The invention discloses a high-yield 3apos; genetic engineering strain of-deoxyadenosine and application thereof

Abstract

The invention discloses a gene engineering strain with high yield of 3 '-deoxyadenosine and application of the gene engineering strain, and belongs to the technical field of gene engineering. The genetic engineering strain is obtained by carrying out genetic modification on the strain, and the genetic modification comprises at least one of the following steps: a) overexpressing a ribonucleotide reductase gene rnr1; b) inactivating / weakening an adenosine kinase gene ad1; c) inactivating / weakening the adenine deaminase gene aah1; d) overexpressing a ribonuclease gene rny1; and e) an inactivation / weakening inhibition type vacuolar alkaline phosphatase gene pho8. According to the method, substrate metabolism kinetics is accurately matched in combination with an intermittent feeding strategy, finally, the yield of 3 '-deoxyadenosine reaches 20.58 g / L and reaches the highest yield reported at present, a'gene-process' dual-drive technical barrier is formed, and an efficient, stable and low-cost solution is provided for industrial production of nucleoside compounds.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and particularly relates to a genetically engineered strain with high yield of 3'-deoxyadenosine and its application. Background Art

[0002] 3'-deoxyadenosine, also known as cordycepin or cordycepic acid, is a nucleoside antibiotic with various pharmacological activities. However, traditional synthesis methods such as chemical synthesis and natural extraction have problems such as high cost and low efficiency, which limit its wide application. In recent years, the biosynthesis of 3'-deoxyadenosine using microbial cell factories has shown good development prospects. However, in practical applications, there is still room for optimization in the metabolic network regulation of microbial hosts: on the one hand, the synthesis of 3'-deoxyadenosine in microorganisms involves multiple metabolic pathways, and the related pathway enzymes are randomly distributed in the cell. The intermediate products need to diffuse over a long distance, resulting in insufficient precursor supply and limited metabolic flux; on the other hand, there is often a competitive relationship between the growth performance of the strain and the product accumulation, making it difficult to improve the production efficiency. Especially for eukaryotic expression systems such as yeast, although they have the ability of complete post-translational modification of proteins, their complex metabolic regulation network makes it difficult to meet the industrial production requirements in terms of product yield and conversion rate. These factors together lead to limited accumulation of 3'-deoxyadenosine in microbial hosts, which becomes the main technical obstacle restricting its industrial production. Therefore, how to regulate the growth performance of the strain and optimize the precursor supply to promote the biosynthesis of 3'-deoxyadenosine is a problem that needs to be solved by those skilled in the art. Summary of the Invention

[0003] The purpose of the present invention is to provide a genetically engineered strain with high yield of 3'-deoxyadenosine and its application, which can significantly improve the yield of 3'-deoxyadenosine by multi-gene regulation to optimize the growth performance of the strain and the precursor supply, and is suitable for industrial production.

[0004] To achieve the above purpose, the technical solution adopted by the present invention is as follows: The present invention provides a genetically engineered strain with high yield of 3'-deoxyadenosine, which is obtained by genetically modifying the strain. The genetic modification includes at least one of the following: a) Overexpressing ribonucleotide reductase gene rnr1 ; b) Inactivating / weakening adenosine kinase gene ado1 ; c) Inactivating / weakening adenine deaminase gene aah1 ; d) Overexpressing ribonuclease gene rny1 ; e) Inactivating / weakening repressive vacuolar alkaline phosphatase genepho8 。

[0005] Preferably, the strains subjected to genetic modification include strains capable of naturally producing 3'-deoxyadenosine and host strains containing exogenously introduced key enzymes for 3'-deoxyadenosine synthesis; the host strains include, but are not limited to, filamentous fungi and yeasts, and the yeasts include, but are not limited to, Saccharomyces cerevisiae, Pichia pastoris, and Yarrowia lipolytica. Preferably, Saccharomyces cerevisiae BY4742 containing exogenously introduced key enzymes for 3'-deoxyadenosine synthesis (keto-deoxyadenosine reductase and adenylic acid dephosphatase) Saccharomyces cerevisiae BY4742.

