, culturing the bacteria, fermentation, turning the Qu, etc. Among them, the fermentation step is particularly important, and the quality of fermentation directly affects the community structure and metabolic function of Daqu microorganisms. These brewing microorganisms produce a large amount of alcohol and various complex flavor substances while metabolizing the raw materials, forming the unique flavor and taste of Luzhou-flavor Baijiu.
[0003] During the fermentation process of Daqu, the diversity and activity of the microbial population are crucial. The microorganisms in Daqu mainly include molds, yeasts, lactic acid bacteria, etc. They produce enzymes and metabolites by decomposing starch, protein, and fat in the raw materials. Molds are mainly responsible for degrading starch and protein to generate sugars and amino acids; yeasts generate alcohol and carbon dioxide during the fermentation of sugars, promoting the formation of alcohol; lactic acid bacteria promote fermentation in an acidic environment and help regulate the pH value. The synergistic effect of these microorganisms determines the efficiency of Daqu fermentation, the flavor of the wine, and the formation of aroma, and is one of the key factors for the success of Daqu fermentation.
[0004] Ester-producing yeasts mainly generate ester substances through fermentation in Daqu. These ester substances make important contributions to the aroma and flavor of the wine. Esters are one of the main sources of aroma in the wine body, and can endow the wine with unique fruity, floral, or aromatic scents, enhancing the overall taste of the wine. Ester-producing yeasts generate ester compounds such as ethyl acetate and ethyl butyrate by decomposing substances such as sugars and amino acids, which not only improve the aroma level of the wine, but also reduce the sharpness of the wine to a certain extent and increase the roundness of the wine body. Therefore, the activity and species of ester-producing yeasts play a crucial role in the aroma quality of the wine during Daqu fermentation.
[0005] In recent years, with the continuous progress of brewing technology, the research and application of fortified Daqu have achieved remarkable development. By optimizing the cultivation process of Daqu and the structure of the microbial population, especially the use of fortified yeast, the fermentation efficiency and the quality of the liquor body can be significantly improved. The role of fortified yeast in Daqu fermentation is mainly reflected in enhancing the alcohol fermentation rate, increasing the liquor yield, and improving the flavor and aroma. By selecting high-ester-producing yeast or yeast strains with high temperature resistance and high alcohol concentration tolerance, more esters and aromatic compounds can be promoted to be generated, enriching the aroma level of the liquor, reducing the production of undesirable by-products, and thus improving the taste and quality of the liquor. Screening and strengthening strains from the original ecology, especially in the application of Daqu fermentation, has many benefits. First of all, the original ecological strains are usually adapted to a specific environment and can play the best role under specific fermentation conditions. Their metabolic characteristics and enzyme activities can better adapt to traditional brewing processes, thereby improving the fermentation efficiency and the quality of the liquor body. Secondly, through long-term natural selection, the original ecological strains usually have strong tolerance and anti-pollution abilities, can grow stably in a complex fermentation environment, reduce the interference of miscellaneous bacteria, and ensure the purity of fermentation. In addition, the selected specific strains often have stronger aroma-producing abilities and can produce more flavor substances (such as esters, alcohols, etc.) during fermentation, enhancing the aroma and taste levels of the liquor. Finally, using the original ecological screened strains to strengthen fermentation can also maintain and enhance the traditional flavor, making the liquor body more in line with local characteristics and the taste needs of consumers. Therefore, screening and strengthening strains from the original ecology not only improves the stability and liquor yield of the fermentation process but also effectively enhances the quality and flavor of the liquor. The application of yeast strengthening technology has greatly improved the controllability and stability of Daqu fermentation and also provided new technical support for the innovation and optimization of the Baijiu brewing industry. However, during the natural inoculation fermentation process, the types of microorganisms are uncertain, and the fermentation processes of different microorganisms are inconsistent, resulting in fluctuations in the quality of Daqu and easily leading to insufficient esterification power of aroma-producing yeast in medium-high temperature Daqu, resulting in insufficient aroma of Daqu and being unable to improve the flavor quality of Baijiu in subsequent Baijiu production. Summary of the Invention
[0006] To this end, the technical problem to be solved by the present invention is to overcome the problem in the prior art that the aroma production of medium-high temperature Daqu is insufficient and the flavor quality of Luzhou-flavor Baijiu cannot be improved.
