Passion flower lipoxygenase gene and application thereof

By cloning and expressing the passionflower PeLOX2 gene, the lack of localization and utilization of passionflower-like genes in the existing technology has been solved, and the effects of improving plant stress resistance and fruit maturity have been achieved, providing new genetic tools for the development and utilization of passionflower.

CN120173976AActive Publication Date: 2025-06-20SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510657916.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-21
Publication Date
2025-06-20
Estimated Expiration
2045-05-21

AI Technical Summary

Technical Problem

The prior art is difficult to effectively locate, clone and utilize important genes in passionflower, which limits the comprehensive development and utilization of passionflower.

Method used

It provides a passionflower PeLOX2 gene and its application. By cloning and expressing the gene, it improves the characteristics of tomato fruit ripening, drought resistance and slender leaves.

Benefits of technology

The effect of improving plant stress resistance, fruit maturity and changing leaves and fruit size has been achieved, providing new candidate genes for the comprehensive development and utilization of passionflower.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173976A_ABST
    Figure CN120173976A_ABST
Patent Text Reader

Abstract

The invention provides a passion flower PeLOX2 gene. The nucleotide sequence of the passion flower PeLOX2 gene is shown as SEQ ID NO: 1. The invention provides the passion flower PeLOX2 gene cloned from passion flower for the first time, and the passion flower PeLOX2 gene can respond to fruit ripening, enable plant fruits to become smaller, improve the ripening of the plant fruits, improve the drought resistance of plants, enable plant leaves to be slender and the like. The invention provides a new candidate gene for research in the aspects of improving the stress resistance of plants, improving the ripening of plant fruits, changing the sizes of plant leaves and fruits and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biology, and particularly relates to a passion fruit lipoxygenase gene and its application. Background Art

[0002] Passion fruit is a perennial evergreen climbing woody vine. Its fruit is a fragrant and delicious fruit, known as the "king of fruit juices". Its natural juice has bright color, unique and rich aromatic flavor, and abundant nutrition. It is measured that passion fruit juice contains more than 60 volatile compounds, and the soluble solid content is as high as 10 - 14%. The contents of organic acids, amino acids, vitamins and mineral elements are all very rich. As a raw material, it can be processed into products such as fruit juice, fruit nectar, jam, jelly, etc., which have the effects of beauty care, relieving summer heat and stimulating appetite, eliminating fatigue, refreshing and sobering up, reducing inflammation and removing freckles, reducing blood lipid and blood pressure, and preventing arteriosclerosis. Due to the increasingly wide application of passion fruit, the research on its molecular biology has been continuously deepened and developed, and gene expression analysis has gradually been applied to reveal the mechanism of passion fruit gene expression and regulation. Therefore, the localization, cloning, function, etc. of important trait genes in passion fruit are of great significance for the comprehensive development and utilization of passion fruit. Summary of the Invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a passion fruit lipoxygenase gene and its application.

[0004] The first aspect of the present invention is to provide a passion fruit PeLOX2 gene for enhancing the lipoxygenase activity of tomatoes, and its nucleotide sequence is as shown in SEQ ID NO:1.

[0005] The second aspect of the present invention is to provide the protein encoded by the passion fruit PeLOX2 gene described in the first aspect of the present invention.

[0006] The third aspect of the present invention is to provide a recombinant vector containing the coding region of the passion fruit PeLOX2 gene described in the first aspect of the present invention.

[0007] Among them, the original vector of the recombinant vector can adopt the vectors commonly used in the field of gene recombination, such as viruses, plasmids, etc. The present invention does not limit this. In a specific embodiment of the present invention, the original vector adopts the pCAMBIA1304 expression vector, etc., but it should be understood that the present invention can also adopt other plasmids or viruses, etc.

[0008] Preferably, the original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the coding region of the passion fruit PeLOX2 gene is located between the NcoI and SpeI restriction enzyme sites of the pCAMBIA1304 expression vector. The fourth aspect of the present invention is to provide a host bacterium containing the coding region of the passion fruit PeLOX2 gene described in the first aspect.

