FOXRED2 as tumor diagnosis and treatment marker

Abstract

The invention provides a novel application of FOXRED2 molecules as a diagnostic marker in a cancer generation and development process. The invention particularly relates to application of a reagent for detecting the expression quantity of the FOXRED2 protein in preparation of a cancer diagnosis or prognosis kit and application of an inhibitor for inhibiting the expression of the FOXRED2 protein in preparation of a medicine for treating cancers. The invention finds that FOXRED2 can help tumor cells to better adapt to an external bad microenvironment by enhancing the transport and degradation capabilities of the tumor cells to misfolded proteins, alleviates cytotoxicity caused by endoplasmic reticulum stress, and finally promotes the disease progression of cancers. Therefore, the FOXRED2 protein provided by the invention can be used as a cancer diagnosis marker and a treatment target.

Description

Technical Field

[0001] The present invention relates to the field of tumor diagnosis and treatment, specifically to the use of FOXRED2 as a marker for tumor diagnosis and treatment, more specifically to the FOXRED2 protein as a marker for tumorigenesis and development and its new roles and mechanisms in tumors, and also relates to a kit or drug developed based on FOXRED2 for early cancer diagnosis, treatment or prognosis evaluation. Background Art

[0002] Cancer is a major threat to people's life and health and one of the main causes of abnormal human death. Statistical data released by the International Agency for Research on Cancer (IARC) under the World Health Organization (WHO) in 2020 showed that in China, the number of newly diagnosed cancer cases was 4.57 million, and the number of cancer death cases was 3 million, ranking first in the world in terms of new cases and deaths. Cancer has imposed a heavy burden on the entire society [1]. Therefore, developing new treatment methods for cancer, improving the efficiency of early diagnosis, and improving prognosis judgment are of great significance for improving the survival rate of cancer patients.

[0003] Taking liver cancer as an example, although immunotherapy has been rapidly promoted and used, the five-year survival rate of liver cancer is still only 21%. At the same time, the current early screening and diagnosis methods for liver cancer mainly include serum alpha-fetoprotein determination and imaging examinations, etc. Its treatment strategies mainly include local ablation therapy, surgical resection, radiotherapy, liver transplantation, transarterial chemoembolization, and systemic therapy. In addition, the choice of treatment strategy depends on tumor size, liver function and cirrhosis status, lymph node involvement, metastasis, the overall health status of the patient, and economic ability. However, these methods have limitations in terms of accuracy and cost, resulting in more than 50% of liver cancer patients being in the middle and late stages of liver cancer at the time of diagnosis. In this period, the clinical treatment methods are limited and the prognosis is poor in the later stage [2, 3]. For various cancers such as liver cancer, where early symptoms are not easily detectable, the disease progresses rapidly, and the current treatment methods have limited effects, exploring new and highly efficient specific expression factors, identifying new markers in the process of cancer development, and elaborating their molecular mechanisms in the process of cancer development play an important role in the early diagnosis and timely treatment of cancer.

[0004] The endoplasmic reticulum is the main site for the synthesis of proteins, lipids, and carbohydrates. Protein folding and protein modification that occur in the endoplasmic reticulum are one of the material bases for the survival of organisms [4]. Due to the protein synthesis requirements for the high-speed proliferation of tumors and a series of adverse external microenvironments brought about after tumor formation, unfolded proteins and misfolded proteins accumulate continuously inside tumors, generating endoplasmic reticulum stress pressure that is extremely unfavorable to tumors [5, 6]. However, current research on the molecular mechanism of the role of the endoplasmic reticulum stress pathway in liver cancer is still relatively scarce. Therefore, analyzing the molecules involved in endoplasmic reticulum stress during the occurrence and development of liver cancer and developing products or drugs for early cancer diagnosis, treatment, or prognosis assessment based on this is very important for the clinical treatment of cancer. Summary of the Invention

[0005] This invention mainly explores whether the FOXRED2 molecule can be used as a diagnostic marker during the occurrence and development of cancer and explores new applications for clinically treating tumors by targeting the FOXRED2 marker. The FOXRED2 protein is a protein located in the endoplasmic reticulum. The research will simultaneously deeply analyze the relationship between FOXRED2 and endoplasmic reticulum stress pressure, explore a new mechanism by which FOXRED2 promotes tumor development by regulating endoplasmic reticulum stress, and based on this, propose that FOXRED2, as a pro-cancer factor highly expressed during the occurrence and development of liver cancer, can be used as a potential marker for tumor diagnosis and treatment, and products or drugs for treating tumors can be developed by targeting FOXRED2.

[0006] Aiming at one or more problems existing in the prior art, this invention has identified that the FOXRED2 protein can be used as a detection marker during the occurrence and development of cancer, analyzed new theories and new mechanisms in its occurrence and development, and can develop products for cancer diagnosis, treatment, and prognosis assessment based on this.