[0007] To solve the above technical problems, the present invention provides an ester-producing and flavor-generating Daqu, a preparation method thereof, and an application thereof. Medium-high temperature Daqu mostly uses raw material fermentation. The content of microorganisms in its raw materials (such as wheat, sorghum, and peas) is very small. Although the types of microorganisms in the fermentation environment (walls and floors) are rich, most of them do not participate in the Daqu fermentation process, and the abundance of common microorganisms in Daqu fermentation is low in environmental samples. The covering material in direct contact with Daqu may be the main source of microorganisms. After the Daqu fermentation starts, each microorganism needs to first colonize and occupy the ecological niche, and then start to play a fermentation role. In this process, the colonization speed of microorganisms varies, and the amount of colonization varies, so it will lead to inconsistent fermentation processes and cause fluctuations in the quality of Daqu. Therefore, it is particularly important to add appropriate strains additionally to guide the direction of microorganism cultivation and improve the quality of Daqu. In the process of adding strains additionally, it is necessary to consider whether the strains can adapt to the fermentation environment and maintain a certain stability in the microbial flora of Daqu to continuously play a role. The present invention has screened two high-ester-producing microorganisms, Saccharomyces cerevisiae and Pichia pastoris. By compounding and fermenting Saccharomyces cerevisiae and Pichia pastoris in different proportions, it is found that the yields of ethyl acetate produced by different proportions of Saccharomyces cerevisiae and Pichia pastoris are different. According to the optimal inoculation ratio, the Daqu is intensively fermented, and the contents of ethyl acetate, ethyl hexanoate, and ethyl lactate in the prepared Daqu are greatly increased, and the saccharifying power, liquefying power, fermenting power, and esterifying power of the Daqu are also significantly improved. In addition, the present invention also finds that Pichia pastoris and Saccharomyces cerevisiae in the strengthened Daqu always maintain at a relatively high level during the fermentation process, so they can continuously play a role in Daqu fermentation and improve the ester-producing and flavor-generating ability of Daqu.
[0008] The first object of the present invention is to provide a preparation method of an ester-producing and flavor-generating Daqu, comprising the following steps:
[0009] S1. Mix and crush wheat and barley to obtain raw materials;
[0010] S2. Mix the mixed yeast with the raw materials to obtain koji materials, press the koji materials into several koji blocks, place them in the house for koji arranging, the interval between the koji blocks is 1-2 cm, and carry out fermentation to obtain the ester-producing and flavor-generating Daqu;
[0011] Wherein, the mixed yeast includes Pichia pastoris and Saccharomyces cerevisiae, the preservation number of Pichia pastoris is CICC NO.33049, and the preservation number of Saccharomyces cerevisiae is CICC NO.32165.
[0012] Further, during the fermentation process, a koji turning operation is carried out every seven days, and the gap between the koji blocks becomes smaller after each koji turning.
[0013] Further, the volume ratio of Pichia pastoris to Saccharomyces cerevisiae is (1-3):(1-3).
[0014] Further, the water addition amount of the koji material is 38 - 40%.
[0015] Further, the concentration of the mixed yeast is 10 -7 / mL, and the addition amount of the mixed yeast is 4 - 6% of the volume of the water addition amount of the koji material.
[0016] Further, the fermentation temperature is 30 - 55 °C, the relative humidity for fermentation is 60 - 80%, and the fermentation time is 33 - 35 days. Temperature and humidity can affect the fermentation effect of the koji blocks. If the relative humidity is too high, there will be too much moisture in the koji blocks, which will cause the microorganisms to grow too fast, making it difficult to control the fermentation process and prone to the phenomenon of "water pooling", resulting in lack of oxygen inside the daqu, generating bad odors, and affecting the quality of the daqu. At the same time, too high humidity may also cause mildew on the surface of the koji blocks and breed miscellaneous bacteria. If the humidity is insufficient, the moisture in the koji blocks will evaporate too fast, causing the koji blocks to dry, affecting the growth and metabolism of microorganisms, reducing the saccharifying power and fermenting power of the daqu, and reducing the generation of flavor substances, ultimately affecting the quality of the daqu.
[0017] Further, the mass ratio of the wheat to the barley is (7 - 9):(1 - 3).