[0006] Preferably, the genetic modification further includes modifying genes encoding proteins with the same catalytic function in the strain, and the protein sequence similarity is greater than 50%, 60%, 70%, 80%, 90%, 95%, 98%.

[0007] Preferably, the ribonucleotide reductase gene rnr1 and the ribonuclease gene rny1 are driven by any one of the strong promoters PGK1, TEF1, GPD, TPI1, ADH1, or TDH3, preferably TDH3.

[0008] The present invention also provides the use of the above genetic engineering strains in the preparation of 3'-deoxyadenosine. 3'-Deoxyadenosine is prepared from the fermentation culture of the genetic engineering strains constructed by the present invention.

[0009] Preferably, the method for preparing 3'-deoxyadenosine includes: inoculating the genetic engineering strain into a fermentation medium and fermenting at 20-40 °C for 48-220 h; the fermentation medium includes a carbon source of 10-100 g / L, a nitrogen source of 10-50 g / L, adenine of 0-15 g / L, and hypoxanthine of 0-15 g / L.

[0010] More preferably, the carbon source is glucose, and the nitrogen source is yeast extract and / or peptone.

[0011] More preferably, strains with inactivated / attenuated adenine deaminase gene aah1 are all fermented using hypoxanthine instead of adenine as a substrate, and the concentration of hypoxanthine is 0.1-15 g / L.

[0012] Preferably, the method for preparing 3'-deoxyadenosine includes: after activating and culturing the genetically engineered strain, inoculating it into a 5 L fermenter containing a fermentation medium. The parameters of the 5 L fermenter are controlled as follows: 28 - 30 °C, stirring speed of 200 - 1000 rpm, aeration rate of 2 - 7, liquid volume of 1 - 3 L, pH of 4 - 7, dissolved oxygen maintained at 1 - 70%. More preferably, the temperature is 30 °C, the stirring speed is 600 rpm, the aeration rate is 6, the liquid volume is 2 L, pH is 5.5 ± 0.1, and the dissolved oxygen is maintained at 30%. After the carbon source in the fermentation broth is exhausted, intermittent feeding is carried out, and during the feeding process, the carbon source concentration in the fermentation broth is maintained at 0 - 15 g / L, and fermentation is carried out for 220 h. The fermentation medium includes 50 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, 1 g / L adenine, and 1 g / L hypoxanthine. The feeding medium used for feeding is 200 - 600 g / L glucose, 0 - 15 g / L adenine, and 0 - 15 g / L hypoxanthine. More preferably, it is 400 g / L glucose, 3 g / L adenine, and 3 g / L hypoxanthine.

[0013] The above fermentation process can make the cell density (measured by OD 600 ) of the genetically engineered strain be above 30.

[0014] More preferably, the genetically engineered strain is obtained by genetically modifying Saccharomyces cerevisiae BY4742 containing the key enzyme for 3'-deoxyadenosine synthesis introduced exogenously. The genetic modification is to overexpress the ribonucleotide reductase gene S. cerevisiae and the ribonuclease gene rnr1 and at the same time inactivate / weaken the adenosine kinase gene rny1 , the adenine deaminase gene ado1 , and the repressive vacuolar alkaline phosphatase gene aah1 . pho8

[0015] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in: (1) By expressing the ribonucleotide reductase gene and inactivating / weakening the adenosine kinase gene, the present invention significantly improves the growth performance of the strain, and increases the biomass and stress resistance of the strain during fermentation; (2) By inactivating / weakening the adenine deaminase gene, overexpressing the ribonuclease gene, and inactivating the repressive vacuolar alkaline phosphatase gene, the present invention significantly improves the supply efficiency of precursors; (3) By combining the fed-batch strategy to precisely match the substrate metabolism kinetics, the yield of 3'-deoxyadenosine finally reached 20.58 g / L, achieving the highest yield reported so far, forming a technical barrier driven by both "gene-process", and providing an efficient, stable and low-cost solution for the industrial production of nucleoside compounds. Description of the Drawings

[0016] Figure 1 Yields of 3'-deoxyadenosine by single-gene modification and combined-gene modification in Examples 1, 3, 4, 5 and 6.

[0017] Figure 2 Yield of 3'-deoxyadenosine after fed-batch fermentation of recombinant strain B5U3-20 in a 5 L fermenter in Example 7.

