Actinobacillus pleuropneumoniae delta fis gene deleted strain as well as construction and application thereof
By constructing the Δfis deletion strain of Actiobacter pleuropneumoniae, using primer amplification and engaging transfer technology, the problem of difficulty in controlling the infection of Actiobacter pleuropneumoniae in the prior art was solved, and the incidence and mortality were reduced, and the environmental adaptability and genomic stability of the bacteria were enhanced.
Patent Information
- Application Number
- CN202510331271.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art is difficult to effectively control the infection of Actinobacter pleuropneumoniae, resulting in high incidence and mortality. The fis protein plays a key role in bacterial growth and gene regulation, affecting the infection process.
The Δfis deletion strain of Actiobacter pleuropneumoniae was constructed, and the upstream and downstream homologous recombinant arms were amplified by designing specific primers. The suicide plasmid pEMOC2::Cm was used for gene knockout, and the E. coli β2155 strain was combined for engaging and transfer, and the target strain with the deletion of the fis gene was obtained.
It has achieved effective control of the infection of Actinobacter pleuropneumoniae, reduced the incidence and mortality, enhanced the adaptability to environmental changes, and stabilized the integrity of the genome and DNA replication and repair.
Smart Images

Figure CN120173853A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for constructing an Actinobacillus pleuropneumoniae Δfis gene deletion strain and its application. Background Art
[0002] Actinobacillus pleuropneumoniae (APP) is a bacterium belonging to the genus Actinobacillus of the family Pasteurellaceae. It is a Gram-positive, sporeless, and capsular-producing bacterium, and is the main pathogen causing contagious porcine pleuropneumonia. Pigs of all ages and genders are susceptible. The disease often has a short course and sudden death, and the morbidity and mortality rates can reach 100%. The disease is widely prevalent globally, causing huge economic losses to the pig industry.
[0003] APP has a capsule and has a strong affinity for alveolar epithelium. After being phagocytosed by phagocytes, APP releases a large amount of RTX toxin, which ultimately lyses the phagocytes and destroys alveolar macrophages, pulmonary endothelial cells, and epithelial cells. The infection of APP can stimulate the body to produce a large number of inflammatory factors, such as IL-1, IL-6, IL-8, and tumor necrosis factor. At the same time, lipopolysaccharide can activate the complement-binding reaction, further activating neutrophils and platelets, causing vasodilation, congestion or hemorrhage. After platelet activation, microthrombi are formed locally, resulting in local ischemia, followed by tissue necrosis, accompanied by a large amount of fibrinous exudation, forming pathological changes such as hemorrhagic, fibrinous, and necrotic pleuropneumonia seen clinically.
[0004] The full name of the fis gene is Factor for inversion stimulation, which encodes the fis protein. Fis is a homodimer found in enteric bacteria, consisting of 98 residues and assembled into a coiled dimer, which contains a flexible and mostly disordered N-terminus followed by four α-helices.
[0005] The fis protein is involved in a variety of cellular functions and plays a key role especially in the processes of bacterial gene expression regulation, DNA replication, and recombination. The following are some of the main functions of the fis protein:
[0006] Regarding the precise control of gene expression: The role of proteins in the life activities of bacteria is particularly crucial. It can not only act as a transcription factor to directly regulate numerous genes, but also play a vital role in regulating the binding and activity of RNA polymerase, thereby precisely regulating the expression intensity of specific genes.
[0007] Regarding the maintenance and adjustment of the overall DNA structure: The function of the Fis protein involves influencing the supercoiled conformation of DNA molecules, thereby participating in the folding of DNA and the maintenance of the overall structure. It is worth noting that the Fis protein also has the ability to promote or stabilize DNA bending, which is essential for ensuring the normal expression of certain genes.
[0008] Regarding DNA replication and repair: The Fis protein plays an important role in regulating the initiation of DNA replication, especially in the initial region of bacterial chromosome replication. In addition, the Fis protein is actively involved in the process of DNA repair, providing strong support for maintaining the stability and integrity of the genome.
