Application of HRD1 and inhibitor thereof in prevention and treatment of myocardial ischemia-reperfusion injury

Abstract

The invention discloses application of HRD1 and an inhibitor thereof in prevention and treatment of myocardial ischemia-reperfusion injury. According to the invention, an endodermis-specific HRD1 gene knockout mouse (Hrd1f / f; a myocardial ischemia-reperfusion injury model is formed by ligating a left anterior descending coronary artery (LAD) of a mouse heart by taking Hrd1f / f (Cd, Cdh5Cre) as an experimental subject, and a result shows that compared with an Hrd1f / f mouse, the Hrd1f / f mouse is Hrd1f / f; the cardiac infarction area of the Cdh5Cre mouse is reduced, the myocardial injury marker level is reduced, the heart microcirculation perfusion is increased, and the inflammatory cell infiltration is reduced; the invention discloses that the HRD1 gene promotes mouse myocardial infarction induced by myocardial ischemia reperfusion injury for the first time, and the HRD1 gene has an important deterioration effect in a myocardial ischemia reperfusion injury model; the invention provides a new drug action target for prevention and treatment of myocardial ischemia reperfusion injury, and has very important clinical transformation value.

Description

Technical Field

[0001] The present invention relates to the application of HRD1 and its inhibitors in the prevention and treatment of myocardial ischemia-reperfusion injury, belonging to the field of biomedical technology. Background Art

[0002] Coronary heart disease and acute myocardial infarction are the most critical and severe diseases threatening human health. At present, the incidence and mortality of acute myocardial infarction in China are still on the rise. The only way to salvage ischemic myocardium is timely reperfusion therapy, including drug thrombolysis and percutaneous coronary intervention. However, reperfusion therapy also induces a special irreversible injury, called ischemic reperfusion injury. It is closely related to clinical complications such as severe arrhythmia, heart failure, and sudden death. Therefore, in-depth research on the specific pathological mechanism of myocardial ischemia-reperfusion injury and exploration of potential myocardial treatment targets have extremely important clinical transformation significance.

[0003] Hydroxymethylglutaryl-CoA reductase degradation 1 (HRD1) is an E3 ubiquitin ligase, whose main function is to prevent the polymerization of toxic proteins in the endoplasmic reticulum by ubiquitination modification and degradation of misfolded proteins, and is also known as the endoplasmic reticulum-associated degradation pathway. In addition, HRD1 also maintains liver and whole-body energy metabolism by regulating the degradation of various metabolic enzymes. Inhibiting HRD1 can also relieve inflammatory responses and autoimmune diseases. However, the role of HRD1 in myocardial ischemia-reperfusion injury has not been reported. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of HRD1 and its inhibitors in the prevention and treatment of myocardial ischemia-reperfusion injury. As a therapeutic drug for myocardial ischemia-reperfusion injury, the HRD1 inhibitor can reduce myocardial ischemia-reperfusion injury and improve the prognosis of myocardial infarction patients.

[0005] To achieve the above purpose, the present invention provides the application of HRD1 as a drug target in screening or preparing drugs for preventing and / or treating myocardial ischemia-reperfusion injury, increasing the medical use of HRD1.

[0006] The present invention also provides the application of HRD1 inhibitors in preparing drugs for preventing and / or treating myocardial ischemia-reperfusion injury.

[0007] Preferably, the drug includes an active ingredient and a pharmaceutically acceptable carrier, and the active ingredient contains an HRD1 inhibitor.

[0008] Preferably, the HRD1 inhibitor is a small molecule, antibody or nucleic acid reagent that targets and inhibits or reduces the expression of HRD1.

[0009] Preferably, the nucleic acid reagent comprises gRNA, and the sequences of the gRNA are shown in SEQ ID NO: 1-2.

[0010] Preferably, the HRD1 inhibitor is a reagent that specifically targets and inhibits or reduces the expression of HRD1 in endothelial cells.

