Actinobacillus pleuropneumoniae delta qseB gene deleted strain as well as construction and application thereof

By constructing a vaccine with ΔqseB gene deletion strain, the problem of unclear virulence mechanism of the QseBC regulation system was solved, and an efficient and safe vaccine distinction effect was achieved, reducing the pathogenicity of Actinobacter pleuropneumoniae was achieved.

CN120173852AInactive Publication Date: 2025-06-20YANGTZE UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510330775.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2025-06-20
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

In the prior art, the specific molecular mechanism of the QseBC two-component regulation system of Actinobacter pleuropneumoniae in regulating virulence is unclear, which makes it difficult to effectively distinguish between natural infection and vaccine infection in vaccine development, and lacks safe and efficient prevention and treatment methods.

Method used

By designing primers to amplify the upstream and downstream homologous recombinant arms of Actiobacter pleuropneumoniae, an ΔqseB gene deletion strain was constructed, and gene knockout was achieved in E. coli using engaging and transfer technology to prepare a ΔqseB gene deletion strain vaccine.

Benefits of technology

It provides a vaccine with high safety, low cost and easy to use, which can effectively distinguish between natural infection and vaccine infection, has good application prospects, and reduces the pathogenicity of Actinobacter pleuropneumoniae.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173852A_ABST
    Figure CN120173852A_ABST
Patent Text Reader

Abstract

The invention discloses a construction method of an actinobacillus pleuropneumoniae qseB gene deleted strain, and relates to the technical field of gene deleted strain research. Comprising the following steps: researching the function of a qseB gene in actinobacillus pleuropneumoniae through literature search, amplifying upstream and downstream homologous arms of the qseB gene through fusion PCR (Polymerase Chain Reaction), constructing a suicide plasmid pEMOC2:: Cm-delta qseB, and carrying out conjugational transfer screening to obtain a gene deletion strain delta qseB. Compared with the wild type S4074, the toxicity of the delta qseB is obviously reduced. The actinobacillus pleuropneumoniae delta qseB gene deletion strain vaccine prepared from the actinobacillus pleuropneumoniae delta qseB gene deletion strain can be used for distinguishing natural infection from vaccine infection, so that a reference value is provided for preventing and treating actinobacillus pleuropneumoniae.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a construction method and application of an Actinobacillus pleuropneumoniae ΔqseB gene deletion strain. Background Art

[0002] Porcine contagious pleuropneumonia (PCP) is a highly contagious respiratory disease mainly characterized by pleuropneumonia and hemorrhagic necrotizing pneumonia caused by Actinobacillus pleuropneumoniae (APP). Actinobacillus pleuropneumoniae (APP) belongs to the genus Actinobacillus of the family Pasteurellaceae, and is a Gram-positive, sporeless, and capsular-producing bacterium.

[0003] The serotypes, virulence factors, genomic structure and gene expression regulation of Actinobacillus pleuropneumoniae (APP) are intricate. This disease has spread worldwide, and pigs of all ages and genders are susceptible. It often has a short course and sudden death, and the morbidity and mortality can reach 100%, causing huge economic losses to the global pig industry. APP is a facultative anaerobic, Gram-negative, polymorphic coccobacillus with a capsule and fimbriae, flagellated and motile. It has a strong affinity for alveolar epithelium. After being phagocytosed by phagocytes, APP releases a large amount of RTX toxin, which ultimately lyses the phagocytes and destroys alveolar macrophages, pulmonary endothelial cells and epithelial cells.

[0004] QseBC is one of the important two-component regulatory systems (TCS) of Actinobacillus pleuropneumoniae. QseC is a histidine kinase protein located on the cell membrane, and QseB is a response regulator protein located in the cytoplasm. It is a regulatory protein widely present in bacteria and is crucial for bacteria to adapt to changes in the extracellular environment of host cells. QseBC is conservatively present in a variety of bacterial species and, as a quorum sensing regulatory system, plays a role in quorum sensing and usually serves as a global regulator of virulence. The QseBC system regulates the expression of bacterial virulence genes and metabolic pathways by sensing environmental signals such as hormones and iron ions in different bacteria, which is crucial for the pathogenicity of bacteria and their adaptability to the host internal environment. Existing studies have shown that the QseBC two-component regulatory system plays an important role in regulating the virulence of APP, but the specific molecular mechanism of its regulation of virulence is still unclear. Therefore, knocking out the qseB gene, establishing a genomic ΔqseB gene deletion strain, and using it to prepare a vaccine against Actinobacillus pleuropneumoniae ΔqseB gene deletion strain, and then providing a reference value for preventing and treating Actinobacillus pleuropneumoniae, has great application prospects. Summary of the Invention