[0007] Specifically, this invention provides the following technical solutions:

[0008] On the one hand, this invention provides the use of a reagent for detecting the expression level of the FOXRED2 protein in the preparation of a cancer diagnosis or prognosis kit.

[0009] In some embodiments, the reagent for detecting the expression level of the FOXRED2 protein includes a Western blot, immunohistochemistry, or enzyme-linked immunosorbent assay reagent for detecting the expression level of the FOXRED2 protein.

[0010] In some embodiments, the reagent for detecting the expression level of the FOXRED2 protein is an anti-FOXRED2 antibody.

[0011] In some embodiments, the cancer is a cancer with high expression of FOXRED2.

[0012] In some embodiments, the cancer is liver cancer, breast cancer, cervical cancer, esophageal cancer, lung cancer, prostate cancer, melanoma, gastric cancer, lymphoma or thymic carcinoma.

[0013] In some embodiments, the cancer is liver cancer.

[0014] In some embodiments, the liver cancer is of the HepG2, PLC or HUH7 cell line.

[0015] On the other hand, the present invention provides the use of an inhibitor that inhibits the expression of the FOXRED2 protein in the preparation of a drug for treating cancer.

[0016] In some embodiments, the inhibitor that inhibits the expression of the FOXRED2 protein is siRNA.

[0017] In some embodiments, the inhibitor that inhibits the expression of the FOXRED2 protein is an inhibitor targeting the substrate binding site of the FOXRED2 protein.

[0018] In some embodiments, the inhibitor that inhibits the expression of the FOXRED2 protein is a gene knockout reagent for FOXRED2.

[0019] The present invention also provides a method for detecting the expression level of the FOXRED2 protein, characterized in that the expression level of the FOXRED2 protein in a sample to be tested is detected by Western blot, immunohistochemistry or enzyme-linked immunosorbent assay.

[0020] The present invention also provides a kit for detecting cancer or judging the prognosis of cancer, characterized in that: the kit includes Western blot, immunohistochemistry and enzyme-linked immunosorbent assay reagents for detecting the expression level of the FOXRED2 protein, and then the presence or absence of cancer and the prognosis of cancer are judged according to the expression level of the FOXRED2 protein. When the detected expression level of the FOXRED2 protein is significantly higher than that of the control group, it is judged that the sample has cancer or a poor prognosis.

[0021] In some embodiments, the control group is a sample without cancer cells.

[0022] The present invention also provides a method for inhibiting the function of the FOXRED2 protein, characterized in that the method comprises administering to a subject an inhibitor targeting the substrate binding site of the FOXRED2 protein.

[0023] In some embodiments, by constructing a fluorescence reporter system downstream of the FOXRED2 protein, the functional change of the FOXRED2 protein after administering an inhibitor targeting the substrate binding site of the FOXRED2 protein is detected.

[0024] On the other hand, the present invention provides a drug for treating liver cancer, and the drug is a substance that inhibits the function of the FOXRED2 protein.

[0025] In some embodiments, the substance that inhibits the function of the FOXRED2 protein includes siRNA, neutralizing antibody, compound that inhibits the expression of the FOXRED2 protein, and an inhibitor targeting the substrate binding site of the FOXRED2 protein.

[0026] Through cell biology experiments and mouse experiments, the present invention found that the FOXRED2 protein has a carcinogenic effect. In the tumor tissues and adjacent tissues of liver cancer clinical patients and mouse liver cancer models, the present invention found that the expression level of the FOXRED2 protein in the tumor tissues was significantly up-regulated compared with that in the adjacent tissues; further, the present invention found that FOXRED2 can alleviate the degree of endoplasmic reticulum stress in tumor cells; finally, the present invention combined with the NRAS / shP53 / SB13 mouse orthotopic liver cancer induction model and found that the deletion of the FOXRED2 protein can significantly inhibit the occurrence and development of liver cancer. This suggests that the FOXRED2 protein in the present invention has the potential for cancer auxiliary diagnosis, as a therapeutic target, or for prognosis evaluation.

[0027] The present invention found that the FOXRED2 protein can alleviate endoplasmic reticulum stress in tumors, and the FOXRED2 protein promotes the occurrence and development of liver cancer depending on its substrate. By preparing a targeted drug (such as siRNA) to specifically inhibit the protein level of FOXRED2 in liver cancer cells; or inhibiting the function of the FOXRED2 protein, it provides new ideas and methods for the clinical diagnosis and treatment of liver cancer. Further, the cancers detected and treated in the present invention include liver cancer, but should not be limited to liver cancer, but should be widely applicable to all cancers with high expression of the FOXRED2 protein.