[0011] Preferably, the HRD1 inhibitor is preferably one of siRNA of the HRD1 gene, a reagent used for knocking out or knocking down HRD1 by CRISPR / Cas9 gene editing, an RNA interference vector of the HRD1 gene, or an antibody against HRD1.

[0012] More preferably, the reagent used for knocking out or knocking down HRD1 by CRISPR / Cas9 gene editing comprises specific gRNA, and the sequences of the gRNA are shown in SEQ ID NO: 1-2.

[0013] The research results of the present invention show that Hrd1 f / f ; Cdh5 Cre In a mouse model of myocardial ischemia-reperfusion injury induced by ligating the coronary artery, the infarct area of the mouse heart was significantly reduced, and the cardiac microcirculation perfusion was significantly increased; it was proved that the HRD1 gene has an important deteriorating effect in the myocardial ischemia-reperfusion injury model.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention uses endothelial cell-specific HRD1 gene knockout mice (Hrd1 f / f ; Cdh5 Cre ) as experimental subjects, and a myocardial ischemia-reperfusion injury model is established by ligating the left anterior descending branch (LAD) of the mouse heart. The results show that compared with Hrd1 f / f mice, the infarct area of the heart of Hrd1 f / f ; Cdh5 Cre mice was reduced, the levels of myocardial injury markers were decreased, the cardiac microcirculation perfusion was increased, and the infiltration of inflammatory cells was reduced; the present invention first reveals that the HRD1 gene promotes myocardial infarction induced by myocardial ischemia-reperfusion injury, and the HRD1 gene has an important deteriorating effect in the myocardial ischemia-reperfusion injury model; the present invention provides a new drug action target for the prevention and treatment of myocardial ischemia-reperfusion injury, and has very important clinical transformation value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Evans blue / TTC staining results showing that endothelial cell-specific HRD1 knockout reduces the infarct area of the mouse heart induced by myocardial ischemia-reperfusion injury;

[0017] Figure 2 Serum LDH and CK-MB results of myocardial injury markers in mice induced by myocardial ischemia-reperfusion injury alleviated by endothelial-specific HRD1 knockout;

[0018] Figure 3 Endothelial-specific HRD1 knockout alleviates microcirculation perfusion disorder in mice induced by myocardial ischemia-reperfusion injury;

[0019] Figure 4 Endothelial-specific HRD1 knockout alleviates cardiac inflammatory cell infiltration induced by myocardial ischemia-reperfusion injury. Detailed implementation mode

[0020] To make the present invention more obvious and understandable, preferred embodiments are hereby described in detail in conjunction with the accompanying drawings as follows.

[0021] Embodiment

[0022] This embodiment provides the application of HRD1 gene knockout in the prevention and treatment of myocardial ischemia-reperfusion injury:

[0023] 1. Experimental method

[0024] 1.1 Establishment of a mouse model of myocardial ischemia-reperfusion injury, and the specific steps include:

[0025] (1) After anesthetizing the mice with 2% isoflurane before the operation, fix them on a thermostatic operating table;

[0026] (2) Perform hair removal treatment and 75% alcohol disinfection on the chest area of the mice;

[0027] (3) Make a small incision about 0.5 cm along the left edge of the sternum, and bluntly separate the muscle layer with a hemostat;

[0028] (4) Enter the chest cavity, pierce the pericardium, gently squeeze the chest cavity of the mice with the left hand to fully expose the heart outside the chest wall, and use 6-0 surgical suture to ligate the left anterior descending coronary artery below the edge of the left atrial appendage and make a slipknot;

[0029] (5) After completion, reset the heart to the chest cavity, squeeze out the air, and suture the incision;

[0030] (6) After 45 minutes of ischemia, loosen the slipknot to restore coronary blood flow, and suture the wound with 4-0 surgical suture;

[0031] (7) Electrocardiogram shows that the ST segment drops by more than 50% 1 hour after the knot is loosened, which is defined as successful reperfusion.