[0005] The present invention aims to provide the construction of Actinobacillus pleuropneumoniae ΔqseB deletion strain to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In one of the technical solutions of the present invention, the upstream homologous recombination arm is amplified from the genome of Actinobacillus pleuropneumoniae S4074 by using primers SEQ ID NO.1 and SEQ ID NO.2, the downstream homologous recombination arm is amplified by using primers SEQ ID NO.3 and SEQ ID NO.4, and the upstream and downstream homologous recombination arms on the qseB gene are connected by fusion PCR technology by using primers SEQ ID NO.1 and SEQ ID NO.4 to obtain a complete upstream and downstream fusion fragment.

[0008] In the second technical solution of the present invention, the upstream and downstream homologous arm fusion fragment is cloned into the suicide plasmid pEMOC2::Cm to obtain the targeting plasmid pEMOC2::Cm-ΔqseB.

[0009] In the third technical solution of the present invention, the targeting plasmid pEMOC2::Cm-ΔqseB is transformed into Escherichia coli β2155 strain by calcium transformation, and cultured until monoclonal formation is obtained, that is, the donor strain β2155 / pEMOC2::Cm-ΔqseB is obtained.

[0010] In the fourth technical solution of the present invention, the donor strain β2155 / pEMOC2::Cm-ΔqseB is conjugated with the recipient bacterium Actinobacillus pleuropneumoniae S4074, and the conjugated bacterial solution is cultured until monoclonal formation is obtained to obtain the target strain Actinobacillus pleuropneumoniae ΔqseB deletion strain.

[0011] Based on the above technical solutions, the present invention has the following technical effects:

[0012] The Actinobacillus pleuropneumoniae ΔqseB gene deletion strain provided by the present invention can be used to prepare a vaccine of Actinobacillus pleuropneumoniae ΔqseB gene deletion strain, which can distinguish natural infection and vaccine infection. It has multiple advantages such as high safety, low cost, and easy use, and has good application prospects. The gene deletion strain of the present invention is a key gene of Actinobacillus pleuropneumoniae, and this gene plays a core role in the pathogenic mechanism and immune response process of Actinobacillus pleuropneumoniae, and can play an effective protective role against Actinobacillus pleuropneumoniae when used to prepare a vaccine. Brief Description of the Drawings

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0014] Figure 1 It is the electrophoresis result diagram of the upstream homologous recombination arm and the downstream homologous recombination arm of qseB of the present invention.

[0015] Figure 2 It is the electrophoresis result diagram of the amplified fusion fragment of the upstream and downstream homologous arms by the primers of SEQ ID NO.1 and SEQ ID NO.4 of the present invention.

[0016] Figure 3 It is the electrophoresis result diagram of the amplified conjugation transfer monoclonal by SEQ ID NO.7 and SEQ ID NO.8 of the present invention

[0017] Figure 4 It is the electrophoresis result diagram of the amplified products by the internal primers and external primers of the present invention.

[0018] Figure 5 It is the result diagram of the survival situation of mice after virus challenge of the present invention. Detailed implementation manners

[0019] Now, the various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation manners of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0021] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0022] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the description of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the description of the present invention are obvious to those skilled in the art. The description and examples of the present application are merely exemplary.

[0023] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0024] The technical solutions of the present invention, unless otherwise specified, are all conventional solutions in the art. The reagents or raw materials used, unless otherwise specified, are all purchased from commercial channels or have been made public.

[0025] The embodiments of the present invention provide an upstream homologous recombination arm and a downstream homologous recombination arm of qseB.

[0026] The embodiments of the present invention also provide a fused fragment of the upstream and downstream homologous arms of qseB.

[0027] The embodiments of the present invention also provide a recombinant vector comprising the DNA molecule.

