Method for preparing self-assembled goose astrovirus vp27 protein-ferritin by using baculovirus expression system
VP27 protein is expressed and purified through the baculovirus expression system, and the self-assembly properties of ferritin are used to display antigens, which solves the problem of difficulty in preparing effective VP27 protein in the prior art, achieves the effect of enhancing the immune response, and has the potential to be applied to vaccines and detection products.
Patent Information
- Application Number
- CN202510203481.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-06-20
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The prior art is difficult to effectively prepare the goose astroviral VP27 protein, and there is a lack of methods of self-assembly using ferritin to enhance the immune response.
Using the baculovirus expression system, the VP27 protein and VP27-Ferritin protein were expressed and purified by constructing the recombinant plasmids pFastBac Dual-VP27 and pFastBac Dual-VP27-ferritin proteins, and the antigen was displayed through the self-assembly properties of ferritin.
The VP27 protein and VP27-Ferritin protein in rapid and convenient acquisition of natural conformations has been achieved, which enhances the ability to stimulate the immune response and has potential applications in the development of goose astrocyte vaccines and detection products.
Smart Images
Figure CN120174013A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microbial technology, in particular to a method for preparing self-assembled goose astrovirus vp27 protein-ferritin by using a baculovirus expression system. Background Art
[0002] Goose astrovirus (GAstV) belongs to the family Astroviridae and is a non-enveloped, single-stranded positive-sense RNA virus. Goslings are susceptible to GAstV. After infection, symptoms such as urate deposition appear in internal organs such as the pericardium, liver, and kidney, as well as joints. The morbidity and mortality rates are both as high as over 50%. The GAstV genome is about 7.2 kb in length and contains 1 5'-untranslated region (UTR), 3 open reading frames (ORF1a, ORF1b, and ORF2), 1 3'-UTR, and 1 polyadenylate (PolyA) tail. The capsid protein encoded by the ORF2 gene consists of 704 amino acids and includes 4 functional domains: S, P1, P2, and an acidic C-terminal domain. Among them, the amino acids at positions 425-665 belong to the P2 domain, and the VP27 protein encoded by it, also known as the spike protein, is located on the surface of the virus structure. The spike protein participates in the recognition of cell surface-related receptors and the immune response of the body, can induce the body to produce neutralizing antibodies, and is the main protective antigen protein of GAstV.
[0003] Currently, there is no commercial GAstV vaccine, and there are also few reports on the research of GAstV vaccines. The journal paper "Isolation, Identification and Selection of Attenuated Strains of a Newly Emerging Nephropathogenic Goose Astrovirus" attenuated GAstV by virus passage and prepared an attenuated vaccine, but there is a risk of virulence reversion.
[0004] Ferritin is a nanoscale biomaterial that naturally exists in all organisms. 24 Ferritins can self-assemble into a hollow nanocage structure with an outer diameter of 12 nm and an inner diameter of 8 nm. Ferritin can not only self-assemble into a spherical nanostructure, display the fused antigen protein on its surface, promote the recognition and uptake of the antigen by antigen-presenting cells, and then induce a stronger immune response, but also has the advantages of good biocompatibility, strong stability, low toxicity, and being modifiable. By enhancing the ability of lymphocytes to capture antigens, etc., it can stimulate stronger T cell and B cell responses. Currently, it can be used as an ideal antigen presentation platform, especially for multimerized antigens, for the development of novel subunit vaccines.
[0005] "Generation and evaluation of a recombinant goose origin Newcastle disease virus expressing Cap protein of goose origin astrovirus as a bivalent vaccine in goslings" published by Xu Dawei, Li Chuanfeng, Liu Guangqing, Chen Zongyan, and Jia Renyong on October 1, 2019 constructed a recombinant bivalent vaccine expressing the GAstV Cap protein gene, but did not involve in-depth research on the VP27 protein.