[0032] 1.2 Construction method of endothelial-specific HRD1 gene knockout mice (Hrd1 f / f ; Cdh5Cre)

[0033] 1. Generation of Hrd1 gene Floxed mice (Hrd1 f / f )

[0034] (1) Design of gene targeting vector:

[0035] Insert loxP sites in the same direction on both sides of the key exons of the HRD1 gene (Syvn1) to construct a conditional knockout vector. The insertion of loxP sites should avoid the gene functional domain to ensure the normal expression of HRD1 protein before recombination.

[0036] The vector contains homologous recombination arms, a selection marker (such as the neomycin resistance gene) and loxP sites, and gene editing is completed by CRISPR / Cas9 targeting technology.

[0037] (2) Mating and screening of F0 generation mice:

[0038] Inject the constructed targeting vector, Cas9 mRNA and specific gRNA into the fertilized eggs of C57BL / 6J mice. After in vitro culture, transplant them into the uterus of pseudopregnant female mice to obtain F0 generation chimeric mice. The sequences of gRNA are as follows:

[0039] gRNA-A1: TGTTGGGGCAACCCAGGCCCAGG (SEQ ID NO: 1);

[0040] gRNA-A2: TGCCAGGGCTGACACGCTGAGGG (SEQ ID NO: 2).

[0041] Verify the correct insertion of loxP sites in F0 generation mice by long fragment PCR or Southern blot, and screen out positive individuals.

[0042] (3) Establishment of Floxed mouse strain:

[0043] Mate positive F0 generation mice with wild-type mice to obtain heterozygotes (Hrd1+ / flox), and further self-cross or mate with heterozygotes to screen out homozygotes Hrd1flox / flox (Hrd1f / f)13.

[0044] 2. Introduction of endothelial-specific Cre tool mice (Cdh5Cre)

[0045] Characteristics of Cdh5-Cre mice:

[0046] The Cdh5 (VE-cadherin) promoter drives the specific expression of Cre recombinase in vascular endothelial cells, achieving gene knockout between loxP sites in endothelial cells.

[0047] Mating strategy:

[0048] Cross Hrd1 f / f mice with Cdh5Cre mice, and screen the offspring for mice with the genotype Hrd1 f / f ; Cdh5Cre / +(i.e., endothelium-specific HRD1 knockout mice).

[0049] The control group should include Hrd1 f / f ; Cdh5 + / + mice to exclude the effect of Cre expression itself on the phenotype.

[0050] 3. Genotype identification: Detect the presence of the Hrd1 gene (loxP site) and Cre gene in the offspring mice by PCR.

[0051] 1.3 Detection of cardiac blood perfusion

[0052] Fix the mice on the operating table. Wipe the tail with alcohol. After identifying the position of the mouse tail vein, inject Lectin (10 μg / mL) into the mouse tail vein with an insulin needle. Five minutes later, anesthetize and sacrifice the mouse, immediately perfuse the heart with 20 mL of PBS to perfuse out the blood containing Lectin. Take out the heart, trim the heart well, and place it on absorbent paper to remove the moisture. Place the heart in an OCT embedding cassette in a fixed direction to avoid generating air bubbles, and mark the basic information of the sample on the cassette. Slowly immerse the OCT embedding cassette containing the sample on the surface of liquid nitrogen and freeze it slowly. After the embedding agent turns completely white and solidifies, immerse it completely in liquid nitrogen. Cut frozen sections of the heart tissue with a thickness of 7 μm. Drop 150 μL of fixative on the tissue and fix it at room temperature for 30 minutes. Aspirate the fixative, wash it three times with the punching solution at room temperature for 5 minutes each time, and then add the punching solution again and incubate at room temperature for 15 minutes. Seal the slices with DAPI mounting medium to ensure that the cover glass is tightly attached to the tissue section without air bubbles. Take pictures with a confocal microscope.