[0009] The fifth aspect of the present invention is to provide an expression cassette containing the coding region of the passion fruit PeLOX2 gene described in the first aspect of the present invention.

[0010] The sixth aspect of the present invention is to provide the application of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in making tomato fruits smaller.

[0011] The seventh aspect of the present invention is to provide the application of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing the lipoxygenase (LOX) activity of tomatoes.

[0012] The eighth aspect of the present invention is to provide the application of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in making Arabidopsis thaliana leaves become slender.

[0013] The ninth aspect of the present invention is to provide the application of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in enhancing the drought resistance of Arabidopsis thaliana.

[0014] The tenth aspect of the present invention is to provide the application of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacterium as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing the content of PRO in Arabidopsis thaliana and / or decreasing the content of MDA in Arabidopsis thaliana.

[0015] The eleventh aspect of the present invention is to provide a primer pair, which is F’: ATGCTGAAGGAAATCTT and R’: TTAGATGGAGATGCTGTTAG.

[0016] The present invention provides for the first time the cloning of the Passiflora edulis PeLOX2 gene, which can respond to fruit ripening, make the plant fruits smaller, improve the ripening of plant fruits, and can also improve the drought resistance of plants, making the plant leaves slender, etc. The present invention provides a new candidate gene for research on improving plant stress resistance, improving plant fruit ripening, changing the size of plant leaves and fruits, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Expression of the PeLOX2 gene at different fruit ripening stages.

[0018] Figure 2 Comparison of wild-type and PeLOX2 transgenic tomato fruits. A: Wild-type tomato; B: Transgenic tomato.

[0019] Figure 3 Results of LOX enzyme activity determination of wild-type and PeLOX2 transgenic tomato plants.

[0020] Figure 4 Drought resistance determination of PeLOX2 transgenic Arabidopsis thaliana.

[0021] Figure 5 Phenotype of PeLOX2 transgenic Arabidopsis thaliana. DETAILED DESCRIPTION OF THE INVENTION

[0022] The present invention will be further described below with reference to the accompanying drawings and specific embodiments for better understanding. For those not specified in the embodiments in terms of specific techniques or conditions, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. For the reagents or instruments not specified in terms of the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0023] Example 1: Cloning of the Passiflora edulis PeLOX2 gene Total RNA was extracted from Passiflora edulis f. edulis seedlings, and the first strand of cDNA was reverse transcribed. Using the first strand of cDNA as a template, PCR amplification was carried out with the full-length gene primers shown in Table 1. PeLOX2 The reaction system is shown in Table 2. The PCR amplification program is: pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 40 s, extension at 72 °C for 5 min, 35 cycles, inactivation at 72 °C for 10 min, annealing temperature 56 °C, annealing time 2 min, and the gene primers are shown in Table 1. The amplified product was recovered and sequenced, and the nucleotide sequence of the Passiflora edulis PeLOX2 gene was obtained as shown in SEQ ID NO:1.

[0024] Table 1 PeLOX2 Full-length primer Gene - ID Forward primer Reverse primer ATGCTGAAGGAAATCTTTCGGA TTAGATGGAGATGCTGTTAG Table 2 PeLOX2 PCR reaction system Component name Dosage cDNA 1µl Primer - F 1µl Primer - R 1µl 2×FastTaq Premix 12.5µl <![CDATA[H2O]]> 9.5µl Total volume 25µl

[0025] Example 2: Expression of Passiflora edulis PeLOX2 at Different Fruit Maturity Stages Select the pulp of Passiflora edulis fruits at three stages of fruit maturity (T1, two weeks before harvest, the pericarp has not fully changed color; T2, fruit maturity harvest stage, the pericarp has completely turned purplish-red; T3, one week after harvest, the pericarp has some wrinkles), and extract RNA for subsequent qRT-PCR detection.