[0028] The embodiments of the present invention also provide a target strain Actinobacillus pleuropneumoniae ΔqseB deletion strain.

[0029] The present invention creatively conducts in-depth analysis on the genome of APP by bioinformatics methods, screens out multiple key genes closely related to pathogenicity, successfully constructs a ΔqseB gene deletion strain, and evaluates the virulence attenuation effect of the gene deletion strain through a mouse challenge experiment, providing a new idea for the subsequent development of vaccines.

[0030] The present invention analyzes and screens 5 pairs of two-component regulations important for APP through literature search and bioinformatics analysis, and screens out the gene qseB that regulates virulence expression from the screened QseBC two-component system. Based on the qseB gene fragment, a target strain Actinobacillus pleuropneumoniae ΔqseB deletion strain is constructed by genetic engineering technology. Using it to prepare a vaccine for Actinobacillus pleuropneumoniae ΔqseB gene deletion strain can distinguish natural infection and vaccine infection. It has multiple advantages such as high safety, low cost, and easy use, and has good application prospects.

[0031] The specific steps are as follows:

[0032] (1): Genes responsible for regulating virulence in the genome of Actinobacillus pleuropneumoniae suis were screened according to literature search.

[0033] (2) Through the screening of virulence genes, the response regulator qseB in the two-component system QseBC was selected as the target gene.

[0034] (3) Design primers according to the qseB gene and its upstream and downstream sequences in the NCBI database. The primer names and sequences are as follows:

[0035] SEQ ID NO.1: qseB-S-F: CTGTCGACCGTATCATCACCCGCATCAGTT

[0036] SEQ ID NO.2: qseB-S-R: GCGTTTAAGCATCTGAATTTCCTATATTAGTTTGTCGTCTTCAATCAGTA

[0037] SEQ ID NO.3: qseB-X-F: TACTGATTGAAGACGACAAACTAATATAGGAAATTCAGATGCTTAAACGC

[0038] SEQ ID NO.4: qseB-X-R: ATGCGGCCGCCCGGCTAACGGGCTGCGTAA TTCAT

[0039] SEQ ID NO.5: qseB-N-F: CCGCAAGGGATACGTTAGACGA

[0040] SEQ ID NO.6: qseB-N-R: CGGCAAGGGTTACTTTGTGGGT

[0041] SEQ ID NO.7: qseB-W-F: ACGAAACGGTTCAGAATCAAACT

[0042] SEQ ID NO.8: qseB-W-R: TCAATAGCGGTAGAGCGATAAAA

[0043] (4) Use the primers to amplify the homologous arm fusion fragment of the upstream and downstream of qseB, and construct the recombinant plasmid pEMOC 2::Cm-ΔqseB;

[0044] (5) Transform the constructed recombinant plasmid into Escherichia coli β2155, and obtain the donor strain β2155 / pEMOC2::Cm-ΔqseB for the conjugation transfer experiment through culture and screening;

[0045] (6) Conduct the conjugation transfer experiment until monoclonal formation.

[0046] (7) Perform PCR identification on the monoclonal, and screen to obtain the ΔqseB gene knockout strain.

[0047] Example 1

[0048] Amplification method and steps of upstream and downstream homologous recombination arms of Actinobacillus pleuropneumoniae qseB

[0049] The upstream homologous recombination arm was amplified from the genome of Actinobacillus pleuropneumoniae using primers SEQ ID NO.1 and SEQ ID NO.2, and the downstream homologous recombination arm was amplified using primers SEQ ID NO.3 and SEQ ID NO.4, as Figure 1 shown.

[0050] The primer sequences are as follows:

[0051] SEQ ID NO.1: qseB-S-F: CTGTCGACCGTATCATCACCCGCATCAGTT

[0052] SEQ ID NO.2: qseB-S-R: GCGTTTAAGCATCTGAATTTCCTATATTAGTTTGTCGTCTTCAATCAGTA

[0053] SEQ ID NO.3: qseB-X-F: TACTGATTGAAGACGACAAACTAATATAGGAAATTCAGATGCTTAAACGC

[0054] SEQ ID NO.4: qseB-X-R: ATGCGGCCGCCCGGCTAACGGGCTGCGTAA TTCAT

[0055] PCR amplification system for amplification of upstream homologous recombination arm: 1 μL of S4074 bacterial solution, 1.5 μL of SEQ ID NO.1 / SEQ ID NO.2, 21 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.