[0018] Further, in step S1, the pulverized material obtained by mixing and pulverizing wheat and barley is sieved through a 40 - 60 - mesh sieve. The pulverized material passing through the 40 - 60 - mesh sieve is the undersize material, and the pulverized material not passing through the 40 - 60 - mesh sieve is the oversize material. The oversize material and the undersize material are mixed in a mass ratio of (5 - 7):(3 - 5) to obtain the raw material. The ratio of the oversize material to the undersize material of the raw material, that is, the fineness of the raw material, will affect the contact degree between the raw material and water and enzymes, and will also affect the subsequent fermentation. When the raw material is too coarse, the microorganisms do not contact the raw material sufficiently, and the fermentation efficiency is not high; when the raw material is too fine, the air permeability of the raw material becomes poor, and it is difficult to control the temperature during the fermentation process, thus affecting the fermentation efficiency.
[0019] The second object of the present invention is to provide a daqu for producing esters and generating fragrance prepared by the above - mentioned preparation method.
[0020] The third object of the present invention is to provide an application of the above - mentioned daqu for producing esters and generating fragrance in the production of white liquor.
[0021] Further, the white liquor includes Luzhou - flavor white liquor.
[0022] The beneficial effects of the present invention:
[0023] The present invention has screened two microorganisms with high ester production, namely Saccharomyces cerevisiae and Pichia pastoris. By compounding and fermenting Saccharomyces cerevisiae and Pichia pastoris in different proportions, it is found that the yields of ethyl acetate produced by different proportions of Saccharomyces cerevisiae and Pichia pastoris are different. According to the optimal inoculation ratio, the medium-high temperature Daqu is intensively fermented, and the contents of ethyl acetate, ethyl hexanoate and ethyl lactate in the prepared Daqu are greatly increased. The saccharifying power, liquefying power, fermenting power and esterifying power of Daqu are also significantly improved. In addition, the present invention also finds that Pichia pastoris and Saccharomyces cerevisiae in the intensively fermented Daqu always maintain at a relatively high level during the fermentation process. Therefore, the compounding of Pichia pastoris and Saccharomyces cerevisiae of the present invention can significantly improve the quality of Daqu and endow the liquor with mellow aroma during the fermentation of Luzhou-flavor liquor. Brief Description of the Drawings
[0024] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to the specific embodiments of the present invention in combination with the drawings, wherein
[0025] Figure 1 is the picture of the yeast after separation and purification;
[0026] Figure 2 is the comparison of the tolerance of JM-3 and JM-23 under different pH conditions; (a) pH = 3.6, (b) pH = 4, (c) pH = 4.4, (d) pH = 4.8, (e) pH = 5.2;
[0027] Figure 3 is the flow chart of the production of the intensively fermented Daqu;
[0028] Figure 4 is the comparison of the types of flavor substances before and after fermentation;
[0029] Figure 5 is the change in the number of microorganisms during fermentation;
[0030] Figure 6 is the comparison of the microbial (fungal) structure before and after intensification. Detailed Description of the Embodiments
[0031] The following further illustrates the present invention in combination with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.
[0032] Example 1: Screening and Identification of Yeast with High Ester Production and Aroma Generation
[0033] Collect the medium-high temperature Daqu on the 3rd day and the 7th day of the fermentation site of traditional Luzhou-flavor liquor manufacturers, and separately isolate yeasts by the 10-fold serial dilution method using Rose Bengal medium, and select 10 -5 、10 -6 、10-7 100 μL of each of the three gradient-diluted sample solutions was spread on a plate of Rose Bengal medium and cultured in an inverted position at 30 °C for 72 h. Single colonies with obvious colony characteristics were selected and further streaked and purified on YEPD medium for more than 3 times. After purification, they were transferred to a YEPD solid slant and stored at 4 °C for later use; After 3 batches of separation and purification experiments (the separation and purification results are shown in Figure 1 ), yeasts were obtained and examined under a microscope and observed for colony morphology.
[0034] Ten strains of yeasts obtained by primary screening were respectively inoculated into 150 mL of YEPD liquid medium and cultured in a shaker at 30 °C for 2 days. The flavor level of the fermentation broth was evaluated sensorially. "+" represents the intensity of the aroma, and the more "+" there are, the stronger the aroma. The most aromatic ones are JM-3 and JM-23.