[0018] Figure 3 Precipitation of 3'-deoxyadenosine crystals in the fermentation broth in Example 7. Detailed Description of the Invention

[0019] According to the following examples, the present invention can be better understood. However, those skilled in the art can easily understand that the content described in the examples is only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0020] Example 1 Preliminary verification of the effectiveness of five gene modifications (single-gene modification) In this application, the EC number (Enzyme Commission number) of ribonucleotide reductase is 1.17.4.1; the EC number of adenosine kinase is 2.7.1.20; the EC number of adenine deaminase is 3.5.4.2; the EC number of ribonuclease is 4.6.1.19; the EC number of repressed vacuolar alkaline phosphatase is 3.1.3.1.

[0021] Among them, RNR1 is the core catalytic subunit of ribonucleotide reductase, responsible for reducing ribonucleotides (NTPs) to deoxyribonucleotides (dNTPs). Overexpression rnr1 can accelerate the cell cycle process and shorten the doubling time, thereby improving the growth performance of the strain and increasing the biomass; ADO1 catalyzes the phosphorylation of adenosine to generate adenosine monophosphate (AMP), while consuming ATP to generate ADP. This reaction is a core step in the salvage synthesis pathway of purine nucleotides, responsible for recycling free adenosine to maintain the intracellular AMP / ADP / ATP balance. 3'-Deoxyadenosine is highly similar to adenosine in structure but lacks the 3'-hydroxyl group (3'-OH). When 3'-deoxyadenosine enters the cell, ADO1 phosphorylates it to generate 3'-deoxyadenosine monophosphate (3'-dAMP), which can be further phosphorylated to form 3'-deoxyadenosine triphosphate (3'-dATP). As an analogue of ATP, 3'-dATP can competitively bind to RNA polymerase and participate in the elongation of the mRNA chain. However, due to the absence of 3'-OH, it is unable to form a phosphodiester bond, resulting in the premature termination of mRNA synthesis (chain termination effect), which will block the mRNA synthesis of key genes and cause cell metabolic disorders; abnormal nucleotide incorporation into the DNA strand interferes with replication and repair; the futile phosphorylation reaction consumes ATP, exacerbating the intracellular energy crisis. This toxic mechanism is the core reason for the anti-tumor and antiviral activities of 3'-deoxyadenosine, but it also has a negative impact on the host strain itself, limiting its survival rate and final yield in high-concentration fermentation. Therefore, knocking out ado1 the gene can enhance the growth performance and product tolerance of the engineered strain by blocking the self-toxicity pathway of 3'-deoxyadenosine, optimizing energy metabolism and nucleotide balance; AAH1 catalyzes the deamination of adenine to generate hypoxanthine. When adenine is used as a substrate, adenine can be utilized through the direct salvage pathway and the indirect deamination pathway. To block the loss of precursors caused by the deamination reaction, an attempt was made to knock out aah1 , but it was found that the production of 3'-deoxyadenosine decreased by about 50%. Further metabolic analysis showed that aah1 after knocking out, the excessive accumulation of adenine would trigger the feedback inhibition of AMP and oxidative stress. Therefore, the strategy of replacing adenine with hypoxanthine was adopted, which not only avoided the deamination pathway but also eliminated the metabolic inhibition; Rny1 can hydrolyze RNA in the vacuole to generate 3'-AMP (a precursor for the synthesis of 3'-deoxyadenosine). Therefore, overexpressing rny1 can optimize the supply of precursors for 3'-deoxyadenosine; Pho8 catalyzes the conversion of 3'-NMP to nucleoside. Therefore, knocking out this gene can block the degradation pathway of the 3'-deoxyadenosine precursor (3'-AMP), reduce the futile loss of intermediate products, and thus improve the synthesis efficiency of 3'-deoxyadenosine.

[0022] The primer sequences used in this example for single-gene modification and verification are shown in Table 1.

