Passiflora lipoxygenase gene and its application

Abstract

The present invention provides a passion fruit PeLOX2 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1. The present invention provides a passion fruit PeLOX2 gene cloned from passion fruit for the first time. The gene can respond to fruit ripening, reduce the size of the fruit, accelerate fruit ripening, improve drought resistance, and make the leaves of the plant slender. The present invention provides a new candidate gene for research on improving plant stress resistance, accelerating plant fruit ripening, and changing plant leaf and fruit size.

Description

Technical Field

[0001] The invention belongs to the biological field, and particularly relates to a passion fruit lipoxygenase gene and application thereof. Background Art

[0002] Passionflower is a perennial, evergreen, climbing woody vine. Its fruit is a fragrant and delicious fruit, known as the "King of Juices." Its natural juice is vibrant in color, boasting a unique, rich aroma and a rich nutritional profile. According to measurements, passionflower juice contains over 60 volatile compounds, with a soluble solids content of 10-14%. It is also rich in organic acids, amino acids, vitamins, and minerals. Passionflower juice can be processed into juices, nectars, jams, jellies, and other products, boasting benefits such as beauty, cooling the body, stimulating appetite, alleviating fatigue, refreshing the mind, reducing inflammation, removing freckles, lowering blood lipids and blood pressure, and preventing arteriosclerosis. As passionflower's applications become increasingly widespread, research into its molecular biology continues to deepen and advance, with gene expression analysis increasingly being applied to elucidate the mechanisms of gene expression and regulation. Therefore, mapping, cloning, and analyzing the functions of genes responsible for important traits in passionflower are crucial for its comprehensive development and utilization. Summary of the Invention

[0003] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a passion fruit lipoxygenase gene and application thereof.

[0004] The first aspect of the present invention is to provide a passion fruit PeLOX2 gene for improving the activity of tomato lipoxygenase, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0005] The second aspect of the present invention is to provide the protein encoded by the Passiflora PeLOX2 gene of the first aspect of the present invention.

[0006] The third aspect of the present invention is to provide a recombinant vector containing the passion fruit PeLOX2 gene coding region described in the first aspect of the present invention.

[0007] The recombinant vector original vector can be a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector is a pCAMBIA1304 expression vector, but it should be understood that other plasmids or viruses can also be used in the present invention.

[0008] Preferably, the original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the passion fruit PeLOX2 gene coding region is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector. The fourth aspect of the present invention provides a host strain containing the passion fruit PeLOX2 gene coding region of the first aspect.

[0009] The fifth aspect of the present invention is to provide an expression cassette containing the passion fruit PeLOX2 gene coding region described in the first aspect of the present invention.

[0010] The sixth aspect of the present invention provides the use of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in reducing the size of tomato fruits.

[0011] The seventh aspect of the present invention is to provide the use of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing the activity of tomato lipoxygenase (LOX).

[0012] The eighth aspect of the present invention provides the use of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in making Arabidopsis leaves become slender.

[0013] The ninth aspect of the present invention is to provide the use of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving the drought resistance of Arabidopsis thaliana.

[0014] The tenth aspect of the present invention is to provide the use of the passion fruit PeLOX2 gene as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in increasing the PRO content in Arabidopsis thaliana and / or reducing the MDA content in Arabidopsis thaliana.

[0015] The eleventh aspect of the present invention is to provide a primer pair, wherein the primer pair is F': ATGCTGAAGGAAATCTT and R': TTAGATGGAGATGCTGTTAG.

[0016] The present invention provides the first cloned passion fruit PeLOX2 gene from passion fruit. This gene can respond to fruit ripening, shrinking the fruit and accelerating fruit maturation. It can also improve drought resistance and elongate leaves. This invention provides a new candidate gene for research into improving plant stress resistance, accelerating fruit maturation, and altering leaf and fruit size. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The expression of PeLOX2 gene at different maturity stages of fruit.

[0018] Figure 2 Comparison of wild-type and PeLOX2 transgenic tomato fruits. A: wild-type tomato; B: transgenic tomato.

[0019] Figure 3 The results of LOX enzyme activity determination in wild-type and PeLOX2 transgenic tomato plants.

[0020] Figure 4 This is a drought resistance test of PeLOX2 transgenic Arabidopsis thaliana.

[0021] Figure 5 The phenotype of PeLOX2 transgenic Arabidopsis thaliana. DETAILED DESCRIPTION

[0022] The present invention will be further described below with reference to the accompanying drawings and in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not specified in the examples, the methods are based on those described in the literature in this field or on the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all commercially available conventional products.