[0026] Use the online website (https: / / www.genscript.com / tools / real-time-pcr-taqman-primer-design-tool) to design primers AGCACTTCCTGAAGAT and CTTCCACCATAGTTGG for real-time fluorescence quantitative PCR (qRT-PCR) of the PeLOX2 gene. Use the Mona MonAmp™ ChemoHS qPCR Mix kit to PeLOX2 perform qRT-PCR on the gene, with EF1α as the internal reference gene, to detect the expression of the Passiflora edulis PeLOX2 gene.

[0027] The results are as Figure 1 shown. As the Passiflora edulis fruit matures, the expression of the PeLOX2 gene gradually increases, indicating that this gene can respond to fruit maturity.

[0028] Example 3: PeLOX2 Effect of the gene on plants 1. Transform PeLOX2 gene-positive Agrobacterium Extract the total RNA from Passiflora edulis seedlings, and reverse transcribe to obtain the first strand of cDNA. Using the first strand of cDNA as a template, with ATGCTGAAGGAAATCTT and TTAGATGGAGATGCTGTTAG, perform PCR amplification reaction. The reaction system and reaction program refer to Example 1 to obtain the PeLOX2 full-length sequence with NcoI and SpeI restriction sites. Combine the pCAMBIA1304 empty vector and the PeLOX2The full-length sequence was digested with NcoI and SpeI, and then the two fragments were ligated. The ligation product was transformed into competent Escherichia coli cells and spread on LB solid medium. After single colonies grew out, positive PCR detection was performed to obtain pCAMBIA1304- PeLOX2 expression vector.

[0029] The expression vector pCAMBIA1304- PeLOX2 was transferred into competent Agrobacterium tumefaciens GV3101 cells. The Agrobacterium was spread on solid YEP medium supplemented with kanamycin and rifampicin antibiotics. After colonies grew out, PCR identification was performed. The colonies with positive PCR results were cultured in liquid medium and stored for subsequent plant infection.

[0030] 2. Transformation of tomato with PeLOX2 gene (1)Sterilization and sowing of seeds Prepare sterile tissue culture glass bottles, 1 / 2MS sowing medium, sterile water, 75% alcohol, and 10% NaClO solution in advance. Pour an appropriate amount of seeds into the sterilized tissue culture bottle, add an appropriate amount of 75% alcohol, and gently shake the bottle to quickly disinfect the seeds for 1 minute. Pour out the alcohol and wash the seeds once with sterile water. Then pour in an appropriate amount of 10% NaClO solution (84 disinfectant), and place it on a shaker at 80 - 100 rpm for 20 minutes in the dark for disinfection. Pour out the NaClO solution and wash the seeds 4 - 5 times with sterile water. Evenly sow the disinfected and washed seeds on the 1 / 2MS medium, and place them in a light incubator for cultivation (16 h of light cultivation at 25 °C and 8 h of dark cultivation at 20 °C).

[0031] (2)Cutting of explants and pre-culture After the seeds were cultured for about 9 - 10 days, select the seedlings that are about to grow true leaves. Use a surgical blade to cut off the petiole and leaf tip parts of the cotyledons. The remaining middle part is the explant (if necessary, the stem segment can be selected as the explant). Try to ensure that the wounds at both ends of the cut explant are flat. Then transfer them to the PC1 solid medium, and place about 15 explants on each plate. Incubate them at 20 °C in the dark for 1 day.