[0023] Table 1 Sequences of the primers used in this example

[0024] 1. Using the engineered Saccharomyces cerevisiae strain B5U3 containing exogenously introduced key enzymes for 3'-deoxyadenosine synthesis and with modifications (3'-deoxyadenosine production of 2.92 g / L) as the starting strain, verify whether overexpression of the ribonucleotide reductase gene rnr1 is effective Using the genome of Saccharomyces cerevisiae S. cerevisiae strain BY4742 as a template, the ribonucleotide reductase gene was amplified using RNR1-F / RNR1-R as primers rnr1 , the promoter sequence TDH3 was amplified using TDH3-RNR1-F / TDH3-RNR1-R as primers, and the terminator sequence ADH1 was amplified using ADH1-F / ADH1-R as primers; using the primers TDH3-RNR1-F / ADH1-R, the above amplified fragments were overlapped to obtain rnr1 an expression cassette. It was integrated into the site X-3 on the genome that does not affect the growth of Saccharomyces cerevisiae strains. Using the genome of Saccharomyces cerevisiae S. cerevisiae strain BY4742 as a template, the upstream homologous fragment X-3-up of the X-3 site was amplified using the primers X-3-up-F / X-3-up-R, and the downstream homologous fragment X-3-down of the X-3 site was amplified using the primers X-3-down-F / X-3-down-R. Then, using X-3-up-F / X-3-down-R as primers, the upstream homologous fragment X-3-up, the downstream homologous fragment X-3-down, and rnr1 the expression cassette were used as templates for overlap to obtain an rnr1 expression frame with homologous fragments. The relevant primer sequences are shown in Table 1.

[0025] The N20 sequence of the X-3 site is CTAATGTGTCCGCGTTTCTA. Design its N20 primers, namely X-3-F / X-3-R. The primer sequences are shown in Table 1. Annealing amplification was carried out using the primers as templates. The 10 μL reaction system: 1 μL of X-3-F, 1 μL of X-3-R, 1 μL of 10× ligase buffer, and 7 μL of ddH2O. The PCR program was: 94°C for 5 min. After annealing amplification, the system was diluted 10 times to obtain the N20 fragment. The N20 fragment and the linear vector fragment pCas9-Hyg were ligated overnight using Novoprotein's T4 ligase. The ligated product was transformed into the competent cells of Trans1T1 by heat shock, cultured overnight, and transformants were picked for sequencing. Finally, the CRISPR / Cas9 tool plasmid pCas9-Hyg-X-3 was obtained.

[0026] The B5U3 strain was cultured in an incubator at 30 °C for 48 hours. Single colonies were picked for activation to prepare competent cells. The pCas9-Hyg-X-3 plasmid and the rnr1 expression cassette containing the homologous fragment of the X-3 site were transformed at a mass ratio of 300 ng: 1500 ng using the electroporation method. Transformants were screened using solid yeast extract peptone dextrose (YPD) medium containing 400 mg / L hygromycin (HygR). The transformants were verified by PCR. The correctly verified strains were inoculated into the fermentation medium for fermentation, and the strain was named B5U3-1. The fermentation medium was: glucose 50 g / L, yeast extract 10 g / L, peptone 20 g / L, adenine 1 g / L. It was cultured at 30 °C and 220 rpm for 144 h.

[0027] The production of 3'-deoxyadenosine was detected using a high-performance liquid chromatograph. The method for analyzing 3'-deoxyadenosine was as follows: 3'-deoxyadenosine in the supernatant of the fermentation broth was separated and quantitatively determined using an Agilent 1260 Infinity II high-pressure liquid chromatograph equipped with an ultraviolet detector (VWD). The chromatographic column used was ZORBAX SB-Aq, the mobile phase was 2% acetonitrile and 98% of 3‰ trifluoroacetic acid, the flow rate was 0.8 mL / min, the column oven was set at 40 °C, and the absorbance was 260 nm. The sample was centrifuged at 13000 rpm / min for 5 min, and the supernatant was filtered through a 0.22 μm membrane to remove impurities and used for analysis. The yield of the B5U3-1 strain was 3.29 g / L (the results are as Figure 1 shown), where the OD 600 of B5U3 was 30.8, and the OD 600 of B5U3-1 increased to 36.4, proving the effectiveness of overexpression rnr1 to increase biomass, thus promoting the yield of 3'-deoxyadenosine.