[0023] Example 1: Cloning of the Passiflora PeLOX2 gene

[0024] Total RNA was extracted from the seedlings of passion fruit and reverse transcribed to obtain the first strand of cDNA. PeLOX2PCR amplification was performed using the full-length primers. The reaction system is shown in Table 2. The PCR amplification program was as follows: 95°C pre-denaturation for 3 minutes, 95°C for 40 seconds, 72°C for 5 minutes, 35 cycles, inactivation at 72°C for 10 minutes, annealing at 56°C for 2 minutes. The primers are shown in Table 1. The amplified product was recovered and sequenced, yielding the nucleotide sequence of the Passiflora PeLOX2 gene as shown in SEQ ID NO: 1.

[0025] Table 1 PeLOX2 Full-length primers

[0026] Gene-ID F-terminal primer R-terminal primer ATGCTGAAGGAAATCTTTCGGA TTAGATGGAGATGCTGTTAG

[0027] Table 2 PeLOX2 PCR reaction system

[0028] Name of each component Usage cDNA 1µl Primer-F 1µl Primer-R 1µl 2×FastTaq Premix 12.5µl <![CDATA[H2O]]> 9.5µl Total volume 25µl

[0029] Example 2: Expression of Passiflora PeLOX2 at different fruit ripening stages

[0030] Fruit pulp from passion fruit at three stages of maturity (T1, two weeks before harvest, when the peel has not completely changed color; T2, when the fruit is ripe and ready for harvest, when the peel has completely turned purple-red; and T3, one week after harvest, when the peel is slightly wrinkled) was selected for RNA extraction for subsequent qRT-PCR analysis.

[0031] Real-time fluorescence quantitative PCR (RT-PCR) primers AGCACTTCCTGAAGAT and CTTCCACCATAGTTGG were designed for PeLOX2 gene using the online website (https: / / www.genscript.com / tools / real-time-pcr-taqman-primer-design-tool). PeLOX2 qRT-PCR was performed to detect the expression of PeLOX2 gene in Passiflora using EF1α as the internal reference gene.

[0032] The results are as follows Figure 1 As shown in Figure 3, as passion fruit matures, the expression of the PeLOX2 gene gradually increases, indicating that this gene can respond to fruit ripening.

[0033] Example 3: PeLOX2 The impact of genes on plants

[0034] 1. Transfer PeLOX2 Gene-positive Agrobacterium

[0035] Total RNA was extracted from the seedlings of passion fruit, and the first strand of cDNA was obtained by reverse transcription. The first strand of cDNA was used as a template and PCR amplification was performed with ATGCTGAAGGAAATCTT and TTAGATGGAGATGCTGTTAG. The reaction system and reaction procedure were as described in Example 1 to obtain a cDNA with NcoI and SpeI restriction sites. PeLOX2 Full-length sequence. PeLOX2 The full-length sequence was double-digested with NcoI and SpeI, and the two fragments were ligated and transformed into competent E. coli. The competent cells were spread on LB solid medium, and a positive PCR test was performed after a single colony was grown to obtain pCAMBIA1304- PeLOX2 Expression vector.

[0036] The expression vector pCAMBIA1304- PeLOX2 The Agrobacterium was transferred into the competent cell of Agrobacterium GV3101, and the Agrobacterium was spread on solid YEP medium supplemented with kanamycin and rifampicin antibiotics. After the colonies grew, PCR identification was performed, and the PCR-positive colonies were shaken and preserved for subsequent plant infection.

[0037] 2. PeLOX2 gene transformation into tomato

[0038] (1) Seed sterilization and sowing

[0039] Prepare sterile tissue culture glass bottles, 1 / 2 MS seeding medium, sterile water, 75% alcohol, and 10% NaClO solution in advance. Place an appropriate amount of seeds into the sterilized tissue culture bottle, add an appropriate amount of 75% alcohol, and gently shake the bottle to quickly disinfect the seeds for 1 minute. Discard the alcohol, rinse once with sterile water, then pour an appropriate amount of 10% NaClO solution (84 disinfectant) into the bottle. Sterilize the seeds in the dark on a shaker at 80-100 rpm for 20 minutes. Discard the NaClO solution and rinse 4-5 times with sterile water. Sow the disinfected and washed seeds evenly onto the 1 / 2 MS medium and culture them in a light incubator (16 hours in the light at 25°C, 8 hours in the dark at 20°C).