[0056] Procedure: 98 degree 5 min, 98 degree 10 sec, 60 degree 30 sec, 68 degree 10 sec, 45 cycles, 72 degree 10 min.

[0057] PCR amplification system for amplification of downstream homologous recombination arm: 1 μL of S4074 bacterial solution, 1.5 μL of SEQ ID NO.3 / SEQ ID NO.4, 21 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.

[0058] Procedure: 98 degrees for 5 min, 98 degrees for 10 sec, 65 degrees for 30 sec, 68 degrees for 10 sec, 45 cycles, 72 degrees for 10 min.

[0059] Example 2

[0060] Amplification method and steps of the upstream and downstream homologous arm fusion fragment of qseB:

[0061] Using primers SEQ ID NO.1 and SEQ ID NO.4, the upstream and downstream homologous recombination arms were ligated by fusion PCR technology to obtain the complete upstream and downstream homologous arm fusion fragment as Figure 2 shown.

[0062] Fusion PCR amplification system: 1 μL of upstream and downstream homologous recombination arm DNA, 1.5 μL of SEQ ID NO.1 / SEQ ID NO.4, 21 μL of ddH2O, 25 μL of 2×KOD IPCR Master Mix, Total 50 μL.

[0063] Procedure: 98 degrees for 5 min, 98 degrees for 10 sec, 63 degrees for 30 sec, 68 degrees for 20 sec, 45 cycles, 72 degrees for 10 min.

[0064] Example 3

[0065] Construction of the targeting plasmid pEMOC2::Cm-ΔqseB:

[0066] Using the restriction enzymes Not I and Sal I, the suicide plasmid pEMOC2::Cm and the upstream and downstream homologous arm fusion fragment were double-digested respectively. After digestion, the targeting plasmid pEMOC2::Cm was recovered by gel cutting, and the digested targeting fragment was purified. pEMOC2::Cm (~100 ng / μL) 16 μL, Sal I 1 μL (10 U / μL), Not I 1 μL (10 U / μL), 10×Cute one Buffer 2 μL, Totle 20 μL. React at 37 °C for 2 hours. After the digestion reaction, the vector and the targeting fragment were separated by 1% agarose electrophoresis respectively, purified by column centrifugation, and eluted in 10 μL of deionized water.

[0067] Ligation: 2 μL of pEMOC2::Cm / Not I, Sal I (~50 ng / μL), 6 μL of upstream and downstream homologous arm fusion fragment / Not I, Sal I (~50 ng / μL), 1 μL of 10×T4 buffer, T4 DNA ligase (5 U / μL), Total 10 μL, react overnight at 4℃.

[0068] Transformation: Transform the ligation product into DH5α competent cells by calcium transformation method, and culture on LB plate (chloramphenicol 25 mg / mL) at 37℃ until monoclonal colonies form.

[0069] Preparation of positive clone and targeting plasmid: Monoclonal colonies growing on chloramphenicol resistant plate contain the targeting plasmid. Randomly select one monoclonal colony for subsequent experiments and name it pEMOC2::Cm-ΔqseB. Inoculate the clone into 5 mL LB (containing chloramphenicol 25 mg / mL), culture at 37℃ for 14 - 16 h, and then purify plasmid DNA by column centrifugation.

[0070] Transform the targeting plasmid into Escherichia coli β2155 by calcium transformation, spread on LB (chloramphenicol 25 mg / mL), 0.5 mM DAP (diaminopimelic acid), and culture at 37℃ until monoclonal colonies form. This monoclonal colony is used as the donor strain β2155 / pEMOC2::Cm-ΔqseB for conjugation transfer experiment.

[0071] Conjugation transfer experiment:

[0072] (1) Streak the recipient bacterium Actinobacillus pleuropneumoniae S4074 on TSA plate, and culture at 37℃ until monoclonal colonies form. Pick a monoclonal colony into 5 mL TSB medium containing 10% newborn bovine serum and 0.1% NAD, and culture at 37℃, 180 rpm until the logarithmic growth phase.