[0028] 2. Using B5U3 as the starting strain to verify the inactivation of the adenosine kinase gene ado1 Whether it is effective Using the genome of the Saccharomyces cerevisiae S. cerevisiae BY4742 strain as a template, PCR was performed using the primers ADO1-knockout-up-F / ADO1-knock out-up-R to amplify the upstream homologous arm sequence of the deletion ado1 ; the primers ADO1-knock out-down-F / ADO1-knock out-down-R were used to obtain the deletion ado1The lower homologous arm sequence; using the above and lower homologous arm sequences as templates, the ADO1-knock out-up-F / ADO1-knock out-down-R primers are used for overlap to obtain the inactivated ado1 homologous fragment. The primer sequences used above are shown in Table 1. Select ado1 The N20 sequence of is AAGACTGTCATCTTCACCCA. Design its N20 primer, which is ADO1-F / ADO1-R. The primer sequences are shown in Table 1. Use the same construction method as above to obtain the plasmid pCas9-Hyg-ADO1. Inactivate the gene ado1 using the same transformation method as above to obtain the recombinant strain B5U3-2. Using the same fermentation method and detection method as above, the 3'-deoxyadenosine yield of the recombinant strain B5U3-2 is 3.38 g / L (the results are as Figure 1 shown).

[0029] 3. Using B5U3 as the starting strain to verify the inactivation of the adenine deaminase gene aah1 whether it is effective Using the genome of the Saccharomyces cerevisiae S. cerevisiae BY4742 strain as a template, use the primers AAH1-knockout-up-F / AAH1-knock out-up-R for PCR to amplify and obtain the deletion of aah1 the upper homologous arm sequence; use the primers AAH1-knock out-down-F / AAH1-knock out-down-R to obtain the lower homologous arm sequence of the deleted AAH1; using the above and lower homologous arm sequences as templates, use the AAH1-knock out-up-F / AAH1-knock out-down-R primers for overlap to obtain the inactivated aah1 homologous fragment. The primer sequences used above are shown in Table 1. Select aah1 The N20 sequence of is TATCAACAGTCAATACGACG. Design its N20 primer, which is AAH1-F / AAH1-R. The primer sequences are shown in Table 1. Use the same construction method as above to obtain the plasmid pCas9-Hyg-AAH1. Inactivate the gene aah1 using the same transformation method as above to obtain the recombinant strain B5U3-3. Using the same fermentation method and detection method as above, the 3'-deoxyadenosine yield of the recombinant strain B5U3-3 is 1.61 g / L (the results are as Figure 1 shown).

[0030] 4. Using B5U3 as the starting strain to verify the overexpression of the ribonuclease gene rny1 whether it is effective Using Saccharomyces cerevisiae S. cerevisiaeUsing the genome of strain BY4742 as a template, the ribonuclease gene was amplified with primers RNY1-F / RNY1-R rny1 , the promoter sequence TDH3 was amplified with primers TDH3-RNY1-F / TDH3-RNY1-R, and the terminator sequence CYC1 was amplified with CYC1-F / CYC1-R; using primers TDH3-RNY1-F / CYC1-R, the fragments amplified above were overlapped to obtain rny1 the expression cassette. It was integrated into locus 511b on the genome that does not affect the growth of Saccharomyces cerevisiae strains. Using Saccharomyces cerevisiae S. cerevisiae The genome of BY4742 was used as a template. The upstream homologous fragment 511b-up of locus 511b was amplified with primers 511b-up-F / 511b-up-R, and the downstream homologous fragment 511b-down of locus 511b was amplified with primers 511b-down-F / 511b-down-R. Then, using 511b-up-F / 511b-down-R as primers, the upstream homologous fragment 511b-up, the downstream homologous fragment 511b-down, and rny1 the expression cassette were used as templates for overlap to obtain the rny1 expression frame with homologous fragments. The relevant primer sequences are shown in Table 1. The N20 sequence of 511b is CAGTGTATGCCAGTCAGCCA. Its N20 primers, 511b-F / 511b-R, were designed, and the primer sequences are shown in Table 1. The plasmid pCas9-Hyg-511b was obtained using the same construction method as above. Using the same transformation method as above for overexpression rny1 , the recombinant strain B5U3-4 was obtained. Using the same fermentation method and detection method as above, the yield of 3'-deoxyadenosine of the recombinant strain B5U3-4 was 3.1 g / L (the results are as Figure 1 shown).