[0009] Regarding the regulation of genome rearrangement and genetic material movement: The Fis protein plays a crucial role in the rearrangement of the bacterial genome, such as inversion and transposition. The Fis protein can stimulate the movement of certain genetic materials, thereby affecting the plasticity of the bacterial genome.
[0010] Regarding the response to environmental changes: Bacteria can make corresponding adjustments according to environmental changes, and all of this is based on the regulation of gene expression. The Fis protein encoded by the fis gene can affect the activity of RNA polymerase, thereby enhancing or inhibiting the transcription of specific genes, enabling bacteria to quickly adjust their physiological processes such as metabolism and growth. In this way, bacteria can more efficiently adapt to environmental changes.
[0011] It should be noted that the level of the Fis protein changes dynamically during the bacterial growth cycle. Especially during the rapid growth phase, its expression level increases significantly, thus assisting bacteria to better adapt to environmental changes. Summary of the Invention
[0012] The present invention aims to provide the construction of an Actinobacillus pleuropneumoniae Δfis deletion strain.
[0013] To achieve the above object, the present invention adopts the following technical solutions:
[0014] (1) The upstream homologous recombination arm was amplified from the genome of Actinobacillus pleuropneumoniae S4074 using primers fis-S-F and fis-S-R, and the downstream homologous recombination arm was amplified using primers fis-X-F and fis-X-R. The upstream and downstream homologous recombination arms of the fis gene were ligated by fusion PCR using primers fis-S-F and fis-X-R to obtain a complete upstream and downstream fusion fragment. It is characterized in that the sequences of primers fis-S-F and fis-S-R are shown in SEQ ID NO.1 and SEQ ID NO.2; the sequences of primers fis-X-F and fis-X-R are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0015] (2) The upstream and downstream homologous arm fusion fragment was cloned into the suicide plasmid pEMOC2::Cm to obtain the targeting plasmid pEMOC2::Cm-Δfis.
[0016] (3) The targeting plasmid pEMOC2::Cm-Δfis was transformed into Escherichia coli strain β2155 by calcium transformation, and cultured until monoclonal formation was achieved, thus obtaining the donor strain β2155 / pEMOC2::Cm-Δfis.
[0017] (4) The donor strain β2155 / pEMOC2::Cm-Δfis was conjugated with the recipient bacterium Actinobacillus pleuropneumoniae S4074, and the conjugated bacterial solution was cultured until monoclonal formation was achieved, obtaining the target strain Actinobacillus pleuropneumoniae Δfis deletion strain.
[0018] The object of the present invention is to provide an Actinobacillus pleuropneumoniae Δfis gene deletion strain constructed by the above method. Description of the Drawings
[0019] Figure 1 It is the electrophoresis diagram of the fis upstream homologous recombination arm and the downstream homologous recombination arm. In the figure, M: DNA molecular weight standard. The molecular weights from top to bottom are: 2000, 1000, 750, 500, 250, 100bp. fis-S: upstream homologous recombination arm, with a length of 923bp; fis-X: downstream homologous recombination arm, with a length of 1017bp.
[0020] Figure 2 It is the electrophoresis diagram of the upstream and downstream homologous arm fusion fragment amplified by primers fis-S-F and fis-X-R. In the figure, M: DNA molecular weight standard. The molecular weights from top to bottom are: 2000, 1000, 750, 500, 250, 100bp. 1: upstream and downstream homologous arm fusion fragment, with a length of 1940bp. It is characterized in that the sequences of primers fis-S-F and fis-X-R are shown in SEQ ID NO.1 and SEQ ID NO.3.
