Primer and method for identifying DMSP (dimethyl sulfoxide) synthetase gene for encoding globocystis globosa

By designing a special primer M for PCR amplification and agarose gel electrophoresis detection, combined with positive clonal identification verification, the problems of long time, high cost and low specificity of spherical cysticus spherical cysticus in the prior art were solved, and fast and accurate detection and red tide monitoring were achieved.

CN120174128APending Publication Date: 2025-06-20YANTAI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411582238.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-07
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The prior art has problems of long time, high cost and low specificity in the identification and monitoring of spherical cysticus, making it difficult to achieve rapid and accurate detection.

Method used

Special primer M was designed for PCR amplification, combined with agarose gel electrophoresis detection, spherical cystosus was identified by observing the amplification results, and the test results were verified through positive cloning identification to improve accuracy.

Benefits of technology

It realizes rapid and accurate detection of spherical cystosaccharis and can judge its concentration, reduces the potential risk of red tides, simplifies the detection process, and reduces the cost of experiments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174128A_ABST
    Figure CN120174128A_ABST
Patent Text Reader

Abstract

The invention discloses a primer and an identification method for identifying a gene for encoding phaeocystis globosa DMSP synthetase, and belongs to the field of molecular genetics. The method is used for solving the problems of long identification time, high cost and low specificity of the phaeocystis globosa in the prior art. The method for identifying the gene for encoding the spherocystis globosa DMSP synthetase comprises the following steps: by taking spherocystis globosa cell DNA as a template and M as a primer, carrying out PCR (Polymerase Chain Reaction) amplification on a part of sequence of a target gene DSYB, carrying out agarose gel electrophoresis detection on a product, observing an amplification result according to gel electrophoresis imaging equipment, and identifying the spherocystis globosa. Meanwhile, the identification method provided by the invention is simple, high in specificity and low in requirement on operators. The invention provides the rapid detection method for the globocystis globocystis, which not only has high sensitivity, effectively distinguishes other algae and is convenient for reducing statistical errors, but also can detect the concentration of the globocystis globocystis and has monitoring and early warning effects on red tide caused by the globocystis globocystis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular genetics, and particularly to a primer and an identification method for identifying a gene encoding dimethylsulfoniopropionate (DMSP) synthase of Phaeocystis globosa. Background Art

[0002] Dimethylsulfoniopropionate, abbreviated as DMSP, is an organic sulfur compound widely present in the marine ecosystem. As the main precursor of the "greenhouse gas" dimethyl sulfide (DMS), it not only plays an important role in participating in the global sulfur cycle and climate regulation, but also undertakes various physiological roles in marine organisms, having a significant impact on the marine ecosystem. Among them, after dimethyl sulfide (DMS) enters the atmosphere from the surface seawater, its oxidation products form sulfate aerosols, increasing the number of cloud condensation nuclei (CCN), thereby increasing the reflectivity of clouds to sunlight, reducing heat input, and reducing the greenhouse effect. DMSP is mainly synthesized and accumulated by marine phytoplankton, especially Phaeocystis globosa, which is a high-yielding alga. Phaeocystis globosa can form red tides and release a large amount of DMSP and DMS under suitable conditions. The outbreak of Phaeocystis globosa is very rapid and violent. In the early stage before the outbreak, the number of Phaeocystis globosa increases but it is difficult to be directly observed by the naked eye, and the sensitivity and timeliness of the usual monitoring methods are lacking, and it is often only observed after the large-scale outbreak of the Phaeocystis globosa red tide.

[0003] Algal cells synthesize the DMS precursor DMSP in vivo by assimilating and reducing sulfate. Phaeocystis globosa is considered to be a high-yielding strain of DMSP. Through transcriptome sequencing, it is known that Phaeocystis globosa contains a DMSP synthase gene. Through a large number of algal culture experiments, it is observed that during the logarithmic growth phase of Phaeocystis globosa, the contents of DMSP and DMS increase significantly, indicating that the synthesis of DMSP is significantly enhanced during the logarithmic growth phase, and the expression level of the DSYB gene also increases accordingly.