[0006] "Prokaryotic expression of goose astrovirus type 1 VP27 protein and preparation and identification of its polyclonal antibody" published by Xiang Yong, Li Linlin, Zhang Junqin, Dong Jiawen, Huang Yunzhen, Zhai Qi, Xu Zhihong, Liao Ming, and Sun Minhua on May 31, 2024 expressed and purified the goose astrovirus VP27 protein using a prokaryotic expression system. However, the recombinant protein obtained by this method does not have a native conformation, cannot mimic the VP27 protein molecule of the virus, and does not involve ferritin self-packaging. Summary of the Invention
[0007] To solve the above technical problems, the present invention provides a method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system.
[0008] To achieve the above object, the present invention is implemented according to the following technical scheme:
[0009] A method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system, comprising the following steps:
[0010] S1. Construct recombinant plasmids pFastBac Dual-VP27 and pFastBac Dual-VP27-ferritin;
[0011] S2. Transform the recombinant plasmids pFastBac Dual-VP27 and pFastBac Dual-VP27-Ferritin into DH10Bac competent cells respectively to obtain recombinant positive clones bacmid-VP27 and bacmid-VP27-Ferritin; Transfect the recombinant positive clones bacmid-VP27 and bacmid-VP27-Ferritin into insect cells respectively for the expression of recombinant baculoviruses to obtain recombinant baculoviruses Ac-VP27 and Ac-VP27-ferritin;
[0012] S3. Separately passage-culture the recombinant baculovirus Ac-VP27 and the recombinant baculovirus Ac-VP27-ferritin to express the VP27 protein and the VP27-Ferritin protein; then isolate and purify the VP27 protein and the VP27-Ferritin protein from the culture supernatant.
[0013] Specifically, the step S1 includes:
[0014] S1-1. Using the pCAGGS-VP27-HA plasmid as a template, perform PCR amplification with VP27-F and VP27-R as primers to obtain fragment P1;
[0015] S1-2. Using DH10Bac super-competent cells as a template, perform PCR amplification with GP67-F and GP67-R as primers to obtain fragment P2;
[0016] S1-3. Using pFastBac Dual super-competent cells as a template, perform PCR amplification with PBD-F and PBD-R as primers to obtain fragment P3;
[0017] S1-4. Use the seamless cloning reagent ClonExpress Ultra One Step Cloning KitV2 to perform homologous recombination ligation of fragment P1, fragment P2, and fragment P3, and transform the ligation product into SURE competent cells to obtain the recombinant plasmid pFastBac Dual-VP27;
[0018] S1-5. Using the recombinant plasmid pFastBac Dual-VP27 as a template, perform PCR amplification with PBDfe-F and PBD-R as primers to obtain fragment P4;
[0019] S1-6. Using the recombinant plasmid pACYC-ferritin as a template, perform PCR amplification with Ferritin-F and Ferritin-R as primers to obtain fragment P5;
[0020] S1-7. Use the seamless cloning reagent ClonExpress Ultra One Step Cloning KitV2 to perform homologous recombination ligation of fragment P4 and fragment P5, and transform the ligation product into SURE competent cells to obtain the recombinant plasmid pFastBacDual-VP27-ferritin.
[0021] Specifically, the step S2 includes:
[0022] S2-1. According to the operation instructions of the bac-to-bac baculovirus expression system, the recombinant plasmids pFastBacDual-VP27 and pFastBac Dual-VP27-Ferritin were respectively transformed into DH10Bac competent cells. Using the blue-white screening technique, recombinant positive clones bacmid-VP27 and recombinant positive clone bacmid-VP27-Ferritin were obtained;
[0023] S2-2. Well-grown Sf9 insect cells were inoculated into a 6-well cell culture plate at a density of 8×10 5 cells. 1 μg of the DNA of recombinant positive clone bacmid-VP27 or recombinant positive clone bacmid-VP27-Ferritin was diluted in 100 μL of Grace insect medium without supplements, briefly vortexed to mix, and incubated at room temperature for 15 - 30 minutes; mix before use II, and then 8 μL of II was diluted in 100 μL of Grace insect medium without supplements, briefly vortexed to mix; incubated at room temperature for 15 - 30 minutes, and the diluted DNA was mixed with the diluted II for a total of 210 μL, gently mixed and incubated for 5 - 15 minutes; the 210 μL DNA-liposome mixture was added dropwise to the II and DNA mixed solution. The cells were incubated at 27 °C for 3 - 5 hours, the transfection mixture was removed, and replaced with 2 mL of complete growth medium. The cells were incubated at 27 °C for 4 d, the cell culture was collected, centrifuged at 1000 rpm for 5 min at room temperature, and the supernatant was the P1 generation recombinant baculovirus Ac-VP27 or the P1 generation recombinant baculovirus Ac-VP27-ferritin. 2% FBS was added to the harvested virus solution and stored at -80 °C for later use.