[0021] Figure 3 Electrophoretogram of the amplified conjugative transfer monoclonal by fis-W-F and fis-W-R. In the figure, M: DNA molecular weight standard. The molecular weights from top to bottom are: 2000, 1000, 750, 500, 250, 100 bp. 1-4: Monoclonal amplified by external primers. The primer sequences of fis-W-F and fis-W-R are shown in SEQ ID NO.7 and SEQ ID NO.8.
[0022] Figure 4 Electrophoretogram of the amplification products of internal primers and external primers. In the figure, M: DNA molecular weight standard. The molecular weights from top to bottom are: 2000, 1000, 750, 500, 250, 100 bp. 1: Amplification result of the internal primer of Actinobacillus pleuropneumoniae Δfis gene deletion strain; 2: Negative control of internal primer (sterile water as negative control); 3: Positive control (amplification result of the internal primer of Actinobacillus pleuropneumoniae S4074); 4: Amplification result of the external primer of Actinobacillus pleuropneumoniae Δfis gene deletion strain; 5: Negative control of external primer (sterile water as negative control); 6: Positive control (amplification result of the external primer of Actinobacillus pleuropneumoniae S4074)
[0023] Figure 5 The challenge doses are both 10 7 Survival curves of 6-week-old Kunming mice infected with Actinobacillus pleuropneumoniae S4074 and Actinobacillus pleuropneumoniae Δfis gene deletion strain at 10 CFU / mL. Specific implementation examples
[0024] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources without special instructions.
[0025] 1. Design primers according to the fis gene and its upstream and downstream sequences in the NCBI database. The primer names and sequences are as follows:
[0026] SEQ ID NO.1: fis-S-F: CTGTCGACTTCGGAGATGATGTCCACAAACCC SEQ ID NO.2: fis-S-R: ACCCATACCGTATTTTTTTAATTTTACATTGATA CCGTTAATGGGTTTTG
[0027] SEQ ID NO.3: fis-X-F: CAAAACCCATTAACGGTATCAATGTAAAATTAAAAAAATACGGTATGGGT
[0028] SEQ ID NO.4: fis-X-R: ATGCGGCCGCTAAGGAAAGCATCCAAAACAG CCCG
[0029] SEQ ID NO.5: fis-N-F: CAAGCACAACAAGTGAACAAACC
[0030] SEQ ID NO.6: fis-N-R: TGCATAACCATATCTAACATCGG
[0031] SEQ ID NO.7: fis-W-F: CCTTTTGGATTTGCCTTTGGATGAA
[0032] SEQ ID NO.8: fis-W-R: TTTTTGACGCTTTCGACTATATCAG
[0033] 2. Construction of Actinobacillus pleuropneumoniae Δfis gene deletion strain
[0034] (1) Amplify the upstream homologous recombination arm from the Actinobacillus pleuropneumoniae genome using primers fis-S-F and fis-S-R, and amplify the downstream homologous recombination arm using primers fis-X-F and fis-X-R, as Figure 1 shown.
[0035] The primer sequences are as follows:
[0036] SEQ ID NO.1: fis-S-F: CTGTCGACTTCGGAGATGATGTCCACAAACCC T
[0037] SEQ ID NO.2: fis-S-R: ACCCATACCGTATTTTTTTAATTTTACATTGATACCGTTAATGGGTTTTG
[0038] SEQ ID NO.3: fis-X-F: CAAAACCCATTAACGGTATCAATGTAAAATTAAAAAAATACGGTATGGGT
[0039] SEQ ID NO.1: fis-X-R: ATGCGGCCGCTAAGGAAAGCATCCAAAACAG CCCG
[0040] PCR amplification system for the amplification of the upstream homologous recombination arm: 1 μL of S4074 bacterial solution, 2 μL of fis-S-F / fis-S-R, 20 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.
[0041] Procedure: 98 degree 5 min, 98 degree 10 sec, 60 degree 30 sec, 68 degree 10 sec, 45 cycles, 72 degree 10 min.
[0042] PCR amplification system for the amplification of the downstream homologous recombination arm: 1 μL of S4074 bacterial solution, 2 μL of fis-X-F / fis-X-R, 20 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.