[0004] At present, the identification and monitoring of Phaeocystis globosa in field investigations still mainly rely on microscopic observation and sampling sequencing. In the laboratory, it is already possible to identify Phaeocystis globosa by amplifying and sequencing the 18S rDNA fragment. However, due to the complexity and high variability of the 18S rDNA fragment, this method has problems such as long time consumption, high cost, low specificity, harsh environmental requirements for the experiment, and high operation requirements for the experimenter. After PCR verification using 18S rDNA universal primers, the PCR products need to be sequenced and the results compared to determine whether Phaeocystis globosa is present in the water sample. Although this method can accurately determine the specific species of Phaeocystis globosa in the water sample, it is difficult to implement in field investigations, and sequencing the PCR results will also increase the detection cost. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides primers for identifying the gene encoding the DMSP synthase of Phaeocystis globosa and an identification method, which solves the problems of long identification time, high cost and low specificity of Phaeocystis globosa in the prior art. At the same time, it can also detect the concentration of Phaeocystis globosa, and play a role in monitoring and early warning of red tides caused by Phaeocystis globosa.

[0006] To achieve the above object, the present invention provides an identification method for the gene encoding the DMSP synthase of Phaeocystis globosa. Among them, using the DNA of Phaeocystis globosa cells as a template and M as primers, a partial sequence of the target gene DSYB is amplified by PCR, and the product is detected by agarose gel electrophoresis. According to the amplification result observed by the gel electrophoresis imaging device, Phaeocystis globosa is identified; The primer pair M is: Forward primer F: TCGGTTGCATACGGCTTCAT; Reverse primer R: TCAGGCACTTGATCGTCACC.

[0007] Preferably, the PCR amplification reaction program is: pre-denaturation at 95°C for 7 min; denaturation at 95°C for 30 s, annealing for 30 s, extension at 72°C for 20 s, 30 cycles; extension at 72°C for 5 min.

[0008] Preferably, the PCR reaction system: 10 μL of TransStart® Tip Green qPCR SuperMix, 0.4 μL of each of the upstream and downstream primers, 1 μL of Phaeocystis globosa cell DNA and 8.2 μL of ddH2O.

[0009] Preferably, the mass concentration of the agarose gel is 1.0%.

[0010] Preferably, the gel electrophoresis imaging device contains a 200 bp band.

[0011] Preferably, the application of the identification method for the gene encoding the DMSP synthase of Phaeocystis globosa in detecting the concentration of Phaeocystis globosa.

[0012] Preferably, the identification method for the gene encoding the DMSP synthase of Phaeocystis globosa plays a role in monitoring and early warning of red tides caused by Phaeocystis globosa.

[0013] Preferably, in the above application, the following steps are included: S1. Synthesize linear plasmids; S2. Make a standard curve; S3. Verify by absolute quantitative qPCR.

[0014] Preferably, the steps of synthesizing linear plasmids include: The product obtained by PCR amplification of the DSYB primer M and then gel extraction is the target gene fragment. The target gene is ligated and transformed into competent cells using Vazyme's 5min TA / Blunt Zero Cloning Kit. The transformed competent cells are cultured in LB liquid medium, shaken at 37°C for 45 minutes to allow amplification, spread on solid LB medium supplemented with kanamycin and sodium ampicillin, and incubated at 37°C for 12 - 16 h until small, round, milky white single colonies form. Select several single colonies and culture them overnight in liquid LB medium; Among them, the PCR amplification reaction program is: pre-denaturation at 95°C for 7 min; denaturation at 95°C for 30 s, annealing for 30 s, extension at 72°C for 20 s, for 30 cycles; extension at 72°C for 5 min; Among them, the PCR reaction system: 10 μL TransStart® Tip Green qPCR SuperMix, 0.4 μL each of upstream and downstream primers, 1 μL of Phaeocystis globosa cell DNA, and 8.2 μL of ddH2O.

[0015] Positive clone identification is verified by PCR using M13 Primer Mix in Vazyme's 5min TA / Blunt Zero Cloning Kit. The amplification program is 3 min at 95°C, 15 sec at 95°C, 15 sec at 55°C, 15 sec at 72°C, for a total of 35 cycles. The resulting product is subjected to agarose gel electrophoresis for observation. The bacterial solution with clear bands and a size of 200 bp is the successfully transformed bacterial solution.

[0016] The successfully transformed bacterial solution is used to extract plasmids using TIANGEN Plasmid Mini Kit (Enhanced Edition) to obtain circular plasmids containing the target gene fragment, which are stored at -20°C.

[0017] Preferably, the circular plasmids obtained above are used to prepare linear plasmids.