[0053] 1.4 Sorting of cardiac inflammatory cells by flow cytometry

[0054] Prepare cardiac tissue digestive enzymes including collagenase II (1 mg / mL), elastase (0.05 mg / mL), and DNase (0.05 mg / mL), and prepare cardiac tissue digestive fluid according to their respective ratios with 1640 medium. First, add the cardiac tissue to 100 μL of the digestive fluid, cut the tissue into pieces, then add 5 mL of the digestive fluid, place it in a 15 mL centrifuge tube, digest it in a 37 °C water bath for 40 minutes, and then place the sample on ice. Gently pipette the sample with a 1 mL pipette gun and filter it through a 70 μm filter. Add 2 mL of red blood cell lysate to the cardiac tissue cell pellet, gently mix it evenly, lyse it at room temperature for 5 minutes, then centrifuge for 5 minutes, and discard the supernatant. Wash it with PBS and then perform flow cytometry staining for inflammatory cells (CD11b + Ly6C +)。Add 200 μL of antibody to the cardiac tissue cell pellet from the previous step and resuspend it by pipetting. Incubate in the dark at 4°C for 40 minutes, while setting up isotype control tubes and single-staining tubes. After washing, resuspend the cardiac tissue cell pellet, and use the FACSAria flow cytometer to perform cell sorting on the stained cardiac samples.

[0055] To verify the protective effect of endothelial-specific HRD1 knockout on mouse myocardium, Hrd1 f / f and Hrd1 with specific HRD1 gene knockout in endothelial cells f / f ; Cdh5 Cre mouse models of ischemia-reperfusion injury were established. After 24 hours of perfusion, Evans blue / TTC staining was performed to detect the myocardial infarction area, serum LDH and CK-MB were detected to evaluate myocardial injury, cardiac blood perfusion was detected by Lectin, and flow cytometry was used to detect cardiac inflammatory cell infiltration. The results showed that endothelial-specific HRD1 knockout significantly reduced the myocardial infarction area, improved blood perfusion, and inhibited inflammatory cell infiltration.

[0056] 2. Experimental results:

[0057] (1) The results of Evans blue / TTC staining showed that endothelial-specific HRD1 knockout significantly alleviated the myocardial infarction area induced by myocardial ischemia-reperfusion injury in mice, as Figure 1 shown.

[0058] (2) The results of serum myocardial injury marker detection showed that endothelial-specific HRD1 knockout alleviated the increase in serum LDH and CK-MB levels induced by myocardial ischemia-reperfusion injury in mice, as Figure 2 shown.

[0059] (3) The results of cardiac blood perfusion detection showed that endothelial-specific HRD1 knockout significantly alleviated the blood perfusion disorder induced by myocardial ischemia-reperfusion injury, as Figure 3 shown.

[0060] (4) Flow cytometry detection showed that endothelial-specific HRD1 knockout significantly alleviated the inflammatory cell infiltration induced by myocardial ischemia-reperfusion injury, as Figure 4 shown.

[0061] The above is only a preferred embodiment of the present invention, and it is not a limitation to any form and essence of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the premise of the present invention, several improvements and supplements can still be made, and these improvements and supplements should also be regarded as the protection scope of the present invention.

Claims

1. Application of HRD1 as a drug target in screening or preparing drugs for preventing and / or treating myocardial ischemia-reperfusion injury.

2. Use of HRD1 inhibitors in the preparation of drugs for preventing and / or treating myocardial ischemia-reperfusion injury.

3. The use according to claim 2, characterized in that The medicament comprises an active ingredient and a pharmaceutically acceptable carrier, wherein the active ingredient comprises an HRD1 inhibitor.

4. The use according to claim 3, characterized in that The HRD1 inhibitor is a small molecule, antibody or nucleic acid agent that targets and inhibits or reduces HRD1 expression.

5. The use according to claim 3, characterized in that The HRD1 inhibitor is an agent that specifically targets, inhibits or reduces the expression of HRD1 in endothelial cells.

6. The use according to claim 4, characterized in that The nucleic acid reagent includes gRNA, and the sequence of the gRNA is shown in SEQ ID NO: 1-2.

Images