[0028] Definition

[0029] Ponceau S: Also known as scarlet, it can be used for the detection of proteins on PVDF membranes, nitrocellulose membranes, and cellulose acetate membranes. Ponceau S is negatively charged and can bind to positively charged amino acid residues. At the same time, Ponceau S can also bind to the non-polar region of proteins, thus forming a red band. The sensitivity of Ponceau S staining is lower than that of Coomassie Brilliant Blue staining. The staining of proteins with Ponceau S is reversible, and the stain can be washed off with distilled water, PBS, or other appropriate solutions after staining. Therefore, when performing protein N-terminal sequencing, the protein on the SDS-PAGE gel is transferred to a PVDF membrane, stained with Ponceau S, and the target band is cut off for sequencing.

[0030] FOXRED2: Full name is FAD-dependent oxidoreductase domain-containing protein 2, also known as endoplasmic reticulum flavoprotein associated with degradation (ERFAD). FOXRED2 has 18 transcripts (splice variants), 212 homologous genes and 5 paralogous genes. It is ubiquitously expressed in the brain, ovary and 24 other tissues. The FOXRED2 protein is localized in the endoplasmic reticulum and is involved in the regulation of endoplasmic reticulum homeostasis.

[0031] CD3δ: CD3δ is a protein subunit of the CD3 receptor complex. In mammals, the CD3 complex contains one CD3γ chain, one CD3δ chain, and two CD3ε chains. CD3δ functions as part of it. If CD3δ is expressed alone in cells, since it cannot form a complex with the remaining subunits, the separately expressed CD3δ is considered a misfolded protein that is harmful to cells and needs to be recognized and cleared by the endoplasmic reticulum degradation system.

[0032] YFP: Yellow Fluorescent Protein, which can be regarded as a mutant of green fluorescent protein and was originally derived from Aequorea victoria. Compared with green fluorescent protein, its fluorescence is shifted towards the red spectrum, which is mainly due to the mutation of threonine at position 203 of the protein to tyrosine. Its maximum excitation wavelength is 514 nm and the maximum emission wavelength is 527 nm. YFP is mainly used in related experiments such as imaging with fluorescence microscopes.

[0033] VSVG: A viral membrane protein that can be used to convert the DNA of an exogenous gene expression vector into infectious virus particles. In the viral life cycle, VSVG plays a key role in viral replication.

[0034] Δ8.9: Also known as delta 8.9, it is a second-generation lentiviral packaging helper plasmid carrying viral gag, pol, rev and tat genes. Together with VSVG, it constitutes a second-generation lentiviral packaging system for packaging second-generation or third-generation lentiviral vector plasmids. These three plasmids form a three-plasmid system (i.e., the second-generation lentiviral system). Co-transfecting these three plasmids into cells such as 293T can package recombinant lentiviruses. Infecting target cells with this lentivirus can achieve gene knockout, knockdown and overexpression, etc.

[0035] Beneficial effects

[0036] The inventors of the present invention found that the FOXRED2 protein is highly expressed in a variety of cancer types, and its high expression is significantly associated with poor prognosis of patients. Further research found that FOXRED2 can help tumor cells better adapt to the adverse external microenvironment by enhancing the ability of tumor cells to transport and degrade misfolded proteins, slow down the cytotoxicity caused by endoplasmic reticulum stress, and ultimately promote the progression of cancer. Therefore, the present invention proposes that the FOXRED2 protein can be used as a diagnostic and therapeutic marker for cancer. The high expression of FOXRED2 in tumors is significantly correlated with the cancer development process, which can provide new ideas for the diagnosis of cancer occurrence in clinical practice. At the same time, it provides new ideas based on the function of the FOXRED2 protein for analyzing the molecular mechanisms of the pathogenesis of FOXRED2-high-expressing cancer types such as liver cancer, breast cancer, cervical cancer, esophageal cancer, lung cancer, prostate cancer, melanoma, gastric cancer, lymphoma, and thymic cancer, and exploring new targets and strategies for the diagnosis and treatment of FOXRED2-high-expressing cancer types such as liver cancer and breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The expression of FOXRED2 in 11 clinical liver cancer samples is shown. N in the figure represents normal, representing normal tissue or adjacent cancer tissue; T represents tumor, representing tumor tissue. The upper and lower figures are both the results of protein immunoblotting experiments. The lower figure is the nitrocellulose membrane after Ponceau S staining.

[0038] Figure 2 The results of immunohistochemical experiments showing the expression of FOXRED2 are shown. The brownish-yellow indicates the expression level of FOXRED2, and the darker the color, the higher the expression level of the FOXRED2 protein.