[0024] Specifically, the step S3 includes:
[0025] S3-1. The P1 generation recombinant baculovirus Ac-VP27 or the P1 generation recombinant baculovirus Ac-VP27-ferritin was used as the seed virus for virus passage respectively. When it was passed to the 3rd generation, it was used as the seed virus for large-scale culture, and the cell supernatant of the 3rd generation was collected;
[0026] S3-2. Prepare nickel columns, rinse the column tubes and gaskets with pure water, and equilibrate the packing material with Lysis Buffer so that it is in the same buffer system as the target protein. Add the supernatant of the 3rd generation cells to the equilibrated gravity column, ensure that the sample is in full contact with the packing material, and remove non-specifically adsorbed miscellaneous proteins with Wash Buffer. Elute with Elution Buffer to obtain VP27 protein and VP27-Ferritin protein.
[0027] Specifically, VP27-F: ctttgcgGACAGCAGGATTTATCAGACAGTTCC;
[0028] VP27-R: tagtggtgatggtgatgatgAGAGGTCTTGAGCGAGACTGCT;
[0029] GP67-F: aggcctacgtcgacgagctcATGCTACTAGTAAATCAGTCACACCAAG;
[0030] GP67-R: aaatcctgctgtcCGCAAAGGCAGAATGCGC;
[0031] PBD-F: catcatcaccatcaccactaaTCTAGAGCCTGCAGTCTCGACA;
[0032] PBD-R: GAGCTCGTCGACGTAGGCC;
[0033] PBDfe-F: TCTAGAGCCTGCAGTCTCGAC;
[0034] PBD-R: GAGCTCGTCGACGTAGGCC;
[0035] Ferritin-F: tctcgctcaagacctctGGAGGCAGCGGTGGATCA;
[0036] Ferritin-R: agactgcaggctctagaTTAATGGTGATGGTGATGGTGATGGTGAG.
[0037] Preferably, the complete growth medium is Grace insect medium supplemented with 10% FBS.
[0038] Compared with the prior art, the present invention provides a method for expressing VP27 protein and VP27-Ferritin protein using a baculovirus system. This method can conveniently and rapidly obtain VP27 protein and VP27-Ferritin protein with natural conformation, which can be used as candidate vaccines for preventing goose astrovirus infection and antigen substances for detecting antibodies against goose astrovirus. Moreover, ferritin nanoparticles have the characteristics of safety, stability, and self-assembly. This research can be used in the field of goose astrovirus research and can also be used for the development of vaccines and detection products. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 The figures show the construction process of recombinant plasmids and plasmid maps: (a) is the plasmid map of recombinant plasmid pFastBac Dual-VP27; (b) is the plasmid map of recombinant plasmid pFastBac Dual-VP27-ferritin; (c) is the flow chart for constructing recombinant plasmids.
[0040] Figure 2 The figures show the Western blot analysis of target proteins: M is the marker; A is Sf9 cells infected with wild baculovirus; B is Sf9 cells infected with Ac-VP27; C is Sf9 cells infected with Ac-VP27-Ferritin.
[0041] Figure 3 The figures show the indirect immunofluorescence detection of target proteins: A is the immunofluorescence detection image of Sf9 cells infected with wild baculovirus; B is the immunofluorescence detection image of Sf9 cells infected with Ac-VP27; C is the immunofluorescence detection image of Sf9 cells infected with Ac-VP27-Ferritin.
[0042] Figure 4 The figures show the WB verification results of VP27 protein and VP27-Ferritin protein.
[0043] Figure 5 The figures show the transmission electron microscopy images of VP27 protein and VP27-Ferritin protein: (a) is VP27 protein; (b) is VP27-Ferritin protein. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0044] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.