[0018] Preferably, the steps for preparing linear plasmids from circular plasmids are as follows: Using the circular plasmid as a substrate, M as a primer, PCR amplification is performed to obtain an amplification product. The product is detected by agarose gel electrophoresis. The amplification result is observed according to the gel electrophoresis imaging device, and the gel band containing the target DNA fragment is cut out and gel extraction is performed to obtain linear plasmids; Among them, the PCR amplification reaction program is: pre-denaturation at 95°C for 7 min; denaturation at 95°C for 30 s, annealing for 30 s, extension at 72°C for 20 s, for 30 cycles; extension at 72°C for 5 min; Among them, the PCR reaction system: 10 μL of TransStart® Tip Green qPCR SuperMix, 0.4 μL each of the upstream and downstream primers, 1 μL of circular plasmid, and 8.2 μL of ddH2O.

[0019] Preferably, the steps for making the standard curve include: According to 10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 、10 -8 、10 -9 Gradient dilute the linear plasmid with ddH2O to make the standard curve.

[0020] Preferably, the steps for absolute quantification qPCR verification include: S1. Blank control group Use PCR for verification, and the system composition is 10 μL of TransStart® Tip Green qPCR SuperMix, 0.4 μL each of the upstream and downstream primers, 1 μL of Phaeocystis globosa cell DNA, and 8.2 μL of ddH2O; The amplification program is 30 sec at 94 °C, 5 sec at 94 °C, 15 sec at 54 °C, 10 sec at 72 °C, for a total of 45 cycles.

[0021] S2. Experimental group Use PCR for verification, and the system composition is 10 μL of TransStart® Tip Green qPCR SuperMix, 0.4 μL each of the upstream and downstream primers, and 9.2 μL of ddH2O; The amplification program is 30 sec at 94 °C, 5 sec at 94 °C, 15 sec at 54 °C, 10 sec at 72 °C, for a total of 45 cycles.

[0022] Compared with the prior art, the beneficial effects of the present invention are: The identification method of the Phaeocystis globosa DMSP synthase gene designed by the present invention, through designing a special primer M for PCR amplification, detecting the product by agarose gel electrophoresis, observing the amplification result according to the gel electrophoresis imaging device, and determining the locus genotype, can simply and quickly detect Phaeocystis globosa and the detection concentration; at the same time, combined with positive clone identification to verify the test result and improve the accuracy.

[0023] 2. The present invention verifies the copy number of the DSYB gene in Phaeocystis globosa through a highly sensitive qPCR method, so as to judge the growth stage of Phaeocystis globosa. The identification method provided by the present invention can quickly and accurately show whether Phaeocystis globosa exists in the algal solution through clear results, and can judge the growth stage of Phaeocystis globosa in the sampling area, reducing the potential risk of red tide occurrence. At the same time, the detection method of Phaeocystis globosa is simple, highly sensitive, highly accurate, and highly specific, effectively distinguishing other algae and facilitating the reduction of statistical errors.

[0024] 3. The operation of this patent is of low difficulty, and the results are shown quickly and clearly. The linear plasmid used for making the standard curve can be continuously used for half a year after being extracted once. It requires little manpower and analysis volume, and the experimental cost is low. Description of the Drawings

[0025] Figure 1 It is the gel electrophoresis diagram of the PCR product of the DSYB gene in Example 1. Detailed Embodiments

[0026] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention. Embodiment

[0027] Step (1) Materials: Phaeocystis globosa was isolated during the red tide in the Beibu Gulf of Guangxi in February 2017. It was identified as Phaeocystis globosa through microscopic analysis and sequencing of the D1-D2 region of the 28S rRNA gene. The rRNA gene sequence has been uploaded to the NCBI database (SeqNo.OQ674720) (the specific website of the database is https: / / www.ncbi.nlm.nih.gov / nuccore / OQ674720.1 / ). NCBI is the National Center for Biotechnology Information, which mainly stores the gene sequencing data of GenBank and the biomedical research paper index of Medline.

[0028] Algal strain culture: The Phaeocystis globosa strain was cultured using f / 2 sterile medium. The culture conditions were a temperature of 20°C, a light intensity of 6000 Lx, and a light-dark ratio of 12 h:12 h. Penicillin, streptomycin, and kanamycin were added to the algal solution for sterilization.

[0029] Select the algal solution in the positive logarithmic growth phase, and use the Omega E,Z.N.A HP Plant DNA Mini Kit (D2485-01) to extract the DNA of algal cells. After extraction, use a NanoDrop 2000 spectrophotometer (ThermoScientific, USA) to detect the DNA concentration and purity, and store it at -20°C.