[0040] (2) Explant cutting and pre-culture

[0041] After about 9-10 days of seed culture, select seedlings that are about to grow true leaves, use a surgical blade to cut off the petiole and leaf tip of the cotyledon, and retain the middle part as the explant (stem segments can be selected as explants if necessary). Try to ensure that the wounds at both ends of the explant are smooth, and then transfer them to PC1 solid culture medium, place about 15 explants on each plate, and culture in the dark at 20℃ for 1 day.

[0042] (3) Activation of Agrobacterium and infection of explants

[0043] Take 100ul of the preserved Agrobacterium to be transformed and inoculate it into LB medium, add the corresponding concentrations of antibiotics (Rif+Gen+Kan) and AS, and culture at 28℃ and 230rpm until the OD 600 =0.8~1.0, according to your own operation conditions, aspirate an appropriate amount of bacterial solution, centrifuge at 5000rpm for 5 minutes, remove the supernatant, resuspend and wash the bacterial pellet with KC liquid medium. Centrifuge at 5000rpm for 5 minutes again, remove the supernatant, add the appropriate volume of KC liquid medium to resuspend the bacterial pellet to make the OD 600 = 0.1. Use 2-3 mL of Agrobacterium infection solution per plate of PC1 medium. Spread the infection solution evenly on the medium, ensuring that the wound area of ​​the explant is fully exposed to the infection solution and that the rest of the explant is kept dry. After standing for 10 minutes, remove the excess infection solution and incubate the infected explants in the dark at 20°C for 2 days.

[0044] (4) Differentiation culture of explants

[0045] After two days of dark culture, explants were transferred to primary screening medium 2Z (MS + 30 g / L sucrose + 7 g / L agar + 1.0 mg / L 6-BA + 0.1 mg / L NAA + 50 mg / L hygromycin + 200 mg / L timentin). The medium was re-transferred to 2Z every 12-15 days, depending on the differentiation of the explants. Once differentiated shoots appeared on the explants, they were transferred to secondary culture medium 1Z. Similarly, the medium was re-transferred to 1Z every 12-15 days (MS + 30 g / L sucrose + 7 g / L agar + 0.5 mg / L 6-BA + 0.05 mg / L NAA + 50 mg / L hygromycin + 200 mg / L timentin).

[0046] (5) Rooting culture of explants

[0047] After the explants grow an independent main stem on the 1Z medium, the main stem buds are cut off and inserted into the rooting medium ENR. Roots are formed after 15-25 days.

[0048] (6) Continue to cultivate until the tomato fruit matures, and measure the fruit weight and diameter. Compared with the wild type, the transgenic tomato fruit is smaller. The average weight of a single wild type tomato fruit is 4.21g and the diameter is 1.92cm, while the average weight of a single transgenic plant fruit is 2.33g and the diameter is 1.1cm. Figure 2 ).

[0049] (7) Determination of LOX enzyme activity in tomatoes

[0050] Fresh tomato fruits were quickly ground into a powder using liquid nitrogen. The mixture was then homogenized in a pre-chilled extraction buffer (containing phosphate buffer, Triton X-100, and EDTA) on ice. The extract was then centrifuged at 12,000 × g for 20 minutes at 4°C, and the supernatant was collected as the crude enzyme extract. The reaction system used linoleic acid as the substrate (emulsified with Tween-20 to a final concentration of 50 μM). Phosphate buffer (pH 6.5) and the appropriate amount of enzyme solution were added to a total volume of 1 mL. A boiling water-inactivated enzyme solution was used as a blank control. The extract was monitored spectrophotometrically at 234 nm for 3–5 minutes at a constant temperature of 25°C, and the rate of change in absorbance (ΔA / min) was recorded. Enzyme activity was calculated by multiplying ΔA / min by the reaction volume, divided by the molar extinction coefficient (25,000 L·mol⁻¹·cm⁻¹), the optical path length (1 cm), and the fresh weight of the sample. The results were expressed as unit fresh weight enzyme activity (U / g FW). The results showed that the average LOX enzyme activity in wild-type plants and transgenic plants was 2.9×10 3 u / g, 11.3×10 3 u / g( Figure 3 ), indicating that PeLOX2 can enhance fruit ripening.

[0051] 3. PeLOX2 gene transformation into Arabidopsis

[0052] (1) Planting of Arabidopsis thaliana

[0053] Arabidopsis thaliana is grown in vermiculite at a controlled temperature of 21-23°C, with 8 hours of light per day during the vegetative phase and 16 hours of light per day during the reproductive phase, at a light intensity of 2000 lx. The relative humidity in the culture room is maintained at 70%-90%. Seedlings can be transplanted after they have developed true leaves and are cultured until new leaves appear, the flower moss reaches 5-10 cm, and the side moss emerges. Arabidopsis thaliana flowers are not fully expanded before transformation.