[0035] Table 1 Sensory evaluation of the aroma of 10 strains of yeasts
[0036] Yeast number Degree of rich aroma JM-1 + JM-2 + JM-3 +++ JM-4 + JM-5 ++ JM-21 + JM-22 + JM-23 +++ JM-24 JM-25
[0037] The yeast strains JM-3 and JM-23 with the most intense aroma were selected for molecular biological identification. For JM-3, D1 / D2 region sequence analysis and identification were carried out (the sequencing primers are shown as NL1 and NL4 in Table 2), and for JM-23, ITS1 / ITS4 region sequence analysis and identification were carried out (the sequencing primers are shown in Table 2). The high-yield ester-producing and aroma-producing yeast JM-3 belongs to the genus Pichia manshurica; JM-23 is Saccharomyces cerevisiae.
[0038] Pichia manshurica was cultured in YEPD liquid medium at 30 °C for 3 days, spherical and oval in shape, of different sizes, with a diameter between 5 - 10 nm. Cultured in YEPD solid medium at 30 °C for 3 days, it is spherical, light white-gray, with a smooth surface, non-reflective, neat edges, and a tough cell wall.
[0039] Saccharomyces cerevisiae is oval or spherical, about 5 - 10 nm in size, unicellular, transparent or milky white. It reproduces asexually by budding, and the mother cell forms new daughter cells by budding. Its cell wall is composed of polysaccharides, and there is an obvious nucleus inside the cell.
[0040] Table 2 Primers and their sequences used for the identification of JM-3 and JM-23
[0041] SEQ ID Primer name Sequence SEQ ID NO.1 NL1 GCATATCAATAAGCGGAGGAAAAG SEQ ID NO.2 NL4 GGTCCGTGTTTCAAGACGG SEQ ID NO.3 ITS1 TCCGTAGGTGAACCTGCGG SEQ ID NO.4 ITS4 TCCTCCGCTTATTGATATGC
[0042] Example 2: Acid tolerance test of ester-producing and aroma-producing yeasts
[0043] Prepare 720 mL of sterilized sorghum fermentation medium with pH values of 3.6, 4, 4.4, 4.8, and 5.2 respectively. Adjust the pH with lactic acid. Inoculate the seed solutions of two strains into test tubes containing 20 mL of sorghum fermentation liquid medium with different pH gradients at an inoculation amount of 2% respectively. Incubate statically at 30 °C, sample every 24 h, and measure the cell concentration at a wavelength of 600 nm for 6 consecutive days. From Figure 2 It can be concluded that as the pH gradually decreases, when the pH is 4.8, the cell concentration of JM-23 is the lowest, indicating that the growth of the cells is inhibited under this pH condition. When the pH is lower, the cell concentration of JM-23 shows an upward trend. As the fermentation process progresses, its cell concentration first increases and then gradually decreases starting from 48 hours, indicating that pH has a certain inhibitory effect on the growth of JM-23. The cell concentration of JM-3 also first increases, but only starts to decrease after 120 h, and it grows best at pH 3.6, indicating that the growth of JM-3 is less affected by pH. It can be concluded that JM-3 has stronger acid tolerance than JM-23.
[0044] Example 3: Compound high-yield ester-producing yeast liquid
[0045] Select strains JM-3 and JM-23, and set different inoculation ratios (1:1, 2:1, 1:2, 3:1, 1:3) respectively. At the same time, set single-strain inoculation as the control group. Each group of experiments needs to be carried out under the same culture conditions to exclude the interference of external factors. Inoculate the yeast liquid into 150 mL Erlenmeyer flasks containing 80 mL of ester-producing fermentation broth at an inoculation amount of 3%, and incubate statically at 30 °C for 7 d. Use GC-MS to measure the content of esters in the fermentation broth. Evaluate the compounding effect of each group by monitoring the yield of fermentation products. Finally, through statistical analysis, the best ratio of Pichia manshurica: Saccharomyces cerevisiae is 2:1, and the highest ethyl acetate content produced at this time reaches 61.1 mg / L. That is, under this ratio, the synergistic effect of the bacterial community is the strongest, and the function of producing ethyl acetate can be maximized.