[0031] 5. Using B5U3 as the starting strain to verify whether inactivating the repressive vacuolar alkaline phosphatase gene pho8 is effective Using the genome of Saccharomyces cerevisiae S. cerevisiae strain BY4742 as a template, PCR was performed with primers PHO8-knockout-up-F / PHO8-knock out-up-R to amplify the upstream homologous arm sequence of the deletion pho8 ; using primers PHO8-knock out-down-F / PHO8-knock out-down-R to obtain the downstream homologous arm sequence of the deletion pho8 ; using the upstream and downstream homologous arm sequences as templates, overlap was performed with primers PHO8-knock out-up-F / PHO8-knock out-down-R to obtain the inactivatedpho8 homologous fragment. The primer sequences used above are shown in Table 1. Select pho8 The N20 sequence of is CAAACCAATACAGACCACAG, and its N20 primer, PHO8-F / PHO8-R, was designed. The primer sequences are shown in Table 1. The plasmid pCas9-Hyg-PHO8 was obtained using the same construction method as above. Inactivate the gene pho8 using the same transformation method as above, and the recombinant strain B5U3-5 was obtained. Using the same fermentation method and detection method as above, the 3'-deoxyadenosine yield of the recombinant strain B5U3-5 was 3.36 g / L (the results are as Figure 1 shown).

[0032] Example 2 Production of 3'-deoxyadenosine using hypoxanthine as a substrate In Example 1, the inactivation of aah1 resulted in a 45% reduction in the 3'-deoxyadenosine yield of the strain B5U3-3. In-depth analysis from the perspective of metabolic network regulation: Adenine is metabolized in vivo through two parallel pathways: one is directly catalyzed by APRT (adenine phosphoribosyltransferase) to generate AMP, and the other is catalyzed by aah1 to be deaminated and converted into hypoxanthine. aah1 After inactivation, this balance is broken. The single APRT metabolic pathway of adenine, due to its inherent inefficiency and strong AMP feedback inhibition, leads to insufficient precursor supply, resulting in a significant reduction in the overall efficiency of the 3'-deoxyadenosine biosynthesis pathway. Therefore, using hypoxanthine as a substrate to produce 3'-deoxyadenosine, this modification restored and increased the yield of the strain B5U3-3 to 3.21 g / L. Therefore, in subsequent examples, the fermentation of strains in which aah1 is inactivated all used hypoxanthine instead of adenine as a substrate for fermentation. In individual experiments, it was observed that when the concentration of hypoxanthine was 0.1 - 15 g / L, the 3'-deoxyadenosine yield reached 3 - 10 g / L.

[0033] Example 3 Double-gene combination modification Using the B5U3-1 strain in Example 1 as the chassis strain, the B5U3-1 strain was plated after being passaged 3 - 4 times. Single colonies that grew on the antibiotic-free YPD plate but not on the YPD plate containing 400 mg / L hygromycin (HygR) were picked. This proved that the CRISPR / Cas9 tool plasmid had been lost. The corresponding single colonies were activated and modified for another 4 genes according to the construction method described in Example 1. Inactivate ado1 to obtain the recombinant strain B5U3-6, inactivate aah1 to obtain the recombinant strain B5U3-7, overexpress rny1 to obtain the recombinant strain B5U3-8, inactivatepho8 The recombinant strain B5U3-9 was obtained. Using the same fermentation and detection methods as in Example 1 and Example 2, the yields of 3'-deoxyadenosine of the recombinant strains B5U3-6, 7, 8, and 9 were 3.43, 3.28, 3.41, and 3.47 g / L, respectively (the results are as Figure 1 shown).

[0034] Example 4 Triple-gene combination modification Using the B5U3-1 strain in Example 1 as the chassis strain, the following modifications were carried out respectively: simultaneously inactivating ado1 and aah1 ; simultaneously overexpressing rny1 and inactivating pho8 ; simultaneously inactivating ado1 and pho8 ; simultaneously inactivating ado1 and overexpressing rny1 ; simultaneously inactivating aah1 and pho8 ; simultaneously inactivating aah1 and overexpressing rny1 . The recombinant strains B5U3-10, B5U3-11, B5U3-12, B5U3-13, B5U3-14, and B5U3-15 were obtained respectively. Using the same fermentation and detection methods as in Example 1 and Example 2, the yields of 3'-deoxyadenosine of the recombinant strains B5U3-10, 11, 12, 13, 14, and 15 were 3.63, 4.16, 4.03, 3.39, 3.76, and 3.84 g / L, respectively (the results are as Figure 1 shown).

[0035] Example 5 Quadruple-gene combination modification Using the B5U3-1 strain in Example 1 as the chassis strain, the following modifications were carried out respectively: simultaneously inactivating ado1 and pho8 , and overexpressing rny1 ; simultaneously inactivating aah1 and pho8 , and overexpressing rny1 ; simultaneously inactivating ado1 , aah1 and pho8 ; simultaneously inactivating ado1 and aah1 , and overexpressing rny1 . The recombinant strains B5U3-16, B5U3-17, B5U3-18, and B5U3-19 were obtained respectively. Using the same fermentation and detection methods as in Example 1 and Example 2, the yields of 3'-deoxyadenosine of the recombinant strains B5U3-16, 17, 18, and 19 were 3.51, 3.74, 4.42, and 3.76, respectively (the results are as Figure 1 shown).

[0036] Example 6 Modification of Five-Gene Combination Using the B5U3-1 strain in Example 1 as the chassis strain, inactivate ado1 , aah1 and pho8 simultaneously, and overexpress rny1 . The recombinant strain B5U3-20 is obtained. Using the same fermentation and detection methods as in Example 1 and Example 2, the yields of 3'-deoxyadenosine of the recombinant strain B5U3-20 are 4.39 g / L respectively (the results are as shown in Figure 1 ). In individual experiments, the highest yield of 3'-deoxyadenosine was observed to reach 10 g / L. After multi-gene co-transformation, the yield of 3'-deoxyadenosine of the engineered strain reached 4.39 g / L, which was significantly increased by 50.3% compared with the original strain (2.92 g / L), proving that the genetic modification strategy can effectively break through the metabolic bottleneck.

[0037] Example 7 Fermentation of 3'-Deoxyadenosine by the Engineered Saccharomyces cerevisiae Strain B5U3-20 in a 5 L Fermenter Use the recombinant strain B5U3-20 for fermentation in a 5 L fermenter. Pick a single colony and inoculate it into 5 mL of YPD liquid medium, and place it in a shaker at 30 °C and 220 rpm for 18 h. Transfer it to 200 mL of YPD liquid medium according to an inoculation ratio of 5% v / v, and place it in a shaker at 30 °C and 220 rpm for 16 h, and then transfer it to the fermentation medium. The formula of the fermentation medium is: glucose 50 g / L, yeast extract 10 g / L, peptone 20 g / L, adenine 1 g / L, hypoxanthine 1 g / L. The adenine and hypoxanthine are precursors. The feeding medium is 400 g / L glucose, 3 g / L adenine, and 3 g / L hypoxanthine. The parameters of the 5 L fermenter are controlled as follows: the temperature is 30 °C, the stirring speed is 600 rpm, the aeration rate is 6, the liquid volume is 2 L, the pH is 5.5 ± 0.1, and the dissolved oxygen is maintained at about 30%. After the carbon source in the fermentation broth is exhausted, intermittent feeding is carried out, and the carbon source concentration in the fermentation broth is maintained at 0-5 g / L during the feeding process, and the fermentation lasts for 220 h. The results show that the yield of 3'-deoxyadenosine of the engineered strain in the 5 L fermenter is 20.58 g / L, and the OD 600 reaches 140 (the results are as shown in Figure 2 ). After the fermentation broth is placed for a period of time, crystal precipitation layers of 3'-deoxyadenosine are observed (as shown in Figure 3 ).

[0038] The present invention provides a genetically engineered strain for increasing the production of 3'-deoxyadenosine by regulating multi-gene metabolism and its application. There are various ways and methods to implement this technical solution, and the above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this field, on the basis of not departing from the fundamental principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications are naturally included in the protection scope of the present invention. Each component not described in detail in this embodiment can be implemented with the help of existing technology.

Claims

1. A genetically engineered strain with high yield of 3'-deoxyadenosine, characterized in that: The strain is obtained by genetically modifying the strain, wherein the genetic modification includes at least one of the following: a) Overexpression of ribonucleotide reductase gene rnr1 ; b) Inactivation / weakening of adenosine kinase gene ado1 ; c) Inactivation / weakening of adenine deaminase gene aah1 ; d) Overexpression of ribonuclease gene rny1 ; e) Inactivation / weakening of the repressible vacuolar alkaline phosphatase gene pho8 .

2. The genetically engineered strain according to claim 1, characterized in that The genetically modified strains include strains capable of naturally producing 3'-deoxyadenosine and host strains containing exogenously introduced key enzymes for 3'-deoxyadenosine synthesis; the host strains include filamentous fungi and yeast, and the yeast include Saccharomyces cerevisiae, Pichia pastoris and Yarrowia lipolytica.

3. The genetically engineered strain according to claim 1, characterized in that The ribonucleotide reductase gene rnr1 and ribonuclease genes rny1 Expression is driven by any of the strong promoters PGK1, TEF1, GPD, TPI1, ADH1 or TDH3.

4. Use of the genetically engineered strain according to any one of claims 1 to 3 in the preparation of 3'-deoxyadenosine.

5. The use according to claim 4, characterized in that: The method for preparing 3'-deoxyadenosine comprises: inoculating the genetically engineered strain into a fermentation medium and fermenting and culturing at 20-40°C for 48-220 hours; the fermentation medium comprises 10-100 g / L of a carbon source, 10-50 g / L of a nitrogen source, 0-15 g / L of adenine and 0-15 g / L of hypoxanthine.

6. The use according to claim 5, characterized in that: Inactivation / weakening of adenine deaminase gene aah1 The strains all used hypoxanthine instead of adenine as substrate for fermentation, and the concentration of hypoxanthine was 0.1~15 g / L.

7. The use according to claim 4, characterized in that: The method for preparing 3'-deoxyadenosine comprises: activating and culturing the genetically engineered strain, and then inoculating the strain into a 5 L fermentation tank containing a fermentation medium, wherein the parameters of the 5 L fermentation tank are controlled as follows: the temperature is 28-30°C, the stirring speed is 200-1000 rpm, the ventilation volume is 2-7, the liquid volume is 1-3 L, the pH is 4-7, the dissolved oxygen is maintained at 1-70%, and after the carbon source in the fermentation liquid is exhausted, intermittent feeding is performed, and the carbon source concentration in the fermentation liquid is maintained at 0-15 g / L during the feeding process, and the fermentation is performed for 220 hours; the fermentation medium comprises 50 g / L of glucose, 10 g / L of yeast extract, 20 g / L of peptone, 1 g / L of adenine and 1 g / L of hypoxanthine, and the feeding medium used for the feeding comprises 200-600 g / L of glucose, 0-15 g / L of adenine and 0-15 g / L of hypoxanthine.

8. The use according to claim 7, characterized in that: The parameters of the 5 L fermenter were controlled as follows: temperature of 30°C, stirring speed of 600 rpm, aeration of 6, liquid volume of 2 L, pH of 5.5±0.1, and dissolved oxygen maintained at 30%; the feed medium used for the feed was 400 g / L glucose, 3 g / L adenine, and 3 g / L hypoxanthine.

9. The use according to claim 8, characterized in that: The genetically engineered strain is obtained by introducing a key enzyme for 3′-deoxyadenosine synthesis into the yeast Saccharomyces cerevisiae. S.cerevisiae BY4742 was obtained by genetic modification, wherein the genetic modification was to overexpress the ribonucleotide reductase gene rnr1 and ribonuclease genes rny1 And at the same time inactivate / weaken the adenosine kinase gene ado1 , adenine deaminase gene aah1 and repressible vacuolar alkaline phosphatase gene pho8 .

Images