[0045] The main raw materials used in the following embodiments and their suppliers or sources are shown in Table 1.
[0046] Table 1
[0047]
[0048] This example exemplarily demonstrates a method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system, including the following steps:
[0049] S1. Construct recombinant plasmid pFastBac Dual-VP27 and recombinant plasmid pFastBac Dual-VP27-ferritin; Some primers need to be designed in this step, and the specific designed primers are shown in Table 2.
[0050] Table 2
[0051]
[0052] All primers were commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0053] S1-1. Using pCAGGS-VP27-HA plasmid as a template, perform PCR amplification with VP27-F and VP27-R as primers to obtain fragment P1;
[0054] The PCR reaction system is:
[0055]
[0056]
[0057] The PCR amplification conditions are: 98°C for 1 min; 98°C for 10 s, 60°C for 5 s, 72°C for 10 s / kb, for a total of 30 cycles; 72°C for 5 min. After the amplification is completed, perform gel electrophoresis and fragment gel recovery and purification to obtain fragment P1.
[0058] S1-2. Using DH10Bac super-competent cells as a template, perform PCR amplification with GP67-F and GP67-R as primers to obtain fragment P2;
[0059] The PCR reaction system is:
[0060]
[0061] The PCR amplification conditions are: 98°C for 1 min; 98°C for 10 s, 60°C for 5 s, 72°C for 10 s / kb, for a total of 30 cycles; 72°C for 5 min. After the amplification is completed, perform gel electrophoresis and fragment gel recovery and purification to obtain fragment P2.
[0062] S1-3. Using pFastBac Dual super-competent cells as a template, perform PCR amplification with PBD-F and PBD-R as primers to obtain fragment P3;
[0063] The PCR reaction system is as follows:
[0064]
[0065]
[0066] The PCR amplification conditions are: 98°C for 1 min; 98°C for 10 s, 60°C for 5 s, 72°C for 10 s / kb, for a total of 30 cycles; 72°C for 5 min. After amplification, gel electrophoresis was performed and the fragments were recovered and purified from the gel to obtain fragment P3.
[0067] S1-4. Use the seamless cloning reagent ClonExpress Ultra One Step Cloning Kit V2 to perform homologous recombination ligation of fragment P1, fragment P2, and fragment P3. The reaction system is as follows:
[0068] Reagent Dosage P1, P2, P3 10 nmol each 2*CEMix 5 μl <![CDATA[ddH2O]]> Up to 10 μl
[0069] The reaction conditions are: 50°C for 15 min; the ligation product was transformed into SURE competent cells to obtain the recombinant plasmid pFastBac Dual-VP27, and the plasmid map is shown in (a) of Figure 1 as follows;
[0070] S1-5. Using the recombinant plasmid pFastBac Dual-VP27 as a template, use PBDfe-F and PBD-R as primers to perform PCR amplification to obtain fragment P4;
[0071] The PCR reaction system is as follows:
[0072]
[0073] The PCR amplification conditions are: 98°C for 1 min; 98°C for 10 s, 60°C for 5 s, 72°C for 10 s / kb, for a total of 30 cycles; 72°C for 5 min. After amplification, gel electrophoresis was performed and the fragments were recovered and purified from the gel to obtain fragment P4.
[0074] S1-6. Using the recombinant plasmid pACYC-ferritin as a template, use Ferritin-F and Ferritin-R as primers to perform PCR amplification to obtain fragment P5;
[0075] The PCR reaction system is as follows:
[0076]
[0077] The PCR amplification conditions were as follows: 98°C for 1 min; 98°C for 10 s, 60°C for 5 s, 72°C for 10 s / kb, for a total of 30 cycles; 72°C for 5 min. After the amplification was completed, gel electrophoresis was performed and the fragments were recovered and purified by gel extraction to obtain fragment P5.