[0046] Table 3 Comparison of ethyl acetate contents at different inoculation ratios
[0047]
[0048]
[0049] Example 4: Preparation of Daqu
[0050] Two types of yeast were inoculated into the culture medium and cultured at 30 °C and 150 r / min for 24 h to obtain the seed liquid. The seed liquids of the two types of yeast were compounded and amplified at a ratio of 2:1 until the cell concentration reached 10 7 / mL for enhancement. The addition amount of the mixed bacterial liquid was 5% of the water amount for mixing the materials.
[0051] The production of fortified Daqu includes the following steps:
[0052] Raw material grading: Wheat and barley were crushed and passed through a 40-mesh sieve. The crushed materials passing through the 40-60 mesh sieve were the undersize, and the crushed materials not passing through the 40-60 mesh sieve were the oversize. The ratio of oversize to undersize was 6:4.
[0053] Fortifying liquid preparation: The yeast seed liquid was mixed with water at a volume ratio of 5%.
[0054] Qu cake pressing: It was required to press into rectangular blocks and be tightly compacted.
[0055] Room entry for fermentation: The qu cakes were placed in the room with an interval of 1-2 cm between the qu cakes. The fermentation cycle was about 33-35 days. The highest fermentation temperature could reach 55 °C, and the relative humidity for fermentation was 60-80%.
[0056] Qu turning: The qu turning operation was carried out once every week. Each time of qu turning required the gap between the qu cakes to become smaller, and heat preservation operation was carried out to make the temperature slowly drop from 55 °C to about 30 °C.
[0057] Storage out: After the fermentation was completed, sensory evaluation was carried out and then stored in the warehouse.
[0058] (5) GC-MS was used to measure the flavor of the Daqu extract after fermentation. The sample pretreatment method was as follows: 10 grams of the sample was taken, 30 mL of ultrapure water was added, and ultrasonic treatment was carried out at 4 °C for 30 minutes; then centrifugation was carried out at 4 °C for 5 minutes, the supernatant was collected and filtered using a filter with a pore size of 0.22 μm. Then, 8 mL of the filtrate, 20 μL of menthol (internal standard, concentration 100 mg / L), and 3 g of NaCl were mixed and transferred to a 20 mL headspace vial. The mixture was analyzed for flavor compounds by HS-SPME-GC-MS technology (the results were as Figure 4 shown).
[0059] The capillary chromatographic column uses a polyethylene glycol capillary column (60m × 0.25mm × 0.25μm) or other chromatographic columns with the same analytical effect. The temperature programming is set as follows: the initial temperature is 35°C, held for 1 minute; heated to 70°C at a rate of 3.0°C / min; heated to 180°C at a rate of 3.5°C / min; and finally heated to 210°C at a rate of 15°C / min and held for 6 minutes. The detector temperature is 250°C, the injection port temperature is 250°C, the constant flow mode is 1.0 mL / min, the injection volume is 1.0 μL, and the split ratio is 40:1.
[0060] The results show that the content of lipid substances in the fortified Daqu has increased significantly. Specifically, the content of ethyl acetate has increased from 23.8 mg / L before fortification to 120 mg / L, the content of ethyl lactate has increased from 11.2 mg / L to 33.8 mg / L, and the content of ethyl hexanoate has increased from 17.3 mg / L to 44.2 mg / L. This indicates that the Daqu fortified with high-yield ester-producing yeast liquid has significantly improved in the generation of flavor substances.
[0061] Table 4 Determination of flavor substances in Daqu before and after fortification
[0062] Flavor substances Before enhancement (mg / L) After enhancement (mg / L) Ethyl acetate 23.8 120 Ethyl hexanoate 11.2 33.8 Ethyl lactate 17.3 44.2
[0063] The detection of saccharifying power, liquefying power, fermenting power, and esterifying power of Daqu is carried out according to QB / T4257-2011. The detection results are shown in Table 5. The results show that the fermenting power and esterifying power of the fortified Daqu have increased significantly. The fermenting power has increased from 0.307 U before fortification to 0.854 U, and the esterifying power has increased from 363 U before fortification to 597 U. The change in indicators shows that the fortified Daqu has significantly improved in the ability to produce alcohol and esters.