[0030] The operating steps for extracting DNA using the E,Z.N.A HP Plant DNA Mini Kit (D2485-01) are as follows: (1) Load the algal solution into a centrifuge tube, centrifuge at 10000 rpm for 5 minutes, and take the algal cell precipitate.

[0031] (2) Add 500 μl of CSPL Buffer (provided in the kit) and 10 μl of 2-mercaptoethanol to the precipitate. 2-mercaptoethanol can make the algal cells lysed more fully. Vortex for 2 minutes until it is completely lysed and there are no obvious lumps in the solution.

[0032] (3) Place it in a 65°C water bath for 15 minutes and invert it twice during this period.

[0033] (4) Add 800 μl of chloroform:isoamyl alcohol (24:1) mixture to the centrifuge tube, vortex to mix it well. Centrifuge at 10000 rpm for 5 minutes.

[0034] (5) Pipette 300 μl of the upper aqueous phase and transfer it to a new centrifuge tube (do not take the lower layer), add 150 μl of CXD Buffer (provided in the kit), and shake to mix well.

[0035] (6) Transfer the liquid in the centrifuge tube to the DNA mini adsorption column. The adsorption column has been pre-placed in the collection tube (both the DNA mini adsorption column and the collection tube are provided in the kit). Centrifuge at 10000 rpm for 1 minute and discard the liquid in the collection tube.

[0036] (7) Transfer the adsorption column to a new collection tube, add 700 μl of DNA Wash Buffer (provided in the kit), centrifuge at 10000 rpm for 1 minute, discard the liquid in the collection tube, and repeat this step once.

[0037] (8) Centrifuge at the highest speed of the centrifuge for 2 minutes to completely dry the alcohol on the membrane.

[0038] (9) Transfer the adsorption column to a new DNA collection tube. Preheat the Elution Buffer (provided in the kit) to 65°C in advance. Drop 50 - 100 μl of Elution Buffer onto the center of the membrane of the adsorption column and centrifuge at 10,000 rpm for 1 minute.

[0039] (10) The solution in the final collection tube is the DNA solution.

[0040] Step (2) PCR identification of Phaeocystis globosa Using the DNA of Phaeocystis globosa cells as a template and M as primers, amplify a segment of 28S rRNA by PCR. Add the product to a 1% agarose gel and electrophorese at 120 V for 40 min. Observe the amplification result with a gel electrophoresis imaging device. If there is a 200 bp band in the gel electrophoresis imaging device, it is identified as Phaeocystis globosa; Among them, primer M is: Upstream primer F: TCGGTTGCATACGGCTTCAT; Downstream primer R: TCAGGCACTTGATCGTCACC; Among them, the amplification program is 7 min at 95°C, 30 sec at 95°C, 15 sec at 54°C, 20 sec at 72°C, for a total of 30 cycles. Example

[0041] S1. Synthesize linear plasmid The product obtained by PCR amplification of the DSYB primer M and then gel extraction is the target gene fragment. Use the 5min TA / Blunt Zero Cloning Kit of Vazyme to ligate and transform the target gene into competent cells. The transformed competent cells are cultured in LB liquid medium, shaken at 37°C for 45 minutes to amplify them, spread on solid LB medium after adding kanamycin and sodium ampicillin, and place at 37°C for 12 - 16 h until small and round milky white single colonies are formed. Pick several single colonies and culture them overnight in liquid LB medium; Among them, the PCR amplification reaction program is: pre - denaturation at 95°C for 7 min; denaturation at 95°C for 30 s, annealing for 30 s, extension at 72°C for 20 s, 30 cycles; extension at 72°C for 5 min; Among them, the PCR reaction system: 10 μL of TransStart® Tip Green qPCR SuperMix, 0.4 μL of each upstream and downstream primer, 1 μL of Phaeocystis globosa cell DNA, and 8.2 μL of ddH2O; Among them, primer M is: Upstream primer F: TCGGTTGCATACGGCTTCAT; Downstream primer R: TCAGGCACTTGATCGTCACC.

[0042] Positive clone identification was verified by PCR using M13 Primer Mix in the 5min TA / Blunt Zero Cloning Kit from Vazyme. The amplification program was 95°C for 3 min, followed by 35 cycles of 95°C for 15 sec, 55°C for 15 sec, and 72°C for 15 sec. The resulting products were observed by agarose gel electrophoresis. The bacterial solution with clear bands and a size of 200 bp was the successfully transformed bacterial solution.