[0078] S1-7. Use the seamless cloning reagent ClonExpress Ultra One Step Cloning Kit V2 to perform homologous recombination ligation of fragment P4 and fragment P5. The reaction system was as follows:
[0079] Reagent Dosage P4, P5 10 nmol each 2*CEMix 5 μl <![CDATA[ddH2O]]> Up to 10 μl
[0080] The reaction conditions were: 50°C for 15 min; transform the ligation product into SURE competent cells to obtain the recombinant plasmid pFastBac Dual-VP27-ferritin. The plasmid map is shown in Figure 1 as (b) in
[0081] S2. Transform the recombinant plasmid pFastBac Dual-VP27 and the recombinant plasmid pFastBac Dual-VP27-Ferritin into DH10Bac competent cells respectively to obtain the recombinant positive clone bacmid-VP27 and the recombinant positive clone bacmid-VP27-Ferritin; transfect the recombinant positive clone bacmid-VP27 and the recombinant positive clone bacmid-VP27-Ferritin into insect cells respectively for the expression of recombinant baculoviruses to obtain the recombinant baculovirus Ac-VP27 and the recombinant baculovirus Ac-VP27-ferritin;
[0082] S2-1. According to the operation instructions of the bac-to-bac baculovirus expression system, transform the recombinant plasmids pFastBac Dual-VP27 and pFastBac Dual-VP27-Ferritin into DH10Bac competent cells respectively, and use the blue-white screening technique to obtain the recombinant positive clone bacmid-VP27 and the recombinant positive clone bacmid-VP27-Ferritin;
[0083] S2-2. Inoculate 8×10 5 Sf9 cells in good growth condition into a 6-well cell culture plate, dilute 1 μg of the DNA of the recombinant positive clone bacmid-VP27 or the recombinant positive clone bacmid-VP27-Ferritin in 100 μL of Grace insect medium without supplements (without antibiotics and serum), vortex briefly to mix, and incubate at room temperature for 15 - 30 minutes; mix before use II. Then dilute 8 μL in 100 μL of Grace insect medium without supplements (without antibiotics and serum). II. Vortex briefly to mix; incubate at room temperature for 15 - 30 minutes, mixing the diluted DNA with the diluted II, a total of 210 μL, mix gently and incubate for 5 - 15 minutes; add the 210 μL DNA - liposome mixture dropwise to II. In the mixed solution of DNA, incubate the cells at 27 °C for 3 - 5 hours, remove the transfection mixture, and replace it with 2 mL of complete growth medium (in this example, Grace insect medium supplemented with 10% FBS is used as the complete growth medium), incubate the cells at 27 °C for 4 d, and then perform indirect immunofluorescence detection. The results are as Figure 3 shown: Specific fluorescence can be detected in Sf9 cells infected with Ac - VP27 and Ac - VP27 - ferritin, while no specific fluorescence is detected in Sf9 cells infected with wild - type baculovirus, indicating that the recombinant virus was successfully constructed, can correctly express the target protein, and the target protein has good immunogenicity.
[0084] Collect the cell culture, centrifuge at 1000 rpm for 5 min at room temperature, and the supernatant is the P1 - generation recombinant baculovirus Ac - VP27 or the P1 - generation recombinant baculovirus Ac - VP27 - ferritin. Add FBS with a final concentration of 2% to the harvested virus solution and store it at - 80 °C for later use.
[0085] S3. Sub - culture the recombinant baculovirus Ac - VP27 and the recombinant baculovirus Ac - VP27 - ferritin respectively, and express the VP27 protein and the VP27 - Ferritin protein; then isolate and purify the VP27 protein and the VP27 - Ferritin protein from the culture supernatant;
[0086] S3 - 1.
[0087] (1) Inoculate Sf9 suspension cells at a density of 5×105 cells / mL in 50 mL of SIM SF medium, and culture them in a constant - temperature shaker at 27 °C with an oscillation speed of 90 rpm until the cell density reaches 2×10 6 cells / mL (about 2 d).
[0088] (2) Calculate the titer of the P2 - generation recombinant baculovirus and the volume of the virus solution required to make the final inoculation amount MOI = 0.1.
[0089] (3) Incubate in a constant temperature shaker at 27°C with shaking at 90 rpm. Observe the cytopathic effect every 24 h. When all cells show cytopathic effect (4 - 6 d), centrifuge at 2000 rpm for 5 min to collect the supernatant, which is the virus solution of passage 3 (P3), and use it as the seed virus for further large-scale culture.