[0043] Procedure: 98 degree 5 min, 98 degree 10 sec, 65 degree 30 sec, 68 degree 10 sec, 45 cycles, 72 degree 10 min.
[0044] (2) Use primers fis-S-F and fis-X-R to connect the upstream and downstream homologous recombination arms through fusion PCR technology to obtain a complete upstream and downstream homologous arm fusion fragment as Figure 2 shown.
[0045] Fusion PCR amplification system: 1 μL of upstream and downstream homologous recombination arm DNA, 1.5 μL of fis-S-F / fis-X-R, 21 μL of ddH2O, 25 μL of 2×KOD I PCR Master Mix, Total 50 μL.
[0046] Procedure: 98 degree 5 min, 98 degree 10 sec, 63 degree 30 sec, 68 degree 20 sec, 45 cycles, 72 degree 10 min.
[0047] (3) Construction of the targeting plasmid pEMOC2::Cm-Δfis: The suicide plasmid pEMOC2::Cm and the upstream and downstream homologous arm fusion fragments were double digested with the restriction endonucleases Not I and Sal I. After gel extraction of the digested targeting plasmid pEMOC2::Cm, the digested targeting fragment was purified. 16 μL of pEMOC2::Cm (~100 ng / μL), 1 μL of Sal I (10 U / μL), 1 μL of Not I (10 U / μL), 2 μL of 10×Cute one Buffer, Total 20 μL. React at 37°C for 2 hours. After the digestion reaction, the vector and the targeting fragment were separated by 1% agarose electrophoresis, purified by column centrifugation, and eluted in 10 μL of deionized water.
[0048] (4) Ligation: 2 μL of pEMOC2::Cm / Not I, Sal I (~50 ng / μL), 6 μL of the upstream and downstream homologous arm fusion fragment / Not I, Sal I (~50 ng / μL), 1 μL of 10×T4 buffer, T4 DNA ligase (5 U / μL), Total 10 μL, React overnight at 4°C.
[0049] (5) Transformation: The ligation product was transformed into DH5α competent cells by the calcium transformation method and cultured on an LB plate (chloramphenicol 25 mg / mL) at 37°C until monoclonal formation.
[0050] (6) Preparation of positive clones and targeting plasmids: Monoclonal colonies growing on the chloramphenicol-resistant plate contained the targeting plasmid. One monoclonal colony was randomly selected for subsequent experiments and named pEMOC2::Cm-Δfis. The clone was inoculated into 5 mL of LB (containing chloramphenicol 25 mg / mL) and cultured at 37°C for 14 - 16 h, then the plasmid DNA was purified by column centrifugation.
[0051] (7) The targeting plasmid was transformed into Escherichia coli β2155 by calcium transformation and spread on LB (chloramphenicol 25 mg / mL), 0.5 mM DAP (diaminopimelic acid), and cultured at 37°C until monoclonal formation. This monoclonal colony was used as the donor strain β2155 / pEMOC2::Cm-Δfis for the conjugation transfer experiment.
[0052] (8) Conjugation transfer experiment:
[0053] a. The recipient bacterium Actinobacillus pleuropneumoniae S4074 was streaked on a TSA plate and cultured at 37°C until monoclonal formation. A single monoclonal colony was picked and inoculated into 5 mL of TSB medium containing 10% newborn bovine serum and 0.1% NAD, and cultured at 37°C and 180 rpm until the logarithmic growth phase.
[0054] b. Inoculate the β2155 / pEMOC2::Cm-Δfis monoclonal into 5 mL of LB (containing 25 mg / mL of chloramphenicol and 0.5 mM DAP). Incubate overnight at 37 °C with shaking at 180 rpm.
[0055] c. Mix the β2155 / pEMOC2::Cm-Δfis bacterial solution with 500 μL of the recipient bacterial solution for a conjugation experiment.
[0056] d. Spread an appropriate amount of the post-conjugation bacterial solution on a TSA plate containing 1 mg / mL of chloramphenicol and incubate at 37 °C until monoclonal colonies form.
[0057] (9) Screening of Δfis gene knockout strains:
[0058] a: On the resistant plate, randomly select 3 monoclonal colonies and pick them into 1 mL of TSB medium containing 10% newborn bovine serum and 0.1% NAD using a 10 μL pipette tip. Incubate at 37 °C with shaking at 180 rpm until turbid. Take a small amount of the bacterial solution and perform PCR identification using the external and internal primers of the fis gene. The amplification length of the original strain with the external primer S4074 is 1940 bp, and for the target strain, it is 1017 bp. The amplification length of the original strain with the internal primer S4074 is 923 bp, and for the target strain, it is 923 bp. The results are as Figure 3 shown. The results indicate that the fis gene of this monoclonal has been replaced.
[0059] The sequences of the above-mentioned internal and external primers are as follows:
[0060] fis-N-F: CAAGCACAACAAGTGAACAAACC
[0061] fis-N-R: TGCATAACCATATCTAACATCGG
[0062] fis-W-F: CCTTTTGGATTTGCCTTTGGATGAA
[0063] fis-W-R: TTTTTGACGCTTTCGACTATATCAG
[0064] PCR reaction system for external primer identification: 1 μL of bacterial solution, 1 μL of fis-W-F / fis-W-R, 7 μL of ddH2O, 10 μL of 2×Magic Green Taq SuperMix, Total 20 μL.
[0065] Program: 95degree 3min, 95degree 10sec, 52degree 10sec, 72degree 60sec, 35cycles, 72degree 10min.
[0066] Internal primer identification PCR reaction system: bacterial solution 1μL, fis-NF / fis-NR 1μL, ddH2O 7μL, 2×Magic Green Taq SuperMix 10μL, Total 20μL.
[0067] Program: 95degree 3min, 95degree 10sec, 51degree 10sec, 72degree 60sec, 35cycles, 72degree 10min.
[0068] b: After successful identification, remove the intermediate state single clone of the previous recombination in the genome. The pure secondary recombination positive clone no longer has the fis gene, and the internal primer amplification result is negative. The single exchange monoclonal strain is inoculated in TSB liquid medium containing 10% newborn calf serum and 0.1% NAD, and subcultured at 37°C shaking. Take an appropriate amount of bacterial liquid from each generation of strains and dilute it to the appropriate dilution, and apply it to TSA solid medium containing 10% newborn calf serum and 0.1% NAD. The grown single colonies are copied to 10% newborn calf serum TSA solid medium containing chloramphenicol resistance and without resistance, and cultured in a constant temperature incubator at 37°C. The strain that does not grow in the medium containing resistance and grows in the medium without resistance is suspected to be a Δfis gene deletion strain of Actinobacillus pleuropneumoniae. The strain is inoculated in TSB liquid medium containing 10% newborn calf serum and 0.1% NAD, and cultured at 37°C shaking until the bacterial liquid is turbid. After the bacterial solution becomes turbid, the sample is identified using the bacterial solution as a template and internal and external primers. Figure 4 shown.
[0069] (10) Strain preservation: Take 700 μL of fresh culture medium of the Δfis gene-deficient strain of Actinobacillus pleuropneumoniae, add 300 μL of 80% sterile glycerol as the strain, and store it at -80°C for long-term storage.
[0070] (11) Survival of the Δfis deletion strain of Actinobacillus pleuropneumoniae
[0071] a: Bacterial strain activation and culture: Streptococcus suis serotype 2 Δfis deletion strain and the original strain Streptococcus suis serotype 2 S4074 stored at -80°C were streaked on TSA medium (containing 10% newborn bovine serum and 0.1% NAD) respectively and cultured at 37°C for 12 h. Single colonies were picked and inoculated into 5 mL of TSB medium (containing 10% newborn bovine serum and 0.1% NAD). After turbidity, the culture was inoculated into 5 mL of TSB liquid medium (containing 10% newborn bovine serum and 0.1% NAD) at a ratio of 1:1000 and cultured at 37°C and 180 rpm for 12 h. Then it was transferred to 5 mL of TSB liquid medium (containing 10% newborn bovine serum and 0.1% NAD) at a ratio of 1:100 and cultured at 37°C and 180 rpm.
[0072] b: Mouse challenge: A total of 16 six-week-old Kunming mice were divided into two groups of 8 mice each. The Streptococcus suis serotype 2 Δfis deletion strain and the original strain Streptococcus suis serotype 2 S4074 were cultured until the bacterial liquid reached an OD 600 of 0.6 at the logarithmic growth phase, and then diluted to 10 8 CFU / mL with 0.9% normal saline. 100 μL of the diluted bacterial liquid was used for mouse challenge (the challenge dose was 10 7 CFU / mL), and the death of mice within 7 days was recorded.
Claims
1. A Δfis gene deletion strain of Actinobacillus pleuropneumoniae, characterized in that: Constructed by: (1) Using primers SEQ ID NO.1 / SEQ ID NO.2 and SEQ ID NO.3 / SEQ ID NO.4, upstream and downstream homologous recombination arms were amplified from the genome of Actinobacillus pleuropneumoniae, respectively; (2) using the product of step (1) as a template, performing fusion PCR with primers SEQ ID NO.1 / SEQ ID NO.4 to obtain a homology arm fusion fragment; (3) The fusion fragment and suicide plasmid pEMOC2::Cm were double-digested with Not I and Sal I, and then ligated with T4 DNA ligase to construct the recombinant targeting plasmid pEMOC2::Cm-Δfis; (4) The recombinant plasmid was transformed into Escherichia coli DH5α, and the chloramphenicol resistance was screened and SEQ ID NO.5 / SEQ ID NO.6 and SEQ ID NO.7 / SEQ ID NO.8 primers were used for PCR verification to obtain DH5α / pE MOC2::Cm-Δfis engineered bacteria; (5) Transforming the verified plasmid into Escherichia coli β2155 to obtain donor bacteria β2155 / pEMOC2::Cm-Δfis; (6) The Δfis gene-deficient strain was obtained by conjugation transfer between donor bacteria and Actinobacillus pleuropneumoniae S4074.
2. The method according to claim 1, characterized in that The PCR conditions in step (2) are: 98 degree 5 min, 98 degree 10 sec, 63 degree 30 sec, 68 degree 20 sec, 45 cycles, 72 degree 10 min.
3. The homologous recombination DNA fragment for constructing the Δfis gene deletion strain according to claim 1, characterized in that: The primer sequences are shown in SEQ ID NO.1 / SEQ ID NO.
4.
4. A recombinant suicide plasmid, characterized in that: Comprising the DNA fragment of claim 3, the plasmid is pEMOC2::Cm-Δfis.
5. A plasmid amplification host bacteria, characterized in that: Carrying the recombinant suicide plasmid according to claim 4.
6. The plasmid amplification host bacteria according to claim 5, characterized in that: The plasmid amplification host bacteria is DH5α-pEMOC2::Cm-Δfis.
7. A conjugative transfer donor bacterium, characterized in that: Carrying the recombinant suicide plasmid according to claim 4.
8. The plasmid amplification host bacteria according to claim 7, characterized in that: The conjugative transfer donor bacteria is β2155-pEMOC2::Cm-Δfis.
9. Use of the Δfis gene deleted strain according to claim 1 in the preparation of a live attenuated vaccine of Actinobacillus pleuropneumoniae.
10. An attenuated vaccine of Actinobacillus pleuropneumoniae, characterized in that: Comprising the Δfis gene deletion according to claim 1.