[0064] Table 5 Determination of saccharifying power, liquefying power, fermenting power, and esterifying power indicators of Daqu before and after fortification
[0065] Daqu index Before enhancement (U) After enhancement (U) Saccharifying power 479 513 Liquefying power 0.738 0.854 Fermenting power 0.307 0.714 Esterifying power 363 597
[0066] The dilution plating method was used to monitor the changes in the number of yeasts, molds, and bacteria during the fermentation process. The detection method was carried out according to the GB 4789.2-2016 standard. The results are as Figure 5 shown. The results show that the number of yeasts increased rapidly within the first 3 days of fermentation and then gradually decreased. During this process, the number of yeasts inoculated with fortified Daqu was always higher than that of unfortified Daqu. The number of molds reached the maximum value on the 3rd day and then began to decline. However, no significant difference was observed between the two groups. The number of bacteria reached the maximum value during the high-fire period (the 13th day) and then gradually decreased, and no obvious difference was also seen between the two groups. Generally speaking, the number of yeasts in the fortified inoculated Daqu increased significantly, while the impact on other microbial species was relatively small.
[0067] The high-throughput sequencing technology was used to identify the microbial flora (fungi) in Daqu during the fermentation process before and after enhancement. The results are as Figure 6 shown. We found that compared with the unenhanced Daqu, the number of Saccharomyces cerevisiae in the enhanced Daqu during the fermentation process could still maintain a relatively high abundance as the fermentation progressed, and the community change of Pichia manshurica was more stable than that before enhancement. Generally speaking, the ratio of Saccharomyces cerevisiae and Pichia manshurica in the inoculated and enhanced Daqu was more coordinated, and it had stronger adaptability to the changes in the external environment as the fermentation progressed. In the later stage of fermentation, the abundances of the two yeasts could still remain at a relatively high level, which was of great significance for ester production during fermentation.
[0068] In summary, the present invention provides a method for enhancing Daqu with high-ester-producing yeasts to increase ethyl acetate. The enhanced Daqu is prepared using a compound bacterial solution, which can improve the fermentation power, esterification power, and flavor substances (ethyl acetate, ethyl lactate) of Daqu, and obtain Daqu with excellent quality and stable quality. At the same time, the preparation method of the present invention is simple and has high safety, and has good application prospects in the fields of liquor production and the like.
[0069] Obviously, the above embodiments are merely examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or variations can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or variations derived therefrom are still within the protection scope of the present invention.
Claims
1. A method for preparing ester-producing and aroma-producing Daqu, characterized in that: The following steps are involved: S1, mixing wheat and barley and grinding them to obtain a raw material; S2, mixing the mixed yeast with the raw materials to obtain koji material, and fermenting the koji material to obtain the ester-producing and aroma-producing koji; The mixed yeast comprises Pichia pastoris and Saccharomyces cerevisiae, the Pichia pastoris has a preservation number of CICC NO.33049, and the Saccharomyces cerevisiae has a preservation number of CICC NO.32165.
2. The preparation method according to claim 1, characterized in that: The volume ratio of the Pichia pastoris to the Saccharomyces cerevisiae is (1-3): (1-3).
3. The preparation method according to claim 1, characterized in that: The water content of the koji material is 38-40%.
4. The preparation method according to claim 3, characterized in that: The concentration of the mixed yeast is 10 -7 / mL, the added amount of the mixed yeast is 4-6% of the volume of the water mixed with the koji material.
5. The preparation method according to claim 1, characterized in that: In step S2, the fermentation temperature is 30-55° C., the relative humidity of the fermentation is 60-80%, and the fermentation time is 33-35 days.
6. The preparation method according to claim 1, characterized in that: The mass ratio of wheat to barley in step S1 is (7-9):(1-3).
7. The preparation method according to claim 1, characterized in that: In step S1, the ground material obtained after the wheat and barley are mixed and ground is passed through a 40-60 mesh sieve, the ground material passing through the 40-60 mesh sieve is the undersize material, and the ground material not passing through the 40-60 mesh sieve is the oversize material, and the oversize material and the undersize material are mixed in a mass ratio of (5-7): (3-5) to obtain the raw material.
8. The ester-producing and aroma-producing Daqu prepared by the preparation method according to any one of claims 1 to 7.
9. Use of the ester-producing and aroma-producing Daqu according to claim 8 in the production of liquor.
10. The use according to claim 9, characterized in that: The liquor includes Luzhou-flavor liquor.
Citation Information
Cited By
Squeezing-fermenting integrated processing device and method for instant shrimps
CN120458124A