[0090] (4) Add FBS (final concentration 2%) to the virus solution and store it at -80°C for later use.
[0091] S3-2,
[0092] 1. Cell lysis
[0093] (1) Sample pretreatment: Centrifuge to collect cells, disperse the cells by flicking with fingers, add lysis buffer, and then flick gently with fingers to fully lyse the cells. After complete lysis, there should be no obvious cell precipitate.
[0094] (2) Post-treatment: Centrifuge the lysed sample at 10000 - 14000 g for 3 - 5 min and take the supernatant.
[0095] 2. Affinity chromatography purification
[0096] (1) Column equilibration: Wash the Ni-NTA column with 5 - 10 column volumes (CV) of equilibration buffer until the baseline is stable.
[0097] (2) Loading: Slowly load the centrifuged supernatant onto the column (flow rate: 1 - 2 mL / min). The His-tagged protein binds to Ni 2 +.
[0098] (3) Washing: Wash with 10 - 20 CV of washing buffer to remove weakly bound contaminating proteins. Gradually increase the imidazole concentration (e.g., 50 mM → 100 mM) for gradient washing to improve purity.
[0099] (4) Elution: Elute the target protein with elution buffer (containing 250 - 500 mM imidazole) to obtain VP27 protein and VP27-Ferritin protein, and collect the elution peaks step by step.
[0100] 3. Desalting and concentration
[0101] (1) Remove imidazole: Use a desalting column (such as PD-10) or dialysis (overnight at 4°C) to remove imidazole.
[0102] (2) Concentrate the protein: Concentrate the protein using an ultrafiltration centrifugal tube (with a molecular weight cut-off of 10 kDa or 30 kDa).
[0103] Perform WB verification. The results are as Figure 4 shown. The target protein band is correct, and then perform electron microscopy observation. The results are as Figure 5As shown, the VP27-Ferritin protein presents a regular spherical shape under transmission electron microscopy observation. After measurement, the particle size is stable, and it can self-assemble into spherical nanostructures, forming particles larger than the VP27 protein, indicating the successful preparation of self-assembled goose astrovirus vp27 protein-ferritin particles.
[0104] The technical solution of the present invention is not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.
Claims
1. A method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system, characterized in that: The following steps are involved: S1. Construction of recombinant plasmid pFastBac Dual-VP27 and recombinant plasmid pFastBac Dual-VP27-ferritin; S2, transforming the recombinant plasmid pFastBac Dual-VP27 and the recombinant plasmid pFastBac Dual-VP27-Ferritin into DH10Bac competent cells respectively to obtain the recombinant positive clone bacmid-VP27 and the recombinant positive clone bacmid-VP27-Ferritin; transfecting the recombinant positive clone bacmid-VP27 and the recombinant positive clone bacmid-VP27-Ferritin into insect cells respectively for recombinant baculovirus expression to obtain the recombinant baculovirus Ac-VP27 and the recombinant baculovirus Ac-VP27-ferritin; S3. The recombinant baculovirus Ac-VP27 and the recombinant baculovirus Ac-VP27-ferritin are subcultured to express the VP27 protein and the VP27-Ferritin protein respectively; and then the VP27 protein and the VP27-Ferritin protein are separated and purified from the culture supernatant.
2. The method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system according to claim 1, characterized in that: The step S1 comprises: S1-1, using pCAGGS-VP27-HA plasmid as template and VP27-F and VP27-R as primers, PCR amplification was performed to obtain fragment P1; S1-2, using DH10Bac super competent cells as template and GP67-F and GP67-R as primers, PCR amplification was performed to obtain fragment P2; S1-3, using pFastBac Dual super competent cells as templates and PBD-F and PBD-R as primers, PCR amplification was performed to obtain fragment P3; S1-4, using seamless cloning reagent ClonExpress Ultra One Step Cloning KitV2 to homologously recombine fragments P1, P2, and P3, and transforming the ligation products into SURE competent cells to obtain the recombinant plasmid pFastBac Dual-VP27; S1-5, using the recombinant plasmid pFastBac Dual-VP27 as a template and PBDfe-F and PBD-R as primers, PCR amplification was performed to obtain fragment P4; S1-6, using the recombinant plasmid pACYC-ferritin as a template and Ferritin-F and Ferritin-R as primers, PCR amplification was performed to obtain fragment P5; S1-7. Use the seamless cloning reagent ClonExpress Ultra One Step Cloning KitV2 to homologously recombine fragments P4 and P5, and transform the ligation product into SURE competent cells to obtain the recombinant plasmid pFastBacDual-VP27-ferritin.
3. The method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system according to claim 2, characterized in that: The step S2 comprises: S2-1. According to the operating instructions of the bac-to-bac baculovirus expression system, the recombinant plasmids pFastBac Dual-VP27 and pFastBac Dual-VP27-Ferritin were transformed into DH10Bac competent cells, and the recombinant positive clones bacmid-VP27 and bacmid-VP27-Ferritin were obtained by blue-white screening technology. S2-2, Sf9 insect cells that have grown well were cultured at 8×10 5 Inoculate 1 μg of DNA from the recombinant positive clone bacmid-VP27 or the recombinant positive clone bacmid-VP27-Ferritin into 100 μL of Grace insect medium without supplements, vortex briefly to mix, and incubate at room temperature for 15-30 minutes; mix before use. II, then dilute 8 μL in 100 μL Grace insect medium without supplements II, vortex briefly to mix; incubate at room temperature for 15-30 minutes to mix the diluted DNA with the diluted II, a total of 210 μL, gently mix and incubate for 5-15 minutes; add 210 μL of DNA-liposome mixture dropwise to II and DNA in a mixed solution, incubate the cells at 27°C for 3-5 hours, remove the transfection mixture, and replace with 2 mL of complete growth medium, incubate the cells at 27°C for 4 days, collect the cell culture, centrifuge at 1000 rpm at room temperature for 5 minutes, the supernatant is the P1 generation recombinant baculovirus Ac-VP27 or P1 generation recombinant baculovirus Ac-VP27-ferritin, add FBS with a final concentration of 2% to the harvested virus solution, and store at -80°C for future use.
4. The method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system according to claim 3, characterized in that: The step S3 comprises: S3-1, using the recombinant baculovirus Ac-VP27 of the P1 generation or the recombinant baculovirus Ac-VP27-ferritin of the P1 generation as seed virus to pass the virus, and when it reaches the third generation, it is used as seed virus for expansion culture, and the supernatant of the third generation cells is collected; S3-2. Prepare a nickel column, rinse the column tube and gasket with pure water, and balance the filler with Lysis Buffer so that it is in the same buffer system as the target protein; add the supernatant of the third-generation cells to the balanced gravity column to ensure that the sample is in full contact with the filler, and use Wash Buffer to remove non-specifically adsorbed impurities; elute with Elution Buffer to obtain VP27 protein and VP27-Ferritin protein.
5. The method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system according to claim 2, characterized in that: VP27-F:ctttgcgGACAGCAGGATTTATCAGACAGTTCC; VP27-R: tagtggtgatggtgatgatgAGAGGTCTTGAGCGAGACTGCT; GP67-F: aggcctacgtcgacgagctcATGCTACTAGTAAATCAGTCACACCAAG; GP67-R: aaatcctgctgtcCGCAAAGGCAGAATGCGC; PBD-F: catcatcaccatcaccactaaTCTAGAGCCTGCAGTCTCGACA; PBD-R: GAGCTCGTCGACGTAGGCC; PBDfe-F:TCTAGAGCCTGCAGTCTCGAC; PBD-R: GAGCTCGTCGACGTAGGCC; Ferritin-F: tctcgctcaagacctctGGAGGCAGCGGTGGATCA; Ferritin-R: agactgcaggctctagaTTAATGGTGATGGTGATGGTGATGGTGAG.
6. The method for preparing self-assembled goose astrovirus vp27 protein-ferritin using a baculovirus expression system according to claim 3, characterized in that: The complete growth medium was Grace insect medium supplemented with 10% FBS.