[0032] (3)Activation of Agrobacterium and infection of explants Take 100 μl of the stored Agrobacterium to be transformed and inoculate it into LB medium, add the corresponding concentrations of antibiotics (Rif + Gen + Kan) and AS, and culture it at 28 °C and 230 rpm until OD 600 = 0.8 - 1.0. According to your own operation situation, pipette an appropriate amount of the bacterial solution, centrifuge it at 5000 rpm for 5 minutes, remove the supernatant, resuspend and wash the bacterial pellet with KC liquid medium. Then centrifuge it at 5000 rpm for 5 minutes again, remove the supernatant, and add the corresponding volume of KC liquid medium to resuspend the bacterial pellet to make its OD 600= 0.1. According to the dosage of 2 - 3 mL of Agrobacterium infection solution used per plate of PC1 medium, spread the infection solution evenly on the medium so that the wounded part of the explant is in full contact with the infection solution, and keep the rest dry. After standing for 10 min, suck away the excess infection solution, and culture the infected explants in the dark at 20 °C for 2 days.

[0033] (4) Differentiation culture of explants Transfer the explants after 2 days of dark culture to the primary screening medium 2Z (MS + 30 g / L sucrose + 7 g / L agar + 1.0 mg / L 6 - BA + 0.1 mg / L NAA + 50 mg / L hygromycin + 200 mg / L ticarcillin). Every 12 - 15 days, according to the differentiation situation of the explants, transfer them to the 2Z medium again. After the differentiated buds grow on the explants, transfer them to the subculture medium 1Z. Similarly, transfer them to the 1Z medium (MS + 30 g / L sucrose + 7 g / L agar + 0.5 mg / L 6 - BA + 0.05 mg / L NAA + 50 mg / L hygromycin + 200 mg / L ticarcillin) every 12 - 15 days.

[0034] (5) Rooting culture of explants After the upper part of the stem with an independent main stem grows on the explants in the 1Z medium, cut off the main stem bud and insert it into the rooting medium ENR, and roots will form after 15 - 25 days.

[0035] (6) Continue to culture until the tomato fruits mature, and measure the fruit weight and diameter. Compared with the wild type, the fruits of transgenic tomatoes become smaller. After measurement, the average weight of a single wild - type tomato fruit is 4.21 g, and the diameter is 1.92 cm, while the average weight of a single fruit of a transgenic plant is 2.33 g, and the diameter is 1.1 cm ( Figure 2 )

[0036] (7) Determination of LOX enzyme activity in tomatoes First, take fresh tomato fruits, quickly grind them into powder with liquid nitrogen, add pre-cooled extraction buffer (containing phosphate buffer, Triton X-100, EDTA, etc.), homogenize in an ice bath, then centrifuge at 4°C and 12,000×g for 20 minutes, and collect the supernatant as the crude enzyme extract. The reaction system uses linoleic acid as the substrate (which needs to be emulsified with Tween-20 to a final concentration of 50 μM), add phosphate buffer (pH 6.5) and an appropriate amount of enzyme solution, and the total volume is 1 mL. Use the enzyme solution inactivated by boiling water as a blank control. Under the constant temperature condition of 25°C, continuously monitor at a wavelength of 234 nm with a spectrophotometer for 3 - 5 minutes, and record the change rate of absorbance over time (ΔA / min). Enzyme activity is calculated by the formula: ΔA / min multiplied by the reaction volume, divided by the molar extinction coefficient (25,000 L·mol⁻¹·cm⁻¹), optical path (1 cm), and fresh weight of the sample, and the result is expressed as enzyme activity per unit fresh weight (U / g FW). The results show that the average LOX enzyme activities in wild-type plants and transgenic plants are 2.9×10 3 u / g and 11.3×10 3 u / g ( Figure 3 ), indicating that PeLOX2 can improve fruit ripening.

[0037] 3. Transformation of Arabidopsis thaliana with the PeLOX2 gene (1) Cultivation of Arabidopsis thaliana Using vermiculite as the substrate, control the temperature at 21 - 23°C, the daily light time is 8 h during the vegetative growth period, 16 h during the reproductive growth period, the light intensity is 2000 lx, and the relative humidity in the culture room is 70% - 90% to cultivate Arabidopsis thaliana. When the seedlings grow true leaves, they can be transplanted. Cultivate until the seedlings grow new leaves, the flower stalks grow to 5 - 10 cm, lateral stalks emerge, and the Arabidopsis thaliana flowers are not fully unfolded for transformation.