[0039] Figure 3 The proliferation of liver cancer cell lines inhibited by FOXRED2 deletion in different cells is shown. Among them, A shows the proliferation of liver cancer cell lines inhibited by FOXRED2 deletion in HepG2 cells; B shows the proliferation of liver cancer cell lines inhibited by FOXRED2 deletion in PLC cells. EV in the figure represents the empty vector. The statistical test method is T-test, n = 3, where * represents significant difference P < 0.05; ** represents significant difference P < 0.01; *** represents significant difference P < 0.001.

[0040] Figure 4 The expression of the misfolded protein reporter system CD3δ-YFP detected by Western blot is shown. It shows that the misfolded protein reporter gene detection system has been successfully constructed. Based on this cell line, the misfolded proteins in cells can be quantitatively detected, and at the same time, the degradation of misfolded proteins can be detected under different conditions of FOXRED2.

[0041] Figure 5 The effectiveness of using a fluorescence experiment to detect the error protein system is shown, and the results of detecting the degradation of the overexpressed FOXRED2 on the error protein CD3δ are also shown.

[0042] Figure 6 The expression of the error protein CD3δ-Flag was detected after knocking down or overexpressing FOXRED2 in HepG2 cells. Among them, A shows the expression of the error protein CD3δ-Flag after knocking down FOXRED2 in HepG2 cells, and B shows the expression of the error protein CD3δ-Flag after overexpressing FOXRED2 in HepG2 cells.

[0043] Figure 7 The situation of inducing in-situ liver cancer in mice is shown. Among them, A shows the pictures of liver tumors in mice after 10 weeks of induction, B shows the ratio of tumor liver weight and the number of foci in mice, and C shows the expression of FOXRED2 in the adjacent tissues and cancer tissues of multiple tumor samples in mice. The statistical test method is T-test, n = 3, where * represents significant difference P < 0.05; ** represents significant difference P < 0.01; *** represents significant difference P < 0.001.

[0044] Figure 8 The expression of FOXRED2 in different cancer types in the TCGA database and the relationship between FOXRED2 and the prognosis of liver cancer patients are shown. Among them, A shows the performance of the transcriptional level of FOXRED2 in multiple cancers. The expression level of FOXRED2 is higher than that of the normal group in multiple cancer types. B shows the situation in the specific cancer type of liver cancer. The high expression of FOXRED2 is positively correlated with the prognosis of liver cancer patients. The higher the expression level of FOXRED2, the worse the prognosis of liver cancer patients. In the figure, BRCA represents breast cancer, DLBC represents diffuse large B-cell lymphoma, ESCA represents esophageal cancer, LIHC represents hepatocellular carcinoma, LUSC represents lung squamous cell carcinoma, PRAD represents prostate adenocarcinoma, SKCM represents cutaneous melanoma, STAD represents gastric adenocarcinoma, and THYM represents thymic tumor. Detailed implementation manners

[0045] To make the objectives, technical solutions, and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to specific embodiments and the accompanying drawings.

[0046] Example 1 FOXRED2 is highly expressed in multiple clinical tumor samples

[0047] 1. Collect samples from clinical liver cancer patients (from the First Affiliated Hospital of University of Science and Technology of China (Anhui Provincial Hospital), approved by the Ethics Committee of the Affiliated Hospital of USTC). Separate the tumor tissues from the adjacent tissues in the samples and detect the expression of FOXRED2 in different tissues. Add tissue lysate (in 50 mL of lysate, 47.55 mL of RIPA lysate, 100 μL of Na3VO4 solution with a final concentration of 0.5 M, 1 mL of NaF solution with a final concentration of 0.5 M, 100 μL of DTT solution with a final concentration of 1 M, 250 μL of PMSF solution with a final concentration of 0.2 M, 1 mL of protease inhibitor cocktails are required; RIPA lysate: 6 g of Tris, 8.76 g of NaCl, 5 g of sodium deoxycholate, 1 g of SDS, 0.42 g of NaF, 1.86 g of EDTA·2Na·2H2O, 10 mL of TritonX-100, adjust the pH to 7.4 with hydrochloric acid, make up to 1000 mL with ddH2O, store at 4 °C) into the tumor tissues and adjacent tissues. After ultrasonic disruption and sufficient lysis of the tissues, extract the protein components in the tissues. Subsequently, perform quantitative analysis on the proteins in different components. Finally, detect and analyze the samples with the same protein content through Western Blot experiment. The specific steps are as follows: After separating the proteins by SDS-PAGE electrophoresis, transfer the proteins onto a nitrocellulose membrane and block the proteins with skim milk; after fully binding with a monoclonal antibody (primary antibody) (Anti-FOXRED2, purchased from sigma company, product number HPA031611) that specifically binds to the FOXRED2 protein, then bind it with a secondary antibody (the secondary antibody is Anti-rabbit, purchased from BIORAD company, product number 170-6515) that specifically binds to the primary antibody, and then perform chemical development and fixation; after scanning the picture, perform analysis.

[0048] The specific experimental steps are as follows:

[0049] