Primer and probe set, kit and application for multiple nucleic acid mass spectrometry detection of swine diarrhea pathogens

Abstract

The present invention relates to the field of molecular biology detection technology, and in particular to a primer and probe set, a kit and an application for multiple nucleic acid mass spectrometry detection of swine diarrhea pathogens. The present invention adopts matrix-assisted laser desorption / ionization time-of-flight nucleic acid mass spectrometry technology, which can simultaneously detect eight major pathogens such as PEDV, TGEV, PDCoV, PoRV, SADS-CoV, PBoV, HEV and Salmonella in a rapid, sensitive and specific manner. By designing specific primers and unextended probes, combined with multiple PCR amplification and mass spectrometry analysis, the present method achieves high-throughput, simultaneous detection of multiple pathogens. Experimental results show that the method has high sensitivity and high specificity, no false positive reactions, and shows 100% repeatability in 60 repeated experiments. Comparison with the qPCR method shows that the detection consistency is as high as 96.2%. The method has the advantages of simple operation, fast detection speed and strong adaptability. It can be widely used in the efficient monitoring of swine diarrhea pathogens, providing important technical support for the early diagnosis and prevention and control of swine diseases.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology detection technology, and in particular to a primer and probe set, a kit and applications for multiple nucleic acid mass spectrometry detection of porcine diarrhea pathogens. Background Art

[0002] Gastrointestinal diseases in pigs, particularly diarrhea, have become one of the most challenging health issues in the global swine industry. These diseases are primarily caused by viral and bacterial pathogens, including porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), porcine rotavirus (PoRV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), porcine bocavirus (PBoV), hepatitis E virus (HEV), and Salmonella. These pathogens not only lead to stunted growth in pigs but are also associated with high mortality rates. These diseases can impact public health through pork and pork products, resulting in significant economic losses for the global livestock industry.

[0003] Notable among these are porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), porcine rotavirus (PoRV), and porcine acute diarrhea syndrome coronavirus (SADS-CoV), which are highly deleterious gastrointestinal viruses. Their primary clinical symptom, diarrhea, is often indistinguishable, posing a significant challenge to differential diagnosis in the field. Furthermore, fecal-oral pathogens such as Salmonella and hepatitis E virus (HEV) infect pigs and pose a significant public health concern due to their zoonotic potential. HEV and Salmonella excreted in the feces of infected pigs can contaminate the environment, leading to cross-species transmission to humans and amplifying the risk of foodborne or waterborne outbreaks. Porcine bocavirus (PBoV), a virus frequently detected in pigs, has recently emerged as a potential contributor to gastrointestinal disease. Although PBoV genotypes G1, G2, and G3 have been identified, their prevalence and significance in diarrheal pigs remain limited. These pathogens often co-occur in mixed infections, complicating the etiological diagnosis of porcine diarrheal diseases and increasing the need for laboratory-based diagnostic tools for accurate pathogen identification.

[0004] Currently, commonly used clinical detection methods include virus isolation and culture, serological testing, enzyme-linked immunosorbent assay (ELISA), reverse transcription polymerase chain reaction (RT-PCR), and other molecular biological methods. While these methods have some application value, they still have many challenges. For example, virus isolation and culture require a long time and are cumbersome to perform; serological testing may have cross-reactions with viral antibodies, making a definitive diagnosis difficult; and ELISA and RT-PCR methods are often limited by factors such as sensitivity, specificity, and operational complexity when detecting multiple pathogens.

[0005] While existing PCR technology can achieve simultaneous detection of multiple pathogens, it still faces several challenges. For example, traditional RT-PCR methods often face difficulties in primer optimization, and their sensitivity and specificity often fall short of the requirements for high-throughput testing. Furthermore, the PCR product analysis process relies on equipment such as electrophoresis and fluorescent quantitative PCR, resulting in cumbersome procedures and high sample volume and time requirements.

[0006] A Chinese invention patent (publication number: CN117625854A) discloses a primer-probe combination, a detection kit, and its application for detecting porcine viral diarrhea. The combination can simultaneously detect four porcine viral diarrhea viruses, demonstrating accuracy, high specificity, high sensitivity, and excellent stability. However, the patent still leaves room for improvement in specificity and sensitivity.

[0007] A Chinese invention patent (publication number: CN108950083A) discloses a multiplex RT-PCR primer set for the simultaneous detection of porcine epidemiological diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PCD), and porcine group A rotavirus. This detection method demonstrates high specificity and sensitivity, enabling simultaneous identification of five viruses with accurate results and high efficiency. However, the patent still faces challenges in optimizing the primer sequences to improve sensitivity and specificity.

[0008] As can be seen, existing detection methods suffer from drawbacks such as cumbersome procedures, long cycle times, and insufficient sensitivity and specificity, making them unable to meet the demand for rapid and accurate detection of multiple swine diarrhea pathogens. Furthermore, the primer sequences of existing detection methods require further optimization to improve detection sensitivity and specificity. Although the role of HEV and PBoV in swine gastrointestinal diseases has not been fully elucidated, due to their zoonotic potential, existing detection methods are unable to meet the demand for reliable, high-throughput detection of these pathogens.

[0009] Based on this, researchers have attempted to improve existing detection technologies in recent years in order to achieve rapid, accurate, and high-throughput detection of multiple pathogens. As an emerging detection technology, multiplexed matrix-assisted laser desorption / ionization time-of-flight nucleic acid mass spectrometry (MALDI-TOF NAMS) has shown great potential in the field of pathogen detection in recent years. MALDI-TOF NAMS uses mass spectrometry to analyze PCR amplification products and identifies target pathogens by detecting changes in molecular weight. The advantages of this technology include high sensitivity, low detection limits, high specificity, and rapid detection, which can effectively improve detection efficiency and accuracy, especially in the context of mixed infection with complex pathogens.

[0010] However, current MALDI-TOF NAMS technology still faces several technical challenges in the multiplex detection of swine diarrhea pathogens, including optimizing primer design, improving the sensitivity of pathogen identification, and further enhancing the multi-target detection capabilities of mass spectrometry systems. Therefore, there is an urgent need to develop an improved MALDI-TOF NAMS detection method that can simultaneously, rapidly, and accurately detect multiple swine diarrhea-related pathogens and overcome the insufficient sensitivity and specificity of existing technologies, especially to improve the accuracy and reliability of detection in mixed-infected clinical samples. Summary of the Invention

[0011] In order to solve the above technical problems, the purpose of the present invention is to provide a PCR primer and probe set for multiple detection of porcine diarrhea pathogens based on the MALDI-TOF NAMS method, which can simultaneously detect pathogens such as porcine epidemic diarrhea virus, transmissible gastroenteritis virus, porcine deltacoronavirus, porcine rotavirus, porcine acute diarrhea syndrome coronavirus, porcine bocavirus, hepatitis E virus and Salmonella, with high sensitivity, specificity and repeatability, providing strong technical support for the diagnosis and control of porcine diarrhea.

[0012] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0013] A PCR primer and probe set for multiplex detection of porcine diarrheal pathogens based on the MALDI-TOF NAMS method. The porcine diarrheal pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV), and Salmonella (Sal); the PCR primers and probes are as follows:

[0014] PDCoV: the nucleotide sequence of the upstream primer is catatcctgtggcggatttc, the nucleotide sequence of the downstream primer is cagtcgttaagcatggcaag, and the nucleotide sequence of the probe is tacatgggcaagagc;

[0015] PEDV: the nucleotide sequence of the upstream primer is aaataaccagggtcgtggag, the nucleotide sequence of the downstream primer is tcttggactggttacgagac, and the nucleotide sequence of the probe is cattattattgcctcctc;

[0016] TGEV: the nucleotide sequence of the upstream primer is tgtgatggagtatgggtatc, the nucleotide sequence of the downstream primer is cattgtattgggattatgc, and the nucleotide sequence of the probe is gggaacggttaaacgtagt;

[0017] SADS-CoV: the nucleotide sequence of the upstream primer is ggcttactctaaacccagtc, the nucleotide sequence of the downstream primer is ttgggaaactggagtagctg, and the nucleotide sequence of the probe is acactggggcatcagcattt;

[0018] HEV: the nucleotide sequence of the upstream primer is tggttggatgaatataggg, the nucleotide sequence of the downstream primer is agtgccggcggtggtttctg, and the nucleotides of the probe are gtggtttctggggtgac;

[0019] PoRV: the nucleotide sequence of the upstream primer is gtcaatcagactctacaag, the nucleotide sequence of the downstream primer is ggtcacatcctctcacta, and the nucleotides of the probe are cccagttactctacgtagcg;

[0020] PBoV-G1: the nucleotide sequence of the upstream primer is gtgtttggttgtttgtccc, the nucleotide sequence of the downstream primer is gacacagtatggcaataccc, and the nucleotide sequence of the probe is gggacccaatgcaagcatgga;

[0021] PBoV-G2: the nucleotide sequence of the upstream primer is aaaagccacgctcatgcag, the nucleotide sequence of the downstream primer is ggtaacgccaaacgtgtttc, and the nucleotide sequence of the probe is tgtttcccatcggta;

[0022] PBoV-G3: the nucleotide sequence of the upstream primer is cccaacagttttcctctagc, the nucleotide sequence of the downstream primer is agtagtgtgaggcaggtaac, and the nucleotides of the probe are ccacaaggtccttgagcg;

[0023] Sal: The nucleotide sequence of the upstream primer is tagaacgaccccataaacac, the nucleotide sequence of the downstream primer is tccattacctacctatctgg, and the nucleotide sequence of the probe is acctatctggttgatt.

[0024] Preferably, the PCR primer and probe set also includes a PCR primer and probe set for detecting the pig RPL4 gene as an internal control, the nucleotide sequence of the upstream primer of the internal control is tttggatctctgggcttttc, the nucleotide sequence of the downstream primer is ctgctaccctcaagagtaac, and the nucleotide sequence of the probe is agatgctcaatacagaccttagc.

[0025] Preferably, a 10-base tag acggtggatg is appended to the 5' end of each PCR primer.

[0026] Furthermore, the present invention also provides the use of the PCR primer and probe set in preparing reagents for multiplex detection of swine diarrhea pathogens using a MALDI-TOF NAMS method.

[0027] Furthermore, the present invention also provides a kit comprising the PCR primer and probe set.

[0028] Preferably, the kit further comprises a standard plasmid, which is as follows:

[0029] Plasmid name Sequence amplification Region (bp) Length (bp) pUC57_HEV-3 AF082843 5129~5508 380 pUC57_HEV-4 EF077630 5143-5522 380 pUC57_PBoV-G1 NC_038537 4142~4555 414 pUC57_PBoV-G2 NC_024453 1784~2203 420 pUC57_PBoV-G3 NC_016031 1979~2313 335 pUC57_PDCoV MZ802774 275~654 380 pUC57_PEDV FJ473389.1 262~701 440 pUC57_PoRV EU372754 997~1356 360 pUC57_TGEV HQ462571 20365~20789 425 pUC57_SADS-CoV MT199592 26210~26609 400 pUC57_ KR185982 1591~2040 450 pUC57_IC XM_005659862 940~1437 498

[0030] As an option, the kit contains 2 μL of recombinant plasmid 10 4 copies / μL, 2.5 μL 2× HU MP buffer, 0.3 μL enzyme mix, 0.2 μL of each target-specific PCR primer, shrimp alkaline phosphatase SAP, reaction buffer, 1 μL probe mix, 0.04 μL Inplex enzyme, 0.2 μL terminator mix with ddNTPs, 0.2 μL Inplex buffer, and 0.56 μL ddH2O.

[0031] Preferably, the PCR thermal cycling conditions of the kit are as follows: reverse transcription at 50°C for 10 min, initial denaturation at 95°C for 5 min, followed by 45 cycles of 95°C for 15 s, 60°C for 30 s, and finally 72°C for 5 min; after amplification, shrimp alkaline phosphatase SAP and reaction buffer are added to 2 μL of PCR product for dNTP dephosphorylation; the mixture is incubated at 37°C for 40 min and then inactivated at 85°C for 5 min.

[0032] Preferably, the kit mixes the dephosphorylated product with 1 μL UEP mix, 0.04 μL Inplex enzyme, 0.2 μL termination mix (containing ddNTPs), 0.2 μL Inplex buffer, and 0.56 μL ddH2O in the extension reaction; the extension schedule includes 40 cycles at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 52°C for 5 s, 80°C for 5 s, and 72°C for 3 s.

[0033] Furthermore, the present invention also provides the use of the PCR primer and probe set or the kit for multiple detection of swine diarrhea pathogens in non-disease diagnosis based on MALDI-TOF NAMS method, wherein the swine diarrhea pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV) and Salmonella (Sal).

[0034] The present invention has the following significant technical effects due to the adoption of the above technical solution:

[0035] 1. High-throughput, simultaneous detection of multiple pathogens: The method of this invention can simultaneously, rapidly, and accurately detect eight major swine diarrhea pathogens, including porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV), porcine rotavirus (PoRV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), porcine bocavirus (PBoV), hepatitis E virus (HEV), and Salmonella. This method overcomes the problem of traditional detection methods requiring multiple separate tests, greatly improving detection efficiency and meeting the clinical demand for high-throughput, simultaneous detection of multiple pathogens.

[0036] 2. High Sensitivity and Specificity: Using MALDI-TOF NAMS technology for pathogen detection, this method exhibits exceptionally high sensitivity and specificity. With a sensitivity range of 12.20 to 33.59 copies / μL, it can detect low concentrations of pathogen nucleic acids, ensuring efficient detection in complex samples. Furthermore, specificity is significantly improved, eliminating false positive reactions and accurately distinguishing target pathogens from non-target microorganisms, avoiding the cross-reaction issues common with traditional methods.

[0037] 3. High Repeatability and Reliability: The method of the present invention demonstrates excellent repeatability and reliability across multiple experimental conditions. Across 60 replicates, both intra- and inter-batch reproducibility achieved a 100% detection rate, ensuring stability and consistency in routine use. This high repeatability makes the detection method of the present invention suitable for large-scale sample testing, particularly in clinical settings.

[0038] 4. High consistency with traditional methods: The MALDI-TOF NAMS method of the present invention was compared with the qPCR method and found to have an overall consistency rate of 96.2%. This result shows that the method provided by the present invention has comparable or even higher accuracy than traditional methods in clinical sample detection and has strong clinical application prospects.

[0039] 5. Fast and simple detection process: The detection method of the present invention does not require complicated operating steps and can complete the detection of multiple pathogens in a relatively short time, thus reducing the detection time. It does not require cumbersome electrophoresis analysis or additional equipment support, is easy to operate, and is suitable for large-scale application.

[0040] 6. Scalability and adaptability: This method utilizes a MALDI-TOF mass spectrometer, which is highly adaptable and can be easily expanded to detect other pathogens. By appropriately adjusting the primer and probe design, it can be quickly applied to detect other porcine pathogens or different types of samples, showing broad application potential.

[0041] 7. Early detection of cross-species pathogens is of great significance: Since porcine bocavirus (PBoV) and hepatitis E virus (HEV) have potential zoonotic risks, the high-throughput detection method provided by the present invention can achieve early detection of these pathogens, providing an effective technical means to prevent cross-species transmission of pathogens, and has important public health significance.

[0042] In summary, the present invention overcomes the shortcomings of traditional detection methods in sensitivity, specificity and high-throughput detection through innovative multiple detection technology, and provides a fast, accurate and efficient detection solution, which has important technical and application value for the early diagnosis and control of porcine diarrhea. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1- Figure 10 10 respectively 3 MALDI-NAMS overlay of the copies / μL plasmid (black) and the blank control with UEP added (red). Figure 1 For HEV-3&HEV-4, Figure 2 For PBoV-G1, Figure 3 For PBoV-G2, Figure 4 For PBoV-G3, Figure 5 For PDCoV, Figure 6 For PEDV, Figure 7 For PoRV, Figure 8 For TGEV, Figure 9 For SADS-CoV, Figure 10 For Salmonell, the blank control for each target showed only the UEP peak, with no SEP peak detected. In contrast, the plasmid showed a SEP peak indicating complete extension, allowing clear differentiation of the presence of the target nucleic acid fragment in the sample.

[0044] Figure 11 shows the black signal peak at 10 3 A mixed plasmid containing 100 copies / μL of DNA was used as a template to simulate the presence of all targets. The red signal peaks are based on ddH2O as the template. The UEP and SEP of each target are marked with their respective colors, with the SEP being represented by the base (A, C, or T) to which the target was extended. SEP and UEP peaks can be clearly distinguished in the NAMS image.

[0045] Figure 12 demonstrates the specificity of MALDI-TOF NAMS by detecting target and non-target pathogens. The X-axis shows the specificity of the primers and UEPs used in this assay. The Y-axis shows the mixed standard plasmid (positive control), target and non-target pathogen samples, negative pork (negative control), and water (blank). The Z-axis shows the signal-to-noise ratio (SNR).

[0046] Figure 13 HEV-3 and HEV-4 detected in different samples. There was no interference between the SEPs of HEV-3 (A) and HEV-4 (C). DETAILED DESCRIPTION

[0047] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts are within the scope of protection of the present invention.

[0048] 1. Materials and Methods

[0049] 1.1 Viruses and positive templates

[0050] The strains, bacteria and virus nucleic acid samples used in the present invention are mainly used for specificity evaluation. Inactivated virus strains, including porcine epidemic diarrhea virus (PEDV, CV777 strain), transmissible gastroenteritis virus (TGEV, WH-1R strain), porcine reproductive and respiratory syndrome virus (PRRSV, HuN4 strain), pseudorabies virus (PRV, Bartha strain) and porcine circovirus type 2 (PCV-2, JH-SRJ strain); porcine deltacoronavirus (PDCoV, P25 GH7DQ0301 strain), porcine acute diarrhea syndrome coronavirus (SADS-CoV), porcine rotavirus (PRoV), porcine bocavirus (PBoV), porcine hepatitis E virus (HEV), classical swine fever virus (CSFV, C strain), foot-and-mouth disease virus (FMDV, OHM / 02 and AKT-111 strains), Japanese encephalitis virus (JEV, SA14-14-2 strain), PEDV+TGEV bivalent live vaccine (WH-1R+AJ1102-R) and Salmonella enterica (ATCC 9842, ATCC 13076, ATCC 35640) nucleic acid samples were positive.

[0051] 1.2 Preparation of viral nucleic acid template

[0052] Viral nucleic acid was extracted and purified using the TaKaRa MiniBEST Viral RNA / DNA Extraction Kit (TaKaRa, Japan) according to the manufacturer's protocol. The resulting DNA and RNA templates were stored at −20°C for subsequent use.

[0053] 1.3 Primer and UEP design and synthesis

[0054] Based on the genome sequences of each pathogen retrieved from the NCBI database, primers targeting conserved regions of these genes and corresponding unextended probes (UEPs) were designed. Sequence analysis and multiple sequence alignment were performed using the CLC Genomics Workbench 23 (Qiagen, Germany) and MEGA-X (New Zealand). Primer and UEP design was performed using Primer3Plus (https: / / www.primer3plus.com) and the MassARRAY Assay® Design Kit (Agena, USA). For TGEV, primers were designed specifically for the S gene, avoiding regions consistent with its PrCv variants to ensure specificity. For HEV, a single-base extension site was designed to distinguish HEV-3 (A, 5560.6 Da) from HEV-4 (C, 5536.6 Da) based on 3'-terminal single nucleotide polymorphisms (SNPs). PBoV UEPs were designed based on variants in the NS1 and VP1 genes of the G1, G2, and G3 genotypes to ensure inclusiveness of all genotypes. In addition, the present invention also uses the porcine RPL4 gene (XM_005659862) as an internal control.

[0055] To prevent potential interference from multiple primer peaks in mass spectrometry, a 10-base tag (acggtggatg, shown in bold in Table 1) was appended to the 5' end of each PCR primer. Primer and probe sequences were designed using Primer-Blast and MFEprimer 4. The sequences of all primers and UEPs are shown in Table 1. All oligonucleotides were synthesized and purified by Sangon Biotech (China). qPCR primers and probes were obtained and synthesized from existing research or commercial kits. The limits of detection (LOD) for all qPCR assays were below 100 copies / µL.

[0056] Table 1 Primers and UEPs for MALDI-TOF NAMS

[0057]

[0058] UEP: unextended probe, SEP: single-base extension product;

[0059] The single-base extension products (SEP) are sorted by their molecular weight. The UEP-extended single bases are marked with capital letters and underlined.

[0060] 1.4 Construction of standard plasmids

[0061] The target gene sequences corresponding to the designed regions of each viral primer were synthesized and cloned into the pUC57 plasmid vector (Sangon, China). These recombinant plasmids were used as standard templates to evaluate the performance of the detection system of the present invention. The details of the standard plasmids are listed in Table 2. The copy number of each plasmid was quantified using Qubit4 (ThermoFisher, USA). Each standard plasmid was first diluted to 10 8 copies / μL, and then serially diluted 10-fold to form a 8 to 10 0 In the subsequent experiments, the concentration range of each gradient concentration (10 7 ~10 0 A mixed plasmid solution (100 copies / μL) was prepared as a positive control. Aliquots of this plasmid mixture were stored for downstream testing.

[0062] Table 2 Plasmids used in the present invention

[0063] Plasmid name Sequence amplification Region (bp) Length (bp) pUC57_HEV-3 AF082843 5129~5508 380 pUC57_HEV-4 EF077630 5143-5522 380 pUC57_PBoV-G1 NC_038537 4142~4555 414 pUC57_PBoV-G2 NC_024453 1784~2203 420 pUC57_PBoV-G3 NC_016031 1979~2313 335 pUC57_PDCoV MZ802774 275~654 380 pUC57_PEDV FJ473389.1 262~701 440 pUC57_PoRV EU372754 997~1356 360 pUC57_TGEV HQ462571 20365~20789 425 pUC57_SADS-CoV MT199592 26210~26609 400 pUC57_ KR185982 1591~2040 450 pUC57_IC XM_005659862 940~1437 498

[0064] 1.5 Optimization of reaction system and reaction conditions

[0065] To optimize the reaction system, 10 PCR products were generated for each target site using the primers and UEPs listed in Table 1. 4 Then, a plasmid containing 10 4 The multiplex conditions were optimized by mixing plasmid samples of 11 targets at equal concentrations of 10 copies / μL. The initial concentrations of all primers and UEPs were set to 5 μmol / L and adjusted to achieve uniform UEP peak intensity and E SEP / UEP ≥ 0.8. Optimization included fine-tuning primer and UEP concentrations, annealing temperature (55°C–60°C), and annealing time (20–35 seconds) in the multiplex PCR system. All experiments included negative controls using ddH2O, and the correct mass spectrometry peaks were used to evaluate the results.

[0066] PCR setup and reaction conditions: Each reaction mixture contained 2 μL of recombinant plasmid (10 4PCR products were prepared using a PCR amplification kit (100 μL, 2.5 μL 2× HU MP buffer), 0.3 μL enzyme mix (Yeasen, China), and 0.2 μL of each target-specific primer. Thermal cycling conditions were as follows: reverse transcription at 50°C for 10 min, initial denaturation at 95°C for 5 min, followed by 45 cycles of 95°C for 15 s, 60°C for 30 s, and a final step of 72°C for 5 min. After amplification, shrimp alkaline phosphatase (SAP) and reaction buffer (Agena, USA) were added to 2 μL of PCR product for dNTP dephosphorylation. The mixture was incubated at 37°C for 40 min and then inactivated at 85°C for 5 min. For the extension reaction, the dephosphorylated product was mixed with 1 μL of UEP mix, 0.04 μL of Inplex enzyme, 0.2 μL of terminator mix (containing ddNTPs), 0.2 μL of Inplex buffer (Agena, USA), and 0.56 μL of ddH2O. The extension schedule consisted of 40 cycles at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s, 52°C for 5 s, 80°C for 5 s, and 72°C for 3 s. The UEPs specifically bind to the target sequence in the PCR product, while chain termination using ddNTPs generates SEPs.

[0067] SEPs were transferred to a 384-well plate, diluted to 25 μL with ddH2O, and centrifuged at 8000 rpm for 2 minutes. The prepared plate, along with an inert matrix chip, was loaded into a DP-TOF mass spectrometer (Digena, China). A pre-edited analysis file containing molecular weight information for each UEP and SEP was imported into the instrument software. After completing sample and plate setup, the resin was added to purify the product. Results were evaluated based on correct peak localization in the mass spectrometer. The UEP and SEP peaks corresponding to each target were detected to confirm successful amplification and extension.

[0068] 1.6 Specificity, sensitivity, and reproducibility of MALDI-TOF NAMS

[0069] The performance of the method was determined by analyzing the consistency of the results for each target. To evaluate the specificity of the MALDI-TOF NAMS method, we detected genomic nucleic acids extracted from inactivated target virus cultures or vaccines. Non-target nucleic acids of inactivated CSFV, FMDV, PRRSV, PRV, and PCV-2 were used as negative controls. 4 The plasmid mixture with 100 copies / μL was used as the positive control, and ddH2O was used as the blank control.

[0070] Two serial dilutions of the plasmid mixture (initial concentration: 100 copies / μL) were prepared to generate a concentration range to evaluate the sensitivity of NAMS, including 50, 25, 12.5, 12.5, 6.2, 3.1, and 1.6 copies / μL. Each diluted plasmid was tested 10 times with the optimized primers and UEPs, and the LOD for each target was determined.

[0071] In order to evaluate the reproducibility, we used high, medium and low concentrations (10 6 , 10 4 and 10 2 A plasmid mixture containing 100 copies / μL was used as template. Twenty replicates were performed for each dilution to assess intra-assay reproducibility. Additionally, two independent experiments were performed (with a 7-day interval between experiments), and the results from three independent batches were analyzed. Inter-batch reproducibility was assessed based on the results obtained with different target primers at different plasmid concentrations.

[0072] 1.7 Evaluation of clinical sample results by MALDI-TOF NAMS

[0073] To validate the ability of MALDI-TOF NAMS to detect multiple pathogens in clinical samples, we evaluated a total of 242 diarrheal samples using both MALDI-TOF NAMS and qPCR. Some discordant samples were validated using dPCR.

[0074] For sample preparation, use blood samples (1-2 mL) directly for nucleic acid extraction. Stool specimens (1-2 g) were diluted 10-fold with PBS, vortexed thoroughly, and centrifuged at 10,000 rpm for 5 minutes. The supernatant was collected. Tissue samples (1-2 g) were homogenized in 5-10 mL of 10 mM phosphate buffered saline (PBS, pH 7.2) at a mass-to-volume ratio of 1:5. The homogenate was processed using a tissue grinder, centrifuged at 10,000 rpm for 5 minutes, and the supernatant was collected.

[0075] Nucleic acid was extracted and purified using a MagNA Pure 24 instrument and the corresponding total nucleic acid extraction kit (Roch, Switzerland). Subsequently, optimized conditions for multiplex reverse transcription PCR, SAP digestion, and UEP extension were used. Each sample was tested in triplicate with ddH2O and 10 4 The copies / μL plasmid mixture served as negative and positive controls.

[0076] 2. Results

[0077] 2.1 Single-target MALDI-TOF NAMS detection

[0078] Mass spectrometry analysis using a single plasmid as template ( Figures 1-10 The results (shown in Figure 1) show that each standard plasmid tested produces a distinct SEP peak (black) at the predicted mass position, while the corresponding blank control only detects a UEP peak (red). Based on the specific mass of each target, the UEP and SEP peaks can be clearly distinguished. The positions of these two peaks are consistent with those shown in Table 1, confirming the specificity and functionality of the designed primers and UEPs.

[0079] 2.2 Multiple detection of 11 targets

[0080] Use mixed plasmid templates (10 for each target site) 4 copies / μL), and the ability of the system to detect multiple targets simultaneously was evaluated. Figure 11 Shown are mass spectra obtained under optimized reaction conditions. All 11 SEP peaks were detected at their expected mass positions with minimal overlap or interference, demonstrating successful multiplex amplification and extension of the UEPs. Furthermore, no extraneous peaks or significant changes in peak height were observed, confirming the compatibility of the assay in a multiplex environment. To ensure uniform signal detection, the initial concentrations of primers and UEPs were adjusted during the optimization process (Table 3).

[0081] Table 3 Final concentrations of primers and UEPs used in MALDI-TOF NAMS

[0082] target Primer (µmol / L) UEP (µmol / L) HEV 5 10 PBoV-G1 2 10 PBoV-G2 4 10 PBoV-G3 2 6 PDCoV 4 6 PEDV 6 15 PoRV 4 10 TGEV 4 10 SADS-CoV 4 8 2 9 Internal control 2 10

[0083] 2.3 Specificity of MALDI-TOF NAMS

[0084] The genomic DNA or cDNA of 10 target pathogens and 5 non-target controls were used as templates, and the extension reaction products were analyzed by mass spectrometry after amplification. Figure 12 As shown, the SEP peaks corresponding to PDCoV, PEDV, TGEV, SADS-CoV, HEV, PoRV, PBoV-G1 / G2 / G3, and Sal were detected in reactions using their respective target pathogens or mixed plasmids as templates. In addition, HEV-3 and HEV-4 can be distinguished by a single UEP based on the extended bases ( Figure 1 In contrast, non-target pathogens (including CSFV, FMDV, PRRSV, PRV, and PCV 2) and blank controls showed no amplification. Mass spectra from these non-target samples revealed only UEP peaks, confirming the high specificity of the MALDI-TOF NAMS assay for the selected target pathogens. This specificity ensures the assay can reliably distinguish target pathogens in complex biological samples without cross-reactivity with non-target microorganisms, highlighting its robustness and accuracy in diagnostic applications.

[0085] 2.4 Sensitivity of MALDI-TOF NAMS

[0086] The sensitivity of MALDI-TOF NAMS detection was evaluated using serially diluted plasmid mixtures ranging from 100 copies / μL to 1.6 copies / μL. All targets were reliably detected at 12.5 copies / μL. Probit regression analysis was then performed to calculate the LoD (99% probability of detection) and its 95% confidence interval based on 10 replicates for each concentration. The results are shown in Table 4. The LoD values for all targets ranged from 12.20 copies / μL to 33.59 copies / μL, demonstrating the high sensitivity and reliability of this method at low nucleic acid concentrations.

[0087] Table 4 Sensitivity test results

[0088]

[0089] 2.5 Reproducibility of MALDI-TOF NAMS

[0090] The reproducibility of MALDI-TOF NAMS detection was evaluated using mixed plasmid template at high, medium, and low concentrations. At each concentration, all targets were detected with 100% accuracy (20 / 20 per concentration, 60 / 60 total). In two subsequent independent experiments, all targets were also detected with 100% positivity (60 / 60 per batch). These results demonstrate the excellent intra- and inter-batch reproducibility of this method, ensuring its reliability for routine detection.

[0091] 2.6 Evaluation of MALDI-TOF NAMS on three types of samples

[0092] The performance of the MALDI-TOF NAMS method was further validated using 242 clinical samples, including stool (97), tissue (132), and serum (13) specimens. To evaluate the accuracy of MALDI-TOF NAMS, we used qPCR as a reference method, and analyzed the concordance rates between the two methods (Table 5). Statistics for HEV include HEV-3 and HEV-4, while PBoV includes the combined results for all genotypes. The results showed that the overall concordance rates for individual targets ranged from 92.6% to 100.0% (except for TGEV). When the data for all targets were combined, the overall concordance rates ranged from 93.2% to 98.3% across sample types, and the overall concordance rate for all 242 samples was 96.2%. These findings demonstrate high concordance between MALDI-TOF NAMS and qPCR, supporting the reliability and accuracy of the newly developed method for the detection of multiple pathogens in clinical diarrheal samples.

[0093] Table 5 Results of 242 clinical samples tested using NAMS and their qPCR coincidence rates

[0094]

[0095] *: The total PBoV coincidence rate is calculated based on the results of G1, G2 and G3 typing tests;

[0096] Positive coincidence rate (%) = P NAMS &P qPCR / P qPCR

[0097] Negative match rate (%) = N NAMS &N qPCR / N qPCR

[0098] Total coincidence rate (%) = (P NAMS &P qPCR +N NAMS &N qPCR ) / all.

[0099] N: negative; P: positive.

[0100] 3. Discussion

[0101] Porcine diarrhea syndrome (PDS) poses a serious threat to the health of global pig populations and the development of the world's swine industry, resulting in significant economic losses, particularly in import and export trade. The complex landscape of diarrheal pathogens in pigs, coupled with the emergence of new pathogens, increases the challenges of disease prevention and control. Therefore, new diagnostic technologies that can handle mixed infections and effectively detect a variety of pathogens are urgently needed. This study aimed to evaluate the performance of nucleic acid mass spectrometry (NAMS) for the detection of PDS-associated pathogens. Our results demonstrate that NAMS can achieve high-throughput, multiplexed pathogen detection with high sensitivity and specificity, addressing some of the limitations of existing diagnostic methods such as ELISA, qPCR, and NGS. These results highlight the potential of NAMS as a powerful tool for large-scale pathogen surveillance and disease control.

[0102] PEDV, TGEV, SADS-CoV, and PDCoV all belong to the Coronaviridae family. Coronaviruses have garnered significant attention due to their broad host range and potential for cross-species transmission. The emergence of coronaviruses such as MERS-CoV, SARS-CoV, and SARS-CoV-2 provides stark reminders of the risks associated with interspecies spillover. For example, phylogenetic analysis suggests that PDCoV, first discovered in 2012, is believed to have originated from an interspecies transmission event involving avian and mammalian coronaviruses. Studies have shown that PDCoV utilizes its spike (S) protein to bind to the host aminopeptidase N (APN), enabling it to infect cells from pigs, chickens, and humans. The high conservation of APN across species may play a key role in facilitating PDCoV's cross-species infectivity. Notably, PDCoV is not the only enteric coronavirus to utilize APN; PEDV and TGEV also rely on this receptor, suggesting potential commonalities in coronavirus host switching mechanisms. Furthermore, studies have shown that SADS-CoV can replicate efficiently in multiple mammalian cell lines, including primary human lung and intestinal cells, further highlighting its potential for interspecies transmission. Similar to HEV and PBoV, the widespread distribution and zoonotic potential of swine-derived coronaviruses warrant comprehensive investigations of their epidemiology and transmission dynamics. These efforts are crucial to assess and mitigate the potential public health risks associated with these pathogens.

[0103] The present invention utilizes the advantages of NAMS to perform SNP genotyping on HEV-3 and HEV-4 genes, such as Figure 13 Shown are HEV-3 and HEV-4 detected in different samples. There is no interference between the SEPs of HEV-3 (A) and HEV-4 (C). Similarly, SNP genotyping can be further used to distinguish pathogen variants, such as virulent versus attenuated strains, and wild-type versus vaccine strains. Furthermore, the successful detection of Salmonella spp. demonstrates the ability of NAMS to simultaneously detect RNA viruses, DNA viruses, and bacteria. This significantly broadens the scope of pathogen detection and its application scenarios, particularly in the diagnosis of syndromes of unknown etiology. This capability relies on the selection of an appropriate nucleic acid extraction method.

[0104] 4. Conclusion

[0105] In summary, this study demonstrates the potential of nucleic acid mass spectrometry (NAMS) as a suitable tool for the detection and genotyping of swine diarrhea pathogens. While this method demonstrates strong sensitivity and specificity, it remains an emerging technology that complements traditional diagnostic methods such as qPCR and NGS. The ability to multiplex these pathogens in a single assay not only improves diagnostic accuracy but also provides a comprehensive understanding of co-infections, which are common in clinical settings. This is particularly useful for complex mixed infections, where traditional single-target approaches often complicate diagnosis. The broader potential of NAMS lies in its application in pathogen surveillance, particularly in epidemiological monitoring, enabling early detection of emerging infectious diseases in animal populations and potentially incorporating them into entry-exit quarantine processes. It provides a new means for more efficient and accurate pathogen screening, which is crucial for controlling the international spread of animal diseases.

[0106] The above is a description of the embodiments of the present invention. The above description of the disclosed embodiments will enable professionals in the field to implement or use the present invention. Various modifications to these embodiments will be apparent to professionals in the field. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but should conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A PCR primer and probe set for multiplex detection of porcine diarrhea pathogens based on MALDI-TOF NAMS method, wherein the porcine diarrhea pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV) and Salmonella ( Salmonella ); It is characterized in that PCR primers and probes are as follows: PDCoV: the nucleotide sequence of the upstream primer is catatcctgtggcggatttc, the nucleotide sequence of the downstream primer is cagtcgttaagcatggcaag, and the nucleotide sequence of the probe is tacatgggcaagagc; PEDV: the nucleotide sequence of the upstream primer is aaataaccagggtcgtggag, the nucleotide sequence of the downstream primer is tcttggactggttacgagac, and the nucleotide sequence of the probe is cattattattgcctcctc; TGEV: the nucleotide sequence of the upstream primer is tgtgatggagtatgggtatc, the nucleotide sequence of the downstream primer is cattgtattgggattatgc, and the nucleotide sequence of the probe is gggaacggttaaacgtagt; SADS-CoV: the nucleotide sequence of the upstream primer is ggcttactctaaacccagtc, the nucleotide sequence of the downstream primer is ttgggaaactggagtagctg, and the nucleotide sequence of the probe is acactggggcatcagcattt; HEV: the nucleotide sequence of the upstream primer is tggttggatgaatataggg, the nucleotide sequence of the downstream primer is agtgccggcggtggtttctg, and the nucleotides of the probe are gtggtttctggggtgac; PoRV: the nucleotide sequence of the upstream primer is gtcaatcagactctacaag, the nucleotide sequence of the downstream primer is ggtcacatcctctcacta, and the nucleotides of the probe are cccagttactctacgtagcg; PBoV-G1: the nucleotide sequence of the upstream primer is gtgtttggttgtttgtccc, the nucleotide sequence of the downstream primer is gacacagtatggcaataccc, and the nucleotide sequence of the probe is gggacccaatgcaagcatgga; PBoV-G2: the nucleotide sequence of the upstream primer is aaaagccacgctcatgcag, the nucleotide sequence of the downstream primer is ggtaacgccaaacgtgtttc, and the nucleotide sequence of the probe is tgtttcccatcggta; PBoV-G3: the nucleotide sequence of the upstream primer is cccaacagttttcctctagc, the nucleotide sequence of the downstream primer is agtagtgtgaggcaggtaac, and the nucleotides of the probe are ccacaaggtccttgagcg; Salmonella : The nucleotide sequence of the upstream primer is tagaacgaccccataaacac, the nucleotide sequence of the downstream primer is tccattacctacctatctgg, and the nucleotide sequence of the probe is acctatctggttgatt.

2. The PCR primer and probe set according to claim 1, wherein The PCR primer and probe set also includes a PCR primer and probe set for detecting the pig RPL4 gene as an internal control. The nucleotide sequence of the upstream primer of the internal control is tttggatctctgggcttttc, the nucleotide sequence of the downstream primer is ctgctaccctcaagagtaac, and the nucleotide sequence of the probe is agatgctcaatacagaccttagc.

3. The PCR primer and probe set according to claim 1 or 2, characterized in that: A 10-base tag, acggtggatg, was appended to the 5' end of each PCR primer.

4. Use of the PCR primer and probe set according to any one of claims 1 to 3 in preparing reagents for multiplex detection of swine diarrhea pathogens using a MALDI-TOF NAMS method.

5. A kit comprising the PCR primer and probe set according to any one of claims 1 to 3.

6. The kit according to claim 5, characterized in that The kit also includes standard plasmids, which are described below: 。 7. Use of the PCR primer and probe set according to any one of claims 1 to 3 or the kit according to any one of claims 5 to 6 for multiplex detection of swine diarrhea pathogens in non-disease diagnosis based on MALDI-TOF NAMS, wherein the swine diarrhea pathogens are porcine deltacoronavirus (PDCoV), porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), porcine acute diarrhea syndrome coronavirus (SADS-CoV), hepatitis E virus (HEV), porcine rotavirus (PoRV), porcine bocavirus (PBoV) and Salmonella ( Salmonella ).

Images