[0043] The successfully transformed bacterial solution was used for plasmid extraction using the TIANGEN Plasmid Mini Kit (Enhanced Version) to obtain a circular plasmid containing the target gene fragment, which was stored at -20°C.

[0044] Using the above-obtained circular plasmid as a substrate and M as a primer, PCR amplification was performed to obtain amplification products. Gel bands containing the target DNA fragment were cut out and gel recovery was carried out to obtain a linear plasmid. Specific related operations refer to Example 1.

[0045] S2. Making a standard curve According to 10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 、10 -8 、10 -9 Gradient dilution of the linear plasmid with ddH2O was used to make a standard curve. The standard equation was y = -2.7829x + 38.014 (R² = 0.921), where y was the Ct value and x was the logarithm (base 10) of the plasmid copy number.

[0046] S3. Absolute quantification qPCR verification Blank control group PCR verification was adopted. The reaction system consisted of 10 μL of TransStart® Tip Green qPCR SuperMix, 0.4 μL of each upstream and downstream primer, 1 μL of Phaeocystis globosa cell DNA, and 8.2 μL of ddH2O. The amplification program was 94°C for 30 sec, followed by 45 cycles of 94°C for 5 sec, 54°C for 15 sec, and 72°C for 10 sec.

[0047] Experimental group PCR verification was adopted, and the system composition was 10 μL of TransStart® Tip Green qPCR SuperMix, 0.4 μL of each upstream and downstream primer, and 9.2 μL of ddH2O; The amplification program was 30 sec at 94 °C, 5 sec at 94 °C, 15 sec at 54 °C, and 10 sec at 72 °C, for a total of 45 cycles.

[0048] After analyzing the Ct values obtained from the experimental group, the copy number value of the DMSP synthesis gene DSYB in the sample to be tested can be obtained. By comparing with the standard curve, the concentration of Phaeocystis globosa in the sample to be tested can be obtained, and further judge whether a Phaeocystis globosa red tide will occur in the short term, playing a role in monitoring and early warning of the red tide caused by Phaeocystis globosa.

[0049] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. All equivalent changes and improvements made according to the scope of the present invention application should still fall within the scope covered by the patent of the present invention.

Claims

1. A method for identifying a gene encoding a DMSP synthase from Phaeocystis sphericalensis, characterized in that: Using DNA from P. sphericalensis cells as template and M as primer, PCR was used to amplify the partial sequence of the target gene DSYB, and the product was detected by agarose gel electrophoresis. The amplification results were observed using gel electrophoresis imaging equipment to identify P. sphericalensis. The primer pair M is: Upstream primer F: TCGGTTGCATACGGCTTCAT; Downstream primer R: TCAGGCACTTGATCGTCACC.

2. The method for identifying a gene encoding DMSP synthase of Phaeocystis sphericalensis according to claim 1, characterized in that: The PCR amplification reaction program is: pre-denaturation at 95°C for 7 min; denaturation at 95°C for 30 s, annealing for 30 s, extension at 72°C for 20 s, 30 cycles; extension at 72°C for 5 min.

3. The method for identifying a gene encoding DMSP synthase of Phaeocystis sphericalensis according to claim 1, characterized in that: PCR reaction system: 10 μL TransStart® Tip Green qPCR SuperMix, 0.4 μL upstream and downstream primers, 1 μL DNA of Phaeocystis sphericalensis cells and 8.2 μL ddH2O.

4. The method for identifying a gene encoding DMSP synthase from Phaeocystis sphericalensis according to claim 1, characterized in that: The mass concentration of the agarose gel is 1.0%.

5. The method for identifying a gene encoding DMSP synthase from Phaeocystis sphericalensis according to claim 1, characterized in that: The gel electrophoresis imaging device contains a 200 bp band.

6. Use of the identification method for a gene encoding DMSP synthase of Phaeocystis spherica according to claims 1-5 in detecting the concentration of Phaeocystis spherica.

7. The identification method of the gene encoding DMSP synthase of Phaeocystis sphericalensis according to claims 1-5 plays a role in monitoring and early warning of red tides caused by Phaeocystis sphericalensis.

8. The use according to claim 6 or 7, characterized in that: The following steps are involved: S1, synthetic linear plasmid; S2, prepare standard curve; S3. Absolute quantitative qPCR validation.

Citation Information

Patent Citations

  • Culture method of phaeocystis globosa

    CN106967610A

  • Cell line for RXRα protein stable high expression and preparation method thereof

    WO2020000327A1