[0073] (2) Pick a monoclonal colony of β2155 / pEMOC2::Cm-ΔqseB into 5 mL LB (containing chloramphenicol 25 mg / mL, 0.5 mM DAP). Culture at 37℃, 180 rpm overnight.

[0074] (3) Mix the β2155 / pEMOC2::Cm-ΔqseB bacterial solution with 500 μL of the recipient bacterium bacterial solution for conjugation experiment.

[0075] (4) Spread an appropriate amount of the conjugated bacterial solution on TSA plate containing chloramphenicol 1 mg / mL, and culture at 37℃ until monoclonal colonies form.

[0076] Example 4

[0077] Screening of ΔqseB gene knockout strain:

[0078] (1) On the resistant plate, randomly select 3 monoclonal colonies, pick them into 1 mL of TSB medium containing 10% newborn bovine serum and 0.1% NAD using a 10 μL pipette tip. Incubate at 37 °C and 180 rpm until turbid. Take a small amount of bacterial liquid and perform PCR identification using the external and internal primers of the qseB gene. The amplified length of the original strain with the external primer S4074 is 1557 bp, and for the target strain, it is 967 bp. The amplified length of the original strain with the internal primer S4074 is 198 bp, and for the target strain, it is also 198 bp. The results are as Figure 3 shown. The results indicate that the qseB gene of this monoclonal colony has been replaced.

[0079] The sequences of the above-mentioned internal and external primers are as follows:

[0080] SEQ ID NO.5: qseB-N-F: CCGCAAGGGATACGTTAGACGA

[0081] SEQ ID NO.6: qseB-N-R: CGGCAAGGGTTACTTTGTGGGT

[0082] SEQ ID NO.7: qseB-W-F: ACGAAACGGTTCAGAATCAAACT

[0083] SEQ ID NO.8: qseB-W-R: TCAATAGCGGTAGAGCGATAAAA

[0084] PCR reaction system for external primer identification: 1 μL of bacterial liquid, 1 μL of qseB-W-F / qseB-W-R, 7 μL of dd H2O, 10 μL of 2×Magic Green Taq SuperMix, Total 20 μL.

[0085] Procedure: 95 degree 3 min, 95 degree 10 sec, 52 degree 10 sec, 72 degree 60 sec, 35 cycles, 72 degree 10 min.

[0086] PCR reaction system for internal primer identification: 1 μL of bacterial liquid, 1 μL of qseB-N-F / qseB-N-R, 7 μL of ddH2O, 10 μL of 2×Magic Green Taq SuperMix, Total 20 μL.

[0087] Program: 95degree 3min, 95degree 10sec, 51degree 10sec, 72degree 60sec, 35cycles, 72degree 10min.

[0088] (2) After successful identification, remove the intermediate state single clone of the previous recombination on the genome. The pure secondary recombination positive clone no longer has the qseB gene, and the internal primer amplification result is negative. The single exchange monoclonal strain is inoculated in TSB liquid culture medium containing 10% newborn calf serum and 0.1% NAD, and subcultured at 37°C shaking. Take an appropriate amount of bacterial liquid from each generation of strains and dilute it to a suitable dilution, and apply it to TSA solid culture medium containing 10% newborn calf serum and 0.1% NAD. The grown single colonies are copied to 10% newborn calf serum TSA solid culture medium containing chloramphenicol resistance and without resistance, and cultured in a constant temperature incubator at 37°C. The strain that does not grow in the medium containing resistance and grows in the medium without resistance is suspected to be the ΔqseB gene deletion strain of Actinobacillus pleuropneumoniae. The strain is inoculated in TSB liquid culture medium containing 10% newborn calf serum and 0.1% NAD, and cultured at 37°C shaking until the bacterial liquid becomes turbid. After the bacterial solution becomes turbid, the sample is identified using the bacterial solution as a template and internal and external primers. Figure 4 shown.

[0089] Strain preservation: Take 700 μL of fresh culture solution of the ΔqseB gene deletion strain of Actinobacillus pleuropneumoniae, add 300 μL of 80% sterile glycerol as the strain, and store it at -80°C for a long time.

