Application of double-cavity probiotic intervention in colon cancer chemotherapy and intestinal tract and genital tract flora

Abstract

The invention discloses application of double-cavity probiotic intervention in colon cancer chemotherapy and intestinal tract and genital tract flora, and relates to the technical field of biological medicine. The bifidobacterium longum subsp. Longum NCU-05 is preserved in the China General Microbiological Culture Collection Center (CGMCC) on January 18, 2023, and the preservation number is CGMCC NO.26492; the lactobacillus crispatus NCU-28 is preserved in the China General Microbiological Culture Collection Center on July 22, 2024, and the preservation number of the lactobacillus crispatus NCU-28 is CGMCC NO.31387. The lactobacillus crispatus NCU-28 has been preserved in the China General Microbiological Culture Collection Center. The traditional Chinese medicine composition has the beneficial effects that intestinal tract and genital tract flora imbalance after colon cancer chemotherapy can be improved, and the traditional Chinese medicine composition can be used as an auxiliary medicine for treating colon cancer. The bifidobacterium longum subsp. Longum and the lactobacillus crispatus are administered through a bidirectional crosstalk cavity of intestinal-vaginal microbiota in a combined medication form, so that the intestinal tract and genital tract dysbacteriosis after colon cancer chemotherapy is effectively improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of dual-chamber probiotic intervention in colon cancer chemotherapy and intestinal and genital tract flora. Background Art

[0002] Colon cancer refers to the malignant lesions that occur in the colorectal mucosal epithelium or glands under the action of various carcinogenic factors such as environment or genetics. Statistical data shows that colon cancer is one of the most common digestive tract malignant tumors in the world, and its incidence rate ranks among the top three globally, second only to gastric cancer and lung cancer. In China, with the improvement of the national living standard, the change of diet structure and habits, and the increasing severity of food safety hazards, the incidence rate of colon cancer shows an increasing and younger trend year by year, and the median onset age is ten years earlier than that in Europe and America. Colon cancer has a hidden onset and often has no obvious early clinical manifestations. Most patients have reached the middle and late stages at the time of clinical diagnosis, and distal metastasis already exists, seriously endangering the life, health and safety of patients. The generally recognized method for treating colon cancer is a comprehensive treatment mainly based on surgery, supplemented by chemotherapy, immunotherapy, traditional Chinese medicine and other supportive treatments. Except for some early-stage patients, patients in the advanced stage and those after surgical resection need to receive chemotherapy. Chemotherapy is another important treatment measure in the comprehensive treatment of colon cancer after surgical treatment. 5-fluorouracil is a clinically recognized effective first-line drug for colorectal cancer chemotherapy and belongs to antimetabolites. Its main mechanism of action is to be converted into the active metabolite fluorodeoxyuridine monophosphate (FdUMP) in the body through the action of related metabolic enzymes. The latter binds to thymidylate synthase (TS) to reduce the free TS, so that deoxyguanylic acid (dUMP) cannot generate deoxythymidylate (dTMP), resulting in reduced DNA synthesis.

[0003] Chemotherapy plays an irreplaceable important role in the comprehensive treatment of tumors. However, while chemotherapy drugs kill tumor cells, they also have a killing effect on rapidly dividing normal cells. For example, intestinal epithelial cells and immune cells are also severely damaged, causing intestinal mucosal injury, manifested as symptoms such as nausea, vomiting, abdominal pain and diarrhea. In severe cases, necrotizing enteritis occurs, with bloody stools, shock, electrolyte disorders, etc., endangering life. The damage of chemotherapy drugs to the intestinal mucosa severely limits their clinical application, which is mainly reflected in the destruction of the intestinal barrier function. For example, 5-FU can directly kill normal bacteria in the intestinal lumen, resulting in a significant reduction in the main probiotic Bifidobacterium, while the numbers of Enterobacter and Enterococcus increase significantly. This increases the facultative anaerobes in the large intestine lumen, reduces the number of colonized normal flora, weakens the colonization antagonistic ability, and intestinal lumen bacteria can be detected in the draining mesenteric lymph nodes. Summary of the Invention

[0004] The object of the present invention is to solve at least one of the technical problems existing in the prior art, and to provide the application of dual-chamber probiotic intervention in colon cancer chemotherapy and intestinal and genital tract flora. The technical solution of the present invention is as follows: In a first aspect, the present invention provides the application of dual-chamber probiotic intervention in colon cancer chemotherapy and intestinal and genital tract flora. The dual-chamber probiotics include Bifidobacterium longum subsp. longum ( Bifidobacterium longum subsp . longum ) NCU-05 and Lactobacillus crispatus ( Lactobacillus crispatus ) NCU-28; wherein, Bifidobacterium longum subsp. longum NCU-05 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on January 18, 2023, with the deposit number CGMCC NO.26492; Lactobacillus crispatus NCU-28 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on July 22, 2024, with the deposit number CGMCC NO.31387.

[0005] In a second aspect, the present invention provides the application of the above-mentioned dual-chamber probiotic intervention in colon cancer chemotherapy and intestinal and genital tract flora. Bifidobacterium longum subsp. longum NCU-05 is administered through the intestine, and Lactobacillus crispatus NCU-28 is administered through the vagina. Preferably, the application includes preparing a combined drug for improving the imbalance of intestinal and genital tract flora after colon cancer chemotherapy with Bifidobacterium longum subsp. longum NCU-05 and Lactobacillus crispatus NCU-28 as active ingredients.

[0006] In a third aspect, the present invention provides a biological preparation, which includes biological preparation A and biological preparation B. The active ingredient of biological preparation A includes Bifidobacterium longum subsp. longum NCU-05, and the active ingredient of biological preparation B includes Lactobacillus crispatus NCU-28. Biological preparation A is administered through the intestine, and biological preparation B is administered through the vagina.

[0007] In a fourth aspect, the present invention provides an adjuvant drug for the treatment of colon cancer, which includes adjuvant drug A and adjuvant drug B. The active ingredient of adjuvant drug A includes Bifidobacterium longum subsp. longum NCU-05, and the active ingredient of adjuvant drug B includes Lactobacillus crispatus NCU-28. The adjuvant drug further includes a drug carrier and / or pharmaceutical excipients; the drug carrier and / or pharmaceutical excipients are at least one of water, lactose, sodium chloride, and glucose; the dosage form of the adjuvant drug is powder, granule, capsule or tablet.

[0008] The present invention has at least one of the following beneficial effects: The present invention provides a dual-chamber probiotic, including Bifidobacterium longum subsp. longum NCU-05 and Lactobacillus crispatus NCU-28. The Bifidobacterium longum subsp. longum NCU-05 and Lactobacillus crispatus NCU-28 can improve the intestinal and genital tract dysbiosis after colon cancer chemotherapy. The present invention also provides the use of Bifidobacterium longum subsp. longum and Lactobacillus crispatus in the form of combination medication in the preparation of biological agents and adjuvant drugs for improving intestinal and genital tract dysbiosis after colon cancer chemotherapy. According to the experimental data of the present invention, Bifidobacterium longum subsp. longum and Lactobacillus crispatus are effective in improving intestinal and genital tract dysbiosis after colon cancer chemotherapy through "bidirectional crosstalk of the gut-vaginal microbiota" by cavity administration. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 For in vitro probiotic property determination, (A) Growth curve of NCU-05; (B) Evaluation of antioxidant capacity of NCU-05; (C, D) Acid tolerance of NCU-05; (E, F) Bile salt tolerance of NCU-05; (G) Cell adhesion experiment of NCU-05 (1000×); (H, I) Inhibitory effect of NCU-05 on intestinal pathogens; (J) Growth curve of NCU-28; (K) Antioxidant capacity of NCU-28; (L, M) Acid tolerance of NCU-28; (N) Cell adhesion experiment of NCU-28 (1000×); (O) Inhibitory effect of NCU-28 on vaginal pathogens; Figure 2 Oral administration of NCU-05 enhanced the anti-cancer effect of 5-FU. (A) Schematic diagram of the animal experiment process (B) Changes in the body weight of mice during the experiment (C) Representative morphology of the mouse colon (D) Colon tumor count (E) Representative histological images of mouse colon tissues stained with H&E (200×) (F) Protein expression related to the p53-induced apoptosis signaling pathway in tumor tissues (G-I) Relative expression of p-p53, Bax, Bcl-2, and Cleaved Caspase-3; Figure 3To relieve chemotherapy-induced nausea and vomiting (CINV) and chemotherapy-induced intestinal mucositis (CIM) caused by 5-FU by oral administration of NCU-05. (A) Kaolin intake of mice in each group (B) Representative immunohistochemical staining of Fos protein in the AP region of the mouse brain (400×), (C, D) Detection of the expression of 5-HT and SP in colon tissues by ELISA (E, F) Detection of the expression of 5-HT and SP in brain tissues by ELISA (G, H) Detection of the expression of 5-HT3R and NK-1R in brain tissues by RT-qPCR (I) Colon length of mice (J) Disease activity index score (K-M) Detection of the expression of TNF-α, IL-1β and IL-4 in colon tissues by ELISA (N) Detection of the protein expression of the NF-κB signaling pathway in intestinal tissues by WB (O-Q) Relative expression levels of TLR4, MyD88, p-p65 and p65 (R) Detection of the expression of MUC-2 and ZO-1 proteins by immunohistochemistry (×200); Figure 4 To improve the intestinal flora imbalance caused by 5-FU chemotherapy by oral administration of NCU-05. (A) Simpson index, (B) Pielou_e analysis, (C ) Chao 1 index, (D) PCoA analysis chart, (E) Venn diagram, (F) Tenericutes. (G)Bacteroidetes. (H) Actinobacteria. (I) Oscillospira . (J) Ruminnococcus . (K) Turicibacter ; Figure 5 To cause damage to the vaginal environment by 5-FU chemotherapy. (A) Simpson index (B) Chao 1 index (C) PCoA analysis (D) Venn diagram (E) Relative abundance of bacteria at the phylum level (F) Proteobacteria(G)Firmicutes (H) Actinobacteria(I) Relative abundance of bacteria at the genus level (J) Aggregatibacter (K) Corynebacterium (L) Lactobacillus (M) Adlercreutzia (N) HE staining of mouse vaginal tissues and observation of the expression of Cleaved-Caspase 3 by immunohistochemistry (200×); Figure 6The "gut-vagina" probiotic administration synergistically exerts an anti-cancer effect with 5-FU. (A) Schematic diagram of the animal experiment. (B) Changes in the body weight of mice over time. (C) Representative morphology of the mouse colon. (D) Number of tumors in the mouse colon. (E) Representative histological images of H&E-stained colon tissues (200×). (F) Expression of proteins related to the p53-induced apoptosis signaling pathway in tumor tissues. (G-I) Relative expression of p-p53, Bax, Bcl-2, and Cleaved Caspase-3; Figure 7 The "gut-vagina" probiotic administration effectively alleviates the gastrointestinal side effects caused by chemotherapy. (A) Kaolin intake of mice (B) Representative immunohistochemical staining of Fos protein in the AP region of the mouse brain (400×) (C, D) Detection of 5-HT expression in colon and brain tissues by ELISA (E) Detection of 5-HT3R expression in brain tissues by RT-qPCR (F) Colon length (G) Disease activity index scores of mice in each group (H, I) Detection of TNF-α and IL-4 expression in colon tissues by ELISA (J) Detection of protein expression of the NF-κB signaling pathway in intestinal tissues by WB (K) Observation of the expression of MUC-2 and ZO-1 proteins by immunohistochemistry (200×) (L-P) Lactobacillus , Clostridium , Bacteroides , Enterococcus and Enterobacter relative abundances; Figure 8 The "gut-vagina" probiotic administration effectively alleviates the vaginal side effects caused by chemotherapy. (A) HE staining of mouse vaginal tissues (200×) (B-D) Detection of TNF-α, IL-1β, and IL-4 expression in vaginal tissues by ELISA (E-H) WB analysis of TLR4, MyD88, p-p65, and p65 in vaginal tissues (I, J) WB analysis of Bax and Bcl-2 in vaginal tissues (K) Immunohistochemical analysis of Cleaved Caspase-3; Figure 9 The "gut-vagina" probiotic administration has a synergistic effect on improving the vaginal flora disorder caused by 5-FU. (A) Shannon index (B) Pielou_e index (C) PCoA analysis (D) Venn diagram (E) Relative abundances of bacteria at the phylum level (F) Proteobacteria (G) Firmicutes (H) Relative abundances of bacteria at the genus level (I) Aggregatibacter . (J) Acinetobacter . (K) Enhydrobacter . (L) Methyloversatilis ; Figure 10 is a schematic diagram of the mechanism; Figure 11 is the abundance of Bifidobacterium at different time points during the intervention. (A) The abundance of Bifidobacterium genus one day before the intervention. (B) The abundance of Bifidobacterium genus on the 11th day of the intervention. (C) The abundance of Bifidobacterium genus after the intervention; Figure 12 is to evaluate the abundance of Bifidobacterium genus or Lactobacillus genus at different time points during the intervention by q-PCR. (A-C) Measure the abundance of Bifidobacterium genus in the feces of mice one day before the intervention, on the 11th day of the intervention, and after the intervention was completed. (D-E) Measure the abundance of Lactobacillus genus in the vaginal secretions of mice one day before the intervention, on the 11th day of the intervention, and after the intervention was completed; Figure 13 is that "gut-vaginal" probiotic administration alleviates chemotherapy-induced gastrointestinal side effects. (A, B) Detect the expression of SP in the colon and brain tissues by ELISA (C) Detect the expression of NK-1R in the brain tissue by RT-qPCR (D) Detect the expression of IL-1β in the colon tissue by ELISA (E-G) Relative expression levels of TLR4, MyD88, p-p65, and p65 in the colon tissue; *p<0.05, **p<0.01 in the above figures. Specific implementation manners

[0010] Example 1: Screening of Bifidobacterium longum subsp. longum NCU-05 (hereinafter referred to as NCU-05) and Lactobacillus crispatus NCU-28 (hereinafter referred to as NCU-28) and determination of in vitro probiotic properties I. Screening: NCU-05 is an oral probiotic isolated from infant feces, and NCU-28 is a vaginal probiotic isolated from the vaginal secretions of healthy women. Fresh feces collected from infants and vaginal secretions collected from healthy women were respectively stored in sterile centrifuge tubes containing 50% glycerol and immediately spread on plates by dilution; After sequencing, the sequence of NCU-05 is shown as SEQ ID No: 1; the sequence of NCU-28 is shown as SEQ ID No: 2.

[0011] II. Acid and bile salt tolerance experiments: 1) Place NCU-05 in an anaerobic incubator with MRS liquid medium and incubate at 37°C for 36 - 72 h; culture NCU-28 in an incubator at 37°C with MRS medium for 36 - 72 h; respectively take out 100 µL and dilute it 10 times with PBS buffer 1 、10 3 、10 5times, centrifuge at 4,000 rpm for 3 min and discard the supernatant; add PBS buffer solutions with pH = 3, 4, 5, 7, let stand for 4 h, mix well, take 10 μL and spread on plates, culture in a 37 °C constant temperature incubator or anaerobic incubator for 36 - 72 h, and perform viable count; 2) culture in a medium containing 0.0% - 0.3% bile salts in a 37 °C constant temperature incubator for 12 - 48 h, mix well, take 10 μL and spread on plates, culture in a 37 °C constant temperature incubator or anaerobic incubator for 36 - 48 h, and perform viable count.

[0012] III. Antioxidant experiment: 1) Determination of DPPH free radical scavenging ability: Add 2 mL of DPPH methanol solution (0.2 mmol / L) to 2 mL of the supernatant of the bacterial culture solution, react at room temperature in the dark for 30 min, take the supernatant and measure the OD at 517 nm. The control is 2 mL of deionized water plus DPPH methanol solution: DPPH free radical scavenging rate = [1 - A517 (sample) / A517 (blank)] × 100%. 2) Determination of hydroxyl free radical scavenging ability: Take 1 mL of 2 mmol / L FeSO4 solution, 1 mL of 6 mmol / L H2O2, 1 mL of 6 mmol / L salicylic acid, add 1 mL of the supernatant of the bacterial culture solution, let stand at room temperature for 30 min, use deionized water as the blank control, measure the absorbance at 510 nm, and calculate the scavenging rate of hydroxyl free radicals: Hydroxyl free radical scavenging rate = [1 - A510 (sample) / A510 (blank)] × 100%. 3) Determination of superoxide free radical scavenging ability: Sequentially add 2 mL of 150 mmol / L Tris-Hcl solution with pH = 8.0, 1 mL of 1.2 mmol / L pyrogallol solution to 0.5 mL of the bacterial culture solution, react at room temperature for 30 min, measure the absorbance at 330 nm: Superoxide free radical scavenging rate = [1 - (A11 - A10) / (A01 - A00)] × 100%; A00: without sample and pyrogallol; A01: without sample but with pyrogallol; A10: with sample but without pyrogallol; A11: with sample and pyrogallol; 4) Chelating ability with Fe 2+ : Add 0.1 mL of 0.4% ferrous sulfate solution to 0.5 mL of the sample solution, gently invert up and down to mix evenly, then add 0.1 mL of 1% VC and 1 mL of 0.2 mol / L NaOH solution, react at room temperature for 20 min, then use 10% trichloroacetic acid, centrifuge at 6,000 rpm for 10 min at 4 °C to remove proteins, take 0.4 mL of the above solution and add 4 mL of 0.1% o-phenanthroline, react at room temperature for 10 min, and measure the absorbance at 536 nm: Fe 2+Chelating ability = [(A blank - A sample) / A blank] × 100%. 5) Determination of total reducing power: Take 1 mL of the bacterial culture solution, add 1 mL of phosphate buffer (pH 6.6) and 1 mL of 1% K3[Fe(CN)6] solution, mix well, incubate at 50 °C in an incubator for 2 min, add 1 mL of 10% trichloroacetic acid solution, shake well, take 1 mL of the mixed solution, add 4 mL of deionized water and 0.4 mL of 0.1% FeCl3 solution, and let stand for 10 min. Use deionized water as the blank and measure the absorbance at 700 nm.

[0013] IV. Antibacterial test: NCU-05: (1) Inoculate NCU-05 into MRS liquid medium and culture it in an anaerobic incubator at 37 °C for 36 - 72 h, centrifuge at 6,000 g for 5 min; (2) C. albicans, Sh. flexneri, L. monocytogenes, S. haemolytic-β, S. aureus, E. coli, S. typhimurium and S. enteritidis coat it on LB solid medium. Gently place the Oxford cup on the plate, pipette 250 μl of the probiotic culture supernatant into the Oxford cup (three replicates for each group), incubate at 37 °C, observe the size of the antibacterial zone every 2 h, and measure the diameter of the antibacterial zone after 8 h.

[0014] NCU-28: (1) Inoculate NCU-28 into MRS liquid medium and culture it in a carbon dioxide incubator at 37 °C for 24 - 48 h, centrifuge at 6,000 g for 5 min; (2) C. albicans, E.faecalis, S. haemolytic-β, G. vaginalis, S. aureus, and E. coli coat it on LB solid medium. The following steps are the same as those for NCU-05.

[0015] V. Cell Adhesion Assay: NCU-05: (1) Inoculate NCU-05 into MRS liquid medium and culture it in an anaerobic incubator at 37°C until the OD value reaches 0.6, then terminate the culture; (2) Wash the HT-29 cell culture plate with a 30% coverage on the coverslip once with sterile PBS buffer. Take 1 mL of the above bacterial culture solution, mix it with 1 mL of the HT-29 cell culture solution containing a small amount of cells, add it to a six-well plate, and culture it in a cell incubator at 37°C; (3) After culturing for 1 - 1.5 hours, take out the six-well cell culture plate, aspirate the culture solution, wash it repeatedly 5 times with PBS buffer, fix it with methanol, stain it with Gram stain, and observe it under an oil immersion microscope. NCU-28: (1) Inoculate NCU-28 into MRS liquid medium and culture it in a carbon dioxide incubator at 37°C until the OD value reaches 0.6, then terminate the culture; (2) Wash the VK2 / E6E7 (human vaginal epithelial cell) culture plate with a 30% coverage on the coverslip once with sterile PBS buffer. Take 1 mL of the above bacterial culture solution, mix it with 1 mL of the VK2 / E6E7 (human vaginal epithelial cell) culture solution containing a small amount of cells, add it to a six-well plate, and culture it in a cell incubator at 37°C; (3) The same as NCU-05.

[0016] The measurement results are as Figure 1 shown. NCU-05 reached a plateau after 30 hours, and the OD600nm value was approximately 2.2 ( Figure 1 A). The antioxidant test showed that the scavenging rates for DPPH, hydroxyl radicals (-OH), and superoxide radicals (O2-) were 80.39%, 68.06%, and 84.50% respectively. Its chelating effect on divalent iron ions (Fe 2+ ) was 76.46%, and the OD700nm value of the total reducing power was 0.94 ( Figure 1 B). At the same time, NCU-05 could tolerate a medium-strength acidic environment and could survive in bile salt solutions of different concentrations, maintaining a viable cell count of 2×10 7 CFU / mL at pH 3.0 and 3×10 7 CFU / mL at a bile salt concentration of 0.3% ( Figure 1 C - F). In addition, NCU-05 also showed good adhesion ability, being able to effectively adhere to HT-29 human colon cancer cells ( Figure 1 G), and had an inhibitory effect on common intestinal pathogens, including C. albicans, Sh. flexneri, L. monocytogenes, S. haemolytic-β, S. aureus, E. coli, S. typhimurium and S. enteritidis , and the diameters of the inhibition zones were 27.7 mm, 25 mm, 28 mm, 23.3 mm, 31 mm, 24 mm, 19 mm, and 26.3 mm respectively ( Figure 1 H - I).

[0017] The vaginal probiotic NCU-28 reached a plateau after 20 hours, with an OD600nm value of approximately 2.0 ( Figure 1 J). The scavenging rates of NCU-28 for DPPH, -OH, and O2- were 61.39%, 83.57%, and 77.54% respectively, and the Fe 2+ chelation rate was 71.45%. The OD700nm value of the total reducing power was 0.81 ( Figure 1 K). It is worth noting that NCU-28 showed the highest viable cell count at pH 5.0, reaching 7.3×10 9 CFU / mL ( Figure 1 L, M). The adhesion experiment showed that NCU-28 had a strong adhesion ability to VK2 / E6E7 human vaginal epithelial cells ( Figure 1 N). The antibacterial experiment results showed that the inhibition zone diameters of NCU-28 against vaginal pathogenic bacteria C. albicans, E.faecalis, S. haemolytic-β, G. vaginalis, S. aureus, and E. coli were 26 mm, 20.3 mm, 24 mm, 20 mm, 25 mm, and 21.6 mm respectively ( Figure 1 O). The above results indicate that both NCU-05 and NCU-28 have ideal probiotic characteristics and can be used in subsequent experiments.

[0018] Example 2: Effects of gavage with NCU-05 on chemotherapy and intestinal and genital tract flora in colon cancer mice I. Establishment of mouse colorectal cancer model: As Figure 2 shown in A, the AOM / DSS induction method was used, a four-step method: after a single intraperitoneal injection of AOM at a dose of 7.5 - 12.5 mg / kg, 2.5% DSS drinking water was fed 7 days later, and then normal drinking water was given, with a total of three cycles. The criteria for successful model judgment: a weight loss of more than 20%, a fecal occult blood score of 3 or more and combined with pathological verification. Starting from the second stage of DSS, two mice in each group were randomly selected, anesthetized and sacrificed, and the growth of colon tumors was examined by dissection to further judge the success of the model establishment.

[0019] II. Animal grouping: 60 C57BL / 6 female mice (SPF level, 8 weeks old, weighing 20 - 22 g). They were randomly divided into different groups, with 12 mice in each cage. (1) Blank control group (N = 12, divided into two cages). (2) Colon cancer group (N = 12, divided into two cages): AOM / DSS-induced tumor model. (3) Colon cancer + gavage probiotic group (N = 12, divided into two cages): On the basis of tumor treatment, 1×10 9CFU / 100µl NCU-05 for 21 days. (4) Colon cancer + FU group (N = 12, divided into two cages): On the basis of tumor treatment, 100 μl of 5-FU was intraperitoneally injected (25 mg / kg, prepared with normal saline, freshly prepared and used immediately, once every 3 days for a total of 21 days). (5) Colon cancer + FU + intragastric administration of probiotics group (N = 12, divided into two cages): On the basis of tumor treatment, 100 μl of 5-FU was intraperitoneally injected (25 mg / kg, prepared with normal saline, freshly prepared and used immediately, once every 3 days for a total of 21 days). Intragastric administration was carried out 1×10 9 CFU / 100µl NCU-05 for 21 days.

[0020] III. Materials and methods: 1. Mouse tissue sampling: (1) Feces and vaginal secretions: After the treatment, the feces of mice in each group were collected and sent to Personal Biotechnology Co., Ltd. for 16S rDNA sequencing. (2) Tissues: The colorectal, brain, and vaginal tissues of the mice after euthanasia were taken out and rinsed with sterilized normal saline. Some were immersed and fixed in 4% paraformaldehyde for histological analysis, and the others were stored in a -80°C refrigerator.

[0021] 2. Kaolin experiment: Medicinal-grade kaolin (hydrated aluminum silicate) and 3% (w / w) gum arabic were mixed with distilled water to make food-sized particles and completely dried at room temperature. 100 g of normal feed and kaolin were weighed, and the mice in each group were allowed to freely ingest them under constant temperature and normal light. The kaolin intake of the mice within 24 h after drug intervention was recorded at a fixed time every day. The degree of nausea and vomiting was evaluated according to the kaolin intake of the mice in each group.

[0022] 3. Disease activity index scoring: The feces of the mice in each group were collected, and the softness and occult blood degree of the feces were observed for scoring. According to the scoring criteria of Cooper HS et al.: DAI = (weight loss score + stool consistency score + blood in stool score): (i) Stool consistency (0 = normal; 2 = loose; 4 = diarrhea); (ii) Blood in the stool (0 = normal; 2 = positive occult blood; 4 = gross hematuria); (iii) Body weight of the animal (0 = weight loss of less than 1%; 1 = weight loss of 1 to 5%; 2 = weight loss of 6 to 10%; 3 = weight loss of 11 to 15%; 4 = weight loss > 16%).

[0023] 4. HE staining analysis of lesion infiltration: Some tumor specimens were cut thin to a thickness of less than 5 mm, fixed in 4% formaldehyde solution, and then embedded in paraffin; the tumor tissues fixed in 4% paraformaldehyde solution were taken out, paraffin-embedded, and sectioned at 5 μm; after pathological staining and covering the slides, the cell structure, size, nuclear-cytoplasmic ratio, atypia, malignancy degree, and infiltration were observed under a microscope.

[0024] 5. Immunohistochemistry (IHC): 1) Dehydration and paraffin embedding: The steps are the same as those for H&E staining; 2) Sectioning: Cut the fixed sample into thin (4-6 µm) tissue sections; 3) Antigen retrieval: Place the slide in a dish containing antigen retrieval solution and boil for 10 min. After taking it out and cooling to room temperature, wash it twice with PBS buffer; 4) Blocking of endogenous catalase: Incubate with 3% H2O2 aqueous solution in the dark for 8 min and rinse twice with PBS buffer; 5) Serum blocking: Add 5% calf serum and incubate at room temperature for 30 min; 6) Antibody labeling: Prepare the primary antibody according to the antibody instruction manual and select the corresponding secondary antibody. Incubate the primary antibody overnight at 4°C (in the dark), and incubate the secondary antibody at room temperature for 40 min; 7) Antibody staining: Add DAB working solution and incubate in the dark for 8 min. After rinsing with ddH2O to terminate the reaction, add hematoxylin for counterstaining for 30 s, and rinse with ddH2O for 8 min; 8) Microscopic examination and analysis: Observe and record the expression of the target protein under the microscope.

[0025] 6. Extraction of tissue RNA and RT-qPCR: 1) Tissue disruption: Weigh 0.1 g of tissue into an EP tube, add Trizol reagent and RNase inhibitor; disrupt the tissue for 30 s, with an interval of 10 s, repeat 3 times; 2) Solution extraction: Let the disrupted sample stand for 8 min, transfer the supernatant to a new nuclease-free EP tube, add an equal volume of phenol / chloroform mixture, shake well for 30 s and then stand for 5 min, then centrifuge at 12,000 rpm at low temperature for 10 min, and transfer the supernatant to a new centrifuge tube; 3) Alcohol precipitation: Add an equal volume of isopropanol to the supernatant, mix and let stand for 10 min to precipitate RNA; 4) RNA washing: Wash the RNA precipitate with 70% ethanol to remove impurities; 5) RNA quality detection: After drying, add 40 µL of nuclease-free water to dissolve RNA, mix well and measure the concentration with a spectrophotometer.

[0026] 7. Reverse transcription of RNA and RT-qPCR: 1) Weigh 0.1 g of tissue into 1 mL of TRIzol lysis buffer, homogenize on ice, centrifuge at 5000 rpm for 10 min at 4°C, and take the supernatant. 2) Add chloroform at a ratio of 200 μL of chloroform per 1 mL of TRIzol, shake vigorously for 3 min at room temperature, centrifuge at 13000 rpm for 15 min at 4°C, and take the upper aqueous phase. 3) Add 600 μL of isopropanol to every 400 μL of the aqueous phase, invert and mix well, incubate at room temperature for 10 min, centrifuge at 13000 rpm for 15 min at 4°C, and retain the precipitate. 4) Add 1 mL of 75% ethanol to the precipitate, centrifuge at 13000 rpm for 10 min at 4°C. 5) Remove the supernatant and dry at room temperature for 15 - 30 min, add DEPC water, dissolve in a water bath at 65°C, and measure the concentration. 6) Removal of genomic DNA reaction: × gDNA Eraser Buffer 2.0 μL, gDNA Eraser 1.0 μL, Total RNA 1.0 μg, RNase-free ddH2O up to 10.0 μL, incubate in a water bath at 2°C for 2 minutes, store at 4°C. 2) Reverse transcription reaction: The experimental liquid after the DNA removal system reaction 10.0 μL, 5×PrimeScript Buffer 2 4.0 μL, PrimeScript RT Enzyme Mix I 1.0 μL, RT Primer Mix 1.0 μL, RNase-free ddH2O 4.0 μL; PCR program: 37°C, 15 minutes; 85°C, 5 seconds; store at 4°C. 3) q-PCR reaction: Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix 10.0 μL, Forward Primer (10 μM) 0.4 μL, Reverse Primer (10 μM) 0.4 μL, template DNA 2 μL, sterile ultrapure water 7.2 μL; PCR program: 95°C, 2 minutes; 95°C, 10 seconds, 60°C, 30 seconds, cycle 40 times; 95°C, 15 seconds; 60°C, 1 minute; 95°C, 15 seconds. 4) Specific sequences: 5-HT3R: GCTATCCTCCATCCGCCACTTC (forward), CGAGCACAGCCAGCAGGTAG (reverse); NK-1R: GTGCAACCTACCTGGCAAAT (forward), ACCAGCAGAGGCAGGAAGTA (reverse); GAPDH: CTCGTGGAGTCTACTGGTGT (forward), GTCATCATACTTGGCAGGTT (reverse).

[0027] 8. Western-blot: 1) Gel preparation: After checking for leaks, prepare a separating gel with an appropriate concentration according to the molecular weight of the target protein. After adding the stacking gel, insert the gel comb and wait for it to solidify; 2) Loading: After thoroughly mixing the protein sample, add it into the gel wells, place it in the electrophoresis tank and add the electrophoresis buffer. First, set a constant voltage of 80 V and run electrophoresis for 20 min, then set a voltage of 180 V and run electrophoresis for 1 h; 3) Blotting: After electrophoresis, retain the area of the target protein band. Place the PVDF membrane pre-activated with methanol on the target fragment, set a constant current of 260 mA for 80 min; 4) Blocking: Prepare 5% skim milk and incubate at room temperature for 1 h; 5) Antibody incubation: Incubate the primary antibody with the target band overnight in a 4°C refrigerator. Wash the membrane 3 times with 1×TBST. Select the corresponding secondary antibody according to the primary antibody and incubate at room temperature for 1 h, then wash the membrane 3 times; 6) Development: Prepare the exposure solution and perform exposure.

[0028] 9. ELISA: 1) Prepare the antibody, washing solution and standard according to the kit instructions; 2) Add the samples in sequence according to the arrangement order of the blank wells, standard wells and sample wells. The sample volume is 100 µL. Incubate at 37°C for 1 h, add 300 µL of washing solution to wash the plate and pat it dry. Repeat 5 times; 3) Dilute the antibody with the antibody diluent, add 100 µL to each well, incubate at 4°C for 1 h, add 300 µL of washing solution to wash the plate 5 times and pat it dry. Repeat 5 times; 4) Add 60 µL of chromogenic solution to each well and incubate at 37°C for 30 min; 5) Add the stop solution to each well and read the values using an ELISA reader.

[0029] 10. qPCR: Verification of the differences in the microbiota of mice in each group: (1) Feces: Common microbiota in the intestine were selected to verify the differences by qPCR. The representativeness and specificity of different primers were compared using the Gene Bank database, and primers with strong specificity and covering the corresponding bacteria to the greatest extent were screened out and synthesized by a relevant company. For 16s Bifidobacterium Lactobacillus: ACTCCTACGGGAGGCAGCAGTTCGCGTC(C / T)GGTGTGAAAGCACCGCTACACATGGAG (forward), TATTACCGCGGCTGCTGGCCCACATCCAGC(A / G)TCCACAGCAGTAGGGAATCTTCCA (reverse); For Clostridium Bacteroides Enterococcus Enterobacter: GCACAAGCAGTGGAGTGGTGTCGGCTTAAGTGCCATCATGACGTTACCCGCAGAAGAAGATCAGATGTGCCCAGATGG (forward), CTTCCTCCGTTTTGTCAACGGACTGTAAGGGCCGTGCCTCTACGAGACTCAAGCTTGCCCGTGTCTCAGTTCCAGTG (reverse). The total intestinal microbiota represents all intestinal microbiota, and the primers correspond to the conserved sequences shared by different species of bacteria. According to the NCBI Primer-Blast comparison results, these primers can bind to the target sequences of almost all intestinal microbiota with known 16S rRNA sequences for real-time detection and quantitative amplification.

[0030] 11. High-throughput sequencing analysis: Before the end of the experiment, fecal samples were collected from mice in each group, placed into sterile EP tubes respectively, quickly frozen with liquid nitrogen and stored in a -80 °C refrigerator. According to the guidelines of the Tiangen Bacterial Genomic DNA Extraction Kit, DNA was extracted from the collected mouse fecal samples and sent to Shanghai Personal Biotechnology Co., Ltd. for 16S rDNA high-throughput sequencing analysis. Universal primers (515F: 5’-GTG CCA GCMGCC GCG GTAA-3’; 806R: 5’-GGACTA CVSGGG TAT CTAAT-3’) were used to amplify the target fragments in the V4 region of 16S rRNA. The QIIME software was used to analyze the effective sequencing data, including α-diversity, β-diversity, and differences between groups, and the SIMCA-P software was used to identify, cluster analyze, and perform partial least squares discriminant analysis on different abundant taxonomic units.

[0031] The above measurement results are as Figure 2 - 5As shown. To evaluate the effect of oral NCU-05 on the anti-cancer effect of 5-FU, a colorectal cancer mouse model was established using AOM / DSS ( Figure 2 A). The levels of Bifidobacterium in mouse feces were monitored by q-PCR, and samples were taken before, during, and after the intervention. At the end of the intervention, the abundance of Bifidobacterium in the feces of mice in the NCU-05 gavage group was significantly higher than that in the non-gavage group (Figure S1A-C). Oral NCU-05 improved the weight loss of MF mice (p<0.05) ( Figure 2 B). Compared with the MF group, the number of colon tumors in the MFB group was significantly reduced (p<0.05) ( Figure 2 C, D). Compared with the M group, the tumor area of mice in the MFB group was significantly reduced, histological damage was alleviated, and its therapeutic effect was significantly better than that of the M group treated with 5-FU alone ( Figure 2 E). The MFB group significantly enhanced the phosphorylation level of P53 in tumor tissues, thus promoting the repair of DNA damage caused by chemotherapy, with a more significant effect than the MF group (p<0.05) ( Figure 2 F, G). When DNA damage cannot be repaired, P53 further initiates the apoptosis program. The Bax / Bcl-2 ratio of mice in the MFB group was significantly higher than that in the MF group (p<0.01), and the expression of Cleaved Caspase-3 was also significantly upregulated (p<0.01) ( Figure 2 H-I). These results indicate that oral NCU-05 helps to enhance the apoptotic effect of 5-FU on colon cancer cells.

[0032] Common gastrointestinal side effects of chemotherapy include nausea, vomiting, and enteritis. First, to verify the therapeutic effect of NCU-05 on chemotherapy-induced nausea and vomiting (CINV), a kaolin test was conducted ( Figure 3 A). The experimental results showed that the kaolin intake of the MFB group on the first day was significantly lower than that of the MF group (MF vs. MFB = 3.45% vs. 2.93%, p<0.05) (Fig.3A).( Figure 3 A). Immunohistochemical analysis showed that compared with the MF group, the expression of FOS protein in neurons of the area postrema (AP) in the MFB group was decreased ( Figure 3 B). ELISA results showed that the level of 5-hydroxytryptamine (5-HT) in the colon tissue of the MF group was significantly increased (C vs. MF = 25.59 vs. 74.05, p<0.01), while the MFB group showed a downregulation of 5-HT expression (MF vs. MFB = 74.05 vs. 48.23, p<0.01)( Figure 3C). Similarly, the expression trend of Substance P (SP) was consistent with that of 5-HT (MF vs MFB = 128.60 vs 112.55, p<0.05) ( Figure 3 D). Further study was conducted on the bidirectional interaction of the gut-brain axis (GBA) in CINV. ELISA results showed that the level of 5-HT in the brain tissue of mice in the MFB group was significantly downregulated (MF vs.MFB = 101.04 vs. 86.84, p<0.05) ( Figure 3 E). Meanwhile, the expression of SP was also significantly downregulated in the MFB group (MF vs.MFB = 168.22 vs. 153.56, p<0.01) ( Figure 3 F). Compared with the control group, the transcriptional levels of 5-HT3R and NK-1R receptors in the brain tissue of chemotherapy-treated mice were significantly increased (p<0.01). However, after oral administration of NCU-05, this trend was reversed ( Figure 3 G, H). These data indicate that NCU-05 alleviates CINV by regulating the expression of related neurotransmitters through the gut-brain axis.

[0033] To investigate the therapeutic effect of oral NCU-05 on chemotherapy-induced intestinal mucositis (CIM), this study observed that oral NCU-05 significantly increased the colon length of chemotherapy mice (MF vs. MFB = 5.25 vs. 6.92, p<0.01) ( Figure 3 I). The disease activity index (DAI) was further evaluated, and the results showed that the MF group had the highest score, while the intervention of NCU-05 effectively alleviated this pathological score (p<0.01) ( Figure 3 J). The expression of inflammatory factors in colorectal tissues was detected by ELISA. Compared with the C group, the tumor necrosis factor α (TNF-α) and interleukin-1β (IL-1β) in the MF group were significantly upregulated, while interleukin-4 (IL-4) was significantly downregulated (p<0.01), and this trend was reversed in the MFB group (p<0.01) ( Figure 3 K-M). Western blot results showed that the NF-κB pathway in the intestinal tissues of mice in the MF group was activated ( Figure 3 N). In the MB and MFB groups, the protein levels of TLR4, MyD88, and p-p65 were significantly reduced, indicating that NCU-05 has an inhibitory effect on inflammation ( Figure 3 O-Q). Immunohistochemical analysis showed that the protein expressions of MUC-2 and ZO-1 in the colon tissues of the MF group were decreased, while the MFB group showed enhanced expressions of these two proteins ( Figure 3R). These results indicate that oral administration of NCU-05 can significantly alleviate chemotherapy-induced intestinal inflammation and improve chemotherapy-induced intestinal injury by inhibiting the inflammatory response, regulating cytokine expression, and enhancing intestinal barrier function.

[0034] Intestinal microbiota imbalance is closely related to colorectal cancer and chemotherapy. To further analyze the effect of NCU-05 on 5-FU-induced intestinal microecological imbalance, the intestinal microbiota composition of mice was analyzed using high-throughput sequencing. It was found through evaluation by Simpson, Pielou_e, and Chao 1 indices that the α-diversity of the intestinal microbiota in chemotherapy-treated mice was significantly reduced (p < 0.01) ( Figure 4 A-C), while oral administration of NCU-05 restored its α-diversity (p < 0.05) ( Figure 4 A, B). Principal coordinate analysis (PCoA) was used to analyze β-diversity, and the results showed that the intestinal microbiota of mice in the M group and the MF group exhibited significantly different microbial characteristics compared with that in the C group. However, intragastric administration of NCU-05 made the intestinal microbiota composition approach that of the control group ( Figure 4 D). The Venn diagram showed that 306 OTUs were shared among the intestinal microbiota of mice in the C, M, MF, MB, and MFB groups, while the number of unique OTUs in each group was 315, 181, 93, 208, and 158, respectively ( Figure 4 E). At the phylum level, compared with chemotherapy-treated mice, after oral administration of NCU-05, the levels of Tenericutes, Bacteroidetes, and Actinobacteria in the intestines of mice increased ( Figure 4 F-H). At the genus level, several microorganisms related to colorectal cancer were selected for analysis. Compared with the C group, the levels of Oscillospira and Ruminococcus decreased in the MF group, while the level of Turicibacter increased, and this trend was improved after oral administration of NCU-05 ( Figure 4 I-K) High-throughput sequencing was used to evaluate the composition of the microbiota in the vaginal secretions of mice. Compared with the C group, both the Simpson index and the Chao1 index of the α-diversity of the vaginal microbiota in MF group mice were significantly reduced, while the MFB group showed improvement in α-diversity ( Figure 5 A, B). Principal coordinate analysis (PCoA) showed that 5-FU chemotherapy significantly altered the vaginal microbiota of mice and deviated it from the healthy state ( Figure 5 C). In addition, the Venn diagram showed that there were 34 shared OTUs among the C, M, MF, MB, and MFB groups, and the number of unique OTUs in each group was 618, 538, 245, 939, and 298, respectivelyFigure 5 D). When analyzing the microbial composition at the phylum level, the abundance of Proteobacteria in the vaginal secretions of chemotherapy-treated mice increased significantly (p < 0.01), while the abundances of Firmicutes and Actinobacteria decreased significantly ( Figure 5 E-H). At the genus level, the abundance of Aggregatibacter increased (p < 0.01) in the MF group, while the abundances of Corynebacterium, Lactobacillus and Adlercreutzia decreased ( Figure 5 I-M).

[0035] The HE staining results showed that the vaginal mucosa of chemotherapy-treated mice exhibited loss of the stratum corneum, proliferation of squamous epithelial cells, and extensive infiltration of inflammatory cells in the mucosa. Notably, the structure of the stratum corneum of the vaginal epithelium in the MFB group of mice was partially restored, although the vaginal damage caused by chemotherapy could not be completely reversed ( Figure 5 N). Immunohistochemical analysis showed that the expression of Cleaved Caspase-3 increased in the vaginal tissues of mice in the MF group, while in the MFB group, its expression was partially downregulated ( Figure 5 N). The above results indicate that 5-FU chemotherapy not only leads to the imbalance of the vaginal microecology but also causes damage to the vaginal epithelial tissue.

[0036] Example 3: Effects of intravaginal administration of NCU-28 and intragastric administration of NCU-05 on chemotherapy and intestinal and reproductive tract flora in colon cancer mice I. Modeling of murine colorectal cancer: The same as in Example 2. II. Animal grouping: (1) Blank control group (N = 12, divided into two cages). (2) Colon cancer group (N = 12, divided into two cages): AOM / DSS-induced tumor model. (3) Colon cancer + FU group (N = 12, divided into two cages): On the basis of tumor treatment, 100 μl of 5-FU (25 mg / kg, prepared with normal saline, freshly prepared and used immediately, once every 3 days for a total of 21 days) was injected intraperitoneally. (4) Colon cancer + FU + intragastric administration of probiotics group (N = 12, divided into two cages): On the basis of tumor treatment, 100 μl of 5-FU (25 mg / kg, prepared with normal saline, freshly prepared and used immediately, once every 3 days for a total of 21 days) was injected intraperitoneally. 1×109 CFU / 100 μl of NCU-05 was intragastrically administered every day for 21 days. (5) MFL group: After the model was established, 5-FU (40 mg / kg) was injected intraperitoneally; at the same time, 50 μL of a concentration of 1×10 6CFU / ml of NCU-28 was placed into the vagina of mice once every two days. (6) MFBL group: After the model was established, 5-FU (40 mg / kg) was intraperitoneally injected, and at the same time, NCU-05 (109 CFU / ml, 100 μL) was administered by gavage for 3 weeks. Then, 50 μL of NCU-28 bacterial solution with a concentration of 1×106 CFU / ml was placed into the vagina of mice once every two days. III. Materials and methods were the same as before.

[0037] The results showed that chemotherapy had an adverse effect on the intestinal and vaginal microbiota. Oral supplementation enhanced the anti-cancer response of 5-FU and improved intestinal toxicity. However, the damage to the vaginal environment was not significantly improved. Therefore, the adjuvant effect of oral NCU-05 combined with intravaginal NCU-28 on 5-FU chemotherapy was further investigated ( Figure 6 A). q-PCR analysis confirmed that the abundance of Bifidobacterium in the feces of mice treated with oral NCU-05 increased ( Figure 12 A-C). Similarly, in the NCU-28 vaginal intervention group, the Lactobacillus abundance in the vaginal secretions of mice also increased significantly ( Figure 12 D-F).

[0038] The combined use of oral NCU-05 and intravaginal NCU-28 (MFBL group) significantly improved the weight loss caused by chemotherapy (p<0.01) ( Figure 6 B). In addition, compared with the group treated with only oral probiotics, the "gut-vagina" probiotic combination showed a better effect in reducing the number of tumors in colon cancer mice (p<0.05) ( Figure 6 C, D). Compared with the MFB group, the MFBL group was more efficient in restoring the colonic glandular structure, reducing the cancerous area, and effectively slowing down the malignancy of cancerous lesions ( Figure 6 E). Compared with the MFB group, the MFBL group significantly upregulated the levels of p-p53 (p<0.05), Bax / Bcl-2 ratio (p<0.01), and Cleaved-Caspase 3 (p<0.05) in tumor tissues, thereby inhibiting the proliferation of tumor cells ( Figure 6 F-I). The above results indicate that the "gut-vagina" probiotic combination is more effective in enhancing the anti-cancer effect of 5-FU compared with simply oral NCU-05.

[0039] In terms of improving chemotherapy-induced vomiting and nausea (CINV), the kaolin intake of mice in the MFBL group decreased compared with that in the MFB group (MFB vs MFBL = 2.51% vs 1.78%, p<0.05) ( Figure 7A). Meanwhile, the expression of FOS protein in the AP region of the brain in the MFBL group of mice was significantly lower than that in the MFB group ( Figure 7 B). In addition, the MFBL group significantly reduced the increase in the levels of 5-HT, SP, 5-HT3R, and NK-1R caused by chemotherapy and showed a more obvious effect than the MFB group ( Figure 7 C-E and Figure 13 A-C). Interestingly, although a decrease in neurotransmitter levels was also observed in the MFL group, the effect was not as obvious as that in the MFB group and the MFBL group.

[0040] In terms of improving chemotherapy-induced intestinal mucositis (CIM), the mice in the MFBL group showed the most significant recovery in terms of colon shortening and increased DAI score ( Figure 7 F, G). Compared with the MFB group, the mice in the MFBL group showed a significant decrease in the levels of TNF-α and IL-1β (p < 0.05) ( Figure 7 H and Figure S3D), while the expression of IL-4 was significantly increased (p < 0.05) ( Figure 7 I). In addition, the protein levels of TLR4, MyD88, and p-p65 in the intestinal tissues of the mice in the MFBL group were significantly downregulated ( Figure 7 J and Figure 13 E-G), indicating that the combined use of NCU-05 and NCU-28 inhibited the inflammatory response. The expression of MUC-2 and ZO-1 proteins in the intestines of the mice in the MFBL group was most significantly improved, contributing to the recovery of intestinal barrier function ( Figure 7 K).

[0041] To evaluate the improvement effect of the combined use of "intestinal-vaginal" probiotics on intestinal microecological imbalance, the abundances of common intestinal bacterial genera were detected by q-PCR. Compared with the C group, the Lactobacillus, Clostridium , and Bacteroides levels in the mice in the MF group were significantly decreased (p < 0.01) ( Figure 7 L-N), while the abundances of Enterococcus and Enterobacter were significantly increased (p < 0.01) ( Figure 7 O, P). In the feces of the mice in the MFB group, the abundances of Lactobacillus, Clostridium , and Bacteroides were significantly increased (p < 0.01), while the abundances of Enterococcus and Enterobacter were significantly decreased (p < 0.01). The MFL group restored the microecological imbalance caused by chemotherapy to a certain extent, while the MFBL group showed the most effective treatment effect. The above results indicate that the combined use of "intestinal-vaginal" probiotics has the most significant effect in improving the gastrointestinal side effects caused by chemotherapy and restoring intestinal microecological balance.

[0042] The effects of dual-channel probiotic therapy on vaginal epithelial tissue after chemotherapy were further investigated. The HE staining results showed that in the MFL and MFBL groups, vaginal epithelial damage was significantly alleviated, the infiltration of inflammatory cells decreased, the integrity of the vaginal mucosa structure was restored, the keratinized layer was clearly visible, and the effect was better than that of the MFB group ( Figure 8 A). Compared with the MFB and MFL groups, the MFBL group more effectively reversed the overexpression of TNF-α and IL-1β in vaginal tissues induced by chemotherapy, and simultaneously significantly increased the expression of IL-4 ( Figure 8 B-D). At the same time, the MFBL group more effectively inhibited the activation of the NF-κB inflammatory pathway ( Figure 8 E-H), and alleviated the apoptosis of epithelial cells ( Figure 8 I-J). Meanwhile, the level of Cleaved Caspase-3 in the MFBL group was also significantly decreased ( Figure 8 K). According to the above results, the combined oral and vaginal probiotic intervention therapy is more effective than single oral or vaginal probiotic therapy in alleviating vaginal inflammation and tissue damage.

[0043] To evaluate the effects of the combined use of "gut-vagina" probiotics on the distal vaginal microbiota, the results showed that in the comparison of the Shannon and Pielou_e indices, the vaginal microbiota α-diversity in the MFL and MFBL groups was significantly restored, compared with the MF group ( Figure 9 A, B). PCoA analysis showed that the vaginal microbiota imbalance induced by chemotherapy was partially alleviated in the MFB and MFL groups, while the vaginal microbiota composition in the MFBL group was closer to that of the healthy control group ( Figure 9 C). In addition, the Venn diagram showed that there were 64 OTUs in common among the C, M, MF, MFB, MFL, and MFBL groups, and the unique OTUs of each group were 578, 507, 178, 128, 489, and 500, respectively ( Figure 9 D). At the phylum level composition, the upregulation of Proteobacteria and the downregulation of Firmicutes induced by chemotherapy were improved in the MFB, MFL, and MFBL groups ( Figure 9 E-G). At the genus level composition, the abundance of Aggregatibacter in the MFBL group was significantly decreased compared with the MF group (p<0.01), while the abundances of Acinetobacter, Enhydrobacter and Methyloversatilis were increased (p<0.05) ( Figure 9 I-L), which reversed the microbiota imbalance induced by chemotherapy. Vaginal probiotics had a better improvement effect than oral probiotics, but still inferior to dual-channel probiotic therapy. Therefore, the combined use of "gut-vagina" probiotics is the most effective in alleviating the vaginal microbiota imbalance induced by chemotherapy.Figure 10 It is a schematic diagram of the mechanism. In a mouse model of AOM- and DSS-induced colorectal cancer (CRC), oral administration of NCU-05 combined with vaginal NCU-28 intervention enhanced the anti-cancer effect of 5-FU by activating the P53 signaling pathway and increasing the expression of pro-apoptotic proteins, thus contributing to the treatment of CRC. In terms of improving the side effects of chemotherapy, the "gut-vagina" combined administration of probiotics regulated the release of neurotransmitters (such as 5-HT, SP) through the GBA axis, alleviating nausea and vomiting. In addition, it restored the imbalance of the gut and vaginal microbiota, thereby alleviating the inflammation-related damage in the gut and vagina.

Claims

1. Double-chamber probiotics, characterized in that: The dual-chamber probiotics include Bifidobacterium longum subspecies longum ( Bifidobacterium longum subsp . longum )NCU-05 and Lactobacillus crispatus ( Lactobacillus crispatus )NCU-28; The Bifidobacterium longum subspecies longum NCU-05 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on January 18, 2023, with the deposit number of CGMCC NO.26492; The Lactobacillus crispatus NCU-28 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on July 22, 2024, with the deposit number CGMCC NO.31387.

2. The use of the dual-chamber probiotic intervention in colon cancer chemotherapy and intestinal and reproductive tract flora according to claim 1, wherein the Bifidobacterium longum subspecies longum NCU-05 is administered via the intestine, and the Lactobacillus crispatus NCU-28 is administered via the vagina.

3. The use according to claim 2, characterized in that: The application includes preparing a combination drug for improving intestinal and reproductive tract flora imbalance after chemotherapy for colon cancer by using the Bifidobacterium longum subspecies longum NCU-05 and the Lactobacillus crispatus NCU-28 as active ingredients.

4. A biological agent, characterized in that: The invention comprises a biological agent A and a biological agent B, wherein the active ingredient of the biological agent A comprises the Bifidobacterium longum subspecies longum NCU-05 described in claim 1, and the active ingredient of the biological agent B comprises the Lactobacillus crispatus NCU-28 described in claim 1.

5. The biological agent according to claim 4, characterized in that The biologic A is administered enterally and the biologic B is administered vaginally.

6. An auxiliary drug for the treatment of colon cancer, characterized in that: The invention comprises an auxiliary drug A and an auxiliary drug B, wherein the active ingredient of the auxiliary drug A comprises the Bifidobacterium longum subspecies longum NCU-05 described in claim 1, and the active ingredient of the auxiliary drug B comprises the Lactobacillus crispatus NCU-28 described in claim 1.

7. The auxiliary drug for treating colon cancer according to claim 6, characterized in that: The auxiliary drug A is administered via the intestine, and the auxiliary drug B is administered via the vagina.

8. The auxiliary drug according to claim 6, characterized in that: The auxiliary drug also includes a drug carrier and / or a pharmaceutical excipient.

9. The auxiliary drug according to claim 8, characterized in that: The drug carrier and / or pharmaceutical excipient is at least one of water, lactose, sodium chloride and glucose.

10. The auxiliary drug according to claim 6, characterized in that: The dosage form of the auxiliary drug is powder, granule, capsule or tablet.

Images