[0038] (2) Infection of Arabidopsis thaliana with transgenic Agrobacterium Expand and shake the transgenic PeLOX2 positive Agrobacterium liquid with YEB medium until OD600≈1. After centrifuging the bacterial liquid at 5000 rpm for 10 min with a centrifuge, discard the supernatant and resuspend it with 50 g / L sugar water to OD≈0.8. Immerse the inflorescence of Arabidopsis thaliana in the bacterial liquid resuspended with sugar water in step 1 for 1 min, wrap the infected inflorescence of Arabidopsis thaliana with plastic wrap, place it in a 0-light incubator for 12 h, and then culture it under normal light. Harvest the T0 generation seeds of Arabidopsis thaliana after the fruit pods grow.

[0039] (3) Screening of positive plants The infiltrated Arabidopsis thaliana was cultured normally until seeds were obtained. The seeds were soaked in 75% alcohol + 2.5% Tween 100 for 1 min, repeated three times, washed once with sterile water, and after thorough sterilization, sown on MS solid medium containing hygromycin (25 µg / ml). After vernalization in a 4°C refrigerator for three days, they were cultured normally to obtain positive plants. This planting and sowing process was repeated three times until stably inherited transgenic Arabidopsis thaliana was obtained.

[0040] Wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana seeds were sown on MS medium during the same period, and the growth conditions of 4-week-old plants were observed and photographed. The results are as Figure 5 shown. Compared with the wild type, the phenotype of the transgenic PeLOX2 Arabidopsis thaliana at 4 weeks of growth showed that its leaves became slender and strip-shaped, while the leaves of wild-type plants were oval, laying a foundation for further study of the developmental function of this gene in plants.

[0041] One-month-old transgenic and wild-type Arabidopsis thaliana were placed in an incubator at 23°C and subjected to drought treatment by not watering for 12 consecutive days. The results are as Figure 4 shown. Compared with the wild type, most transgenic plants showed superior growth. Detection of relevant physiological indicators showed that, in order to further evaluate their physiological responses, we measured various indexes of transgenic and wild-type plants after drought stress. Under normal growth conditions, there was no significant difference in the contents of malondialdehyde (MDA) and proline (PRO) between transgenic and wild-type plants. After drought stress, compared with the wild type, the transgenic plants had lower MDA content and higher PRO content ( Figure 4 ). The results indicate that PeLOX2 can improve the drought resistance of transgenic plants.

[0042] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the invention are also within the scope of the present invention. Therefore, equivalent transformations and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. A passion fruit PeLOX2 gene for improving tomato lipoxygenase activity, characterized in that: Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the Passiflora edulis PeLOX2 gene as claimed in claim 1.

3. A recombinant vector or host bacteria or expression cassette containing the passion fruit PeLOX2 gene coding region according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the passion fruit PeLOX2 gene coding region is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

5. Use of the passion fruit PeLOX2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in reducing the size of tomato fruits.

6. Use of the passion fruit PeLOX2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in improving the activity of tomato lipoxygenase.

7. Use of the passion fruit PeLOX2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in making Arabidopsis leaves become elongated.

8. Use of the passion fruit PeLOX2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in improving the drought resistance of Arabidopsis thaliana.

9. Use of the passion fruit PeLOX2 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in claim 3 in increasing the PRO content in Arabidopsis thaliana and / or reducing the MDA content in Arabidopsis thaliana.

10. A primer pair, characterized in that: The primer pair is F': ATGCTGAAGGAAATCTT and R': TTAGATGGAGATGCTGTTAG.

Citation Information

Patent Citations

  • Passion flower transcription factor PeHB31 for improving drought resistance and application thereof

    CN118374512A

  • Passion flower PeGRX13 gene for improving drought resistance and application thereof

    CN119307514A