[0054] (2) Transgenic Agrobacterium infection of Arabidopsis thaliana

[0055] Will turn PeLOX2 The gene-positive Agrobacterium liquid was propagated using YEB medium and shaken to OD600≈1. The liquid was centrifuged at 5000rpm for 10 minutes, and the supernatant was discarded and resuspended in 50g / L sugar water to OD≈0.8. The Arabidopsis inflorescence in step 1 was completely immersed in the liquid resuspended in sugar water for 1 minute. The infected Arabidopsis inflorescence was wrapped with plastic wrap and placed in a 0-light incubator for 12 hours, then cultured under normal light. After the fruit pods grew, the Arabidopsis T0 generation seeds were harvested.

[0056] (3) Positive plant screening

[0057] The infected Arabidopsis plants were cultured normally until seeds were obtained. The seeds were then soaked in 75% ethanol + 2.5% Tween 100 for 1 minute three times, rinsed once with sterile water, and thoroughly sterilized before being sown on MS solid medium supplemented with hygromycin (25µg / ml). After vernalization at 4°C for three days, positive plants were cultured normally. This planting and sowing process was repeated three times until stably inherited transgenic Arabidopsis plants were obtained.

[0058] Wild-type Arabidopsis and transgenic Arabidopsis seeds were sown in MS medium at the same time, and the growth of 4-week-old plants was observed and photographed. Figure 5 As shown. PeLOX2 Compared with the wild type, the leaves of Arabidopsis thaliana become slender and long, while the leaves of wild type plants are oval, laying the foundation for further research on the developmental function of this gene in plants.

[0059] One-month-old transgenic and wild-type Arabidopsis were placed in an incubator at 23°C for 12 days without watering to provide drought treatment. Figure 4 As shown, most transgenic plants showed superior growth compared to the wild type. To further evaluate their physiological responses, we measured various indices of transgenic and wild-type plants after drought stress. Under normal growth conditions, there was no significant difference in the malondialdehyde (MDA) and proline (PRO) contents between transgenic and wild-type plants. After drought stress, transgenic plants had lower MDA content and higher PRO content than wild-type plants ( Figure 4 ). The results showed that PeLOX2 could improve the drought resistance of transgenic plants.

[0060] While the specific embodiments of the present invention have been described in detail above, these are intended to be exemplary only, and the present invention is not limited thereto. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, any equivalent changes and modifications made without departing from the spirit and scope of the present invention are intended to be encompassed within the scope of the present invention.

Claims

1. Use of the passion fruit PeLOX2 gene, or a protein encoded by the passion fruit PeLOX2 gene, or a recombinant vector, host bacteria, or expression cassette containing the passion fruit PeLOX2 gene coding region in increasing tomato lipoxygenase activity and / or reducing tomato fruit size. The nucleotide sequence of the passion fruit PeLOX2 gene is shown in SEQ ID NO:

1.

2. Use of the passion fruit PeLOX2 gene, or a protein encoded by the passion fruit PeLOX2 gene, or a recombinant vector, host bacteria, or expression cassette containing the passion fruit PeLOX2 gene coding region in making Arabidopsis leaves slender. The nucleotide sequence of the passion fruit PeLOX2 gene is shown in SEQ ID NO:

1.

3. Use of the passion fruit PeLOX2 gene, or a protein encoded by the passion fruit PeLOX2 gene, or a recombinant vector, host bacteria, or expression cassette containing the passion fruit PeLOX2 gene coding region in improving drought resistance in Arabidopsis thaliana, wherein the nucleotide sequence of the passion fruit PeLOX2 gene is shown in SEQ ID NO:

1.

4. The use according to claim 3, characterized in that The passion fruit PeLOX2 gene, or the protein encoded by the passion fruit PeLOX2 gene, or the recombinant vector or host bacteria or expression cassette containing the passion fruit PeLOX2 gene coding region increases the PRO content and / or reduces the MDA content in Arabidopsis thaliana.

5. The use according to any one of claims 1 to 4, characterized in that The original vector of the recombinant vector is the pCAMBIA1304 expression vector, and the passion fruit PeLOX2 gene coding region is located between the NcoI and SpeI restriction endonuclease sites of the pCAMBIA1304 expression vector.

Images