[0090] Example 5

[0091] Survival of the ΔqseB deletion strain of Actinobacillus pleuropneumoniae:

[0092] (1) Activation culture of strains: The ΔqseB deletion strain of Actinobacillus pleuropneumoniae and the original strain Actinobacillus pleuropneumoniae S4074 frozen at -80°C were streaked on TSA medium (containing 10% newborn calf serum and 0.1% NAD), cultured at 37°C for 12 hours, and single clones were picked in 5 mL TSB medium (containing 10% newborn calf serum and 0.1% NAD). After turbidity, they were inoculated into 5 mL TSB liquid medium (containing 10% newborn calf serum and 0.1% NAD) at a ratio of 1:1000. Cultured at 37°C, 180 rpm for 12 hours. Transferred to 5 mL TSB liquid medium (containing 10% newborn calf serum and 0.1% NAD) at a ratio of 1:100, and cultured at 37°C, 180 rpm.

[0093] (2) Mouse challenge: A total of 16 Kunming mice at 6 weeks of age were divided into two groups of 8 mice each. The Actinobacillus pleuropneumoniae ΔqseB deletion strain and the original strain Actinobacillus pleuropneumoniae S4074 were cultured to the logarithmic growth phase until the OD 600 = 0.6 bacterial suspension, which was diluted to 10 8 CFU / mL with 0.9% saline. 100 μL of the diluted bacterial suspension was used for mouse challenge (the challenge dose was 10 7 CFU / mL), and the death of mice within 7 days was recorded. The results are shown in Figure 5 .

[0094] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the claims of the present invention.

Claims

1. A ΔqseB gene deletion strain of Actinobacillus pleuropneumoniae, characterized in that: Constructed by: (1) Using primers SEQ ID NO.1 / SEQ ID NO.2 and SEQ ID NO.3 / SEQ ID NO.4, upstream and downstream homologous recombination arms were amplified from the genome of Actinobacillus pleuropneumoniae, respectively; (2) using the product of step (1) as a template, performing fusion PCR with primers SEQ ID NO.1 / SEQ ID NO.4 to obtain a homology arm fusion fragment; (3) The fusion fragment and suicide plasmid pEMOC2::Cm were double-digested with Not I and Sal I, and then ligated with T4 DNA ligase to construct the recombinant targeting plasmid pEMOC2::Cm-ΔqseB; (4) The recombinant plasmid was transformed into Escherichia coli DH5α, and the chloramphenicol resistance was screened and SEQ ID NO.5 / SEQ ID NO.6 and SEQ ID NO.7 / SEQ ID NO.8 primers were used for PCR verification to obtain DH5α / pE MOC2::Cm-ΔqseB engineered bacteria; (5) Transforming the verified plasmid into Escherichia coli β2155 to obtain donor bacteria β2155 / pEMOC2::Cm-Δqse B; (6) The ΔqseB gene-deficient strain was obtained by conjugation transfer between donor bacteria and Actinobacillus pleuropneumoniae S4074.

2. The method according to claim 1, characterized in that The PCR conditions in step (2) are: 98 degree 5 min, 98 degree 10 sec, 63 degree 30 sec, 68 degree 20 sec, 45 cycles, 72 degree 10 min.

3. The homologous recombination DNA fragment for constructing the ΔqseB gene deletion strain according to claim 1, characterized in that: The primer sequences are shown in SEQ ID NO.1 / SEQ ID NO.

4.

4. A recombinant suicide plasmid, characterized in that: Comprising the DNA fragment of claim 3, the plasmid is pEMOC2::Cm-ΔqseB.

5. A plasmid amplification host bacteria, characterized in that: Carrying the recombinant suicide plasmid according to claim 4.

6. The plasmid amplification host bacteria according to claim 5, characterized in that: The plasmid amplification host bacteria is DH5α-pEMOC2::Cm-ΔqseB.

7. A conjugative transfer donor bacterium, characterized in that: Carrying the recombinant suicide plasmid according to claim 4.

8. The plasmid amplification host bacteria according to claim 7, characterized in that: The conjugative transfer donor bacteria is β2155-pEMOC2::Cm-ΔqseB.

9. Use of the ΔqseB gene deletion strain according to claim 1 in the preparation of a live attenuated vaccine of Actinobacillus pleuropneumoniae.

10. An attenuated vaccine of Actinobacillus pleuropneumoniae, characterized in that: Comprising the ΔqseB gene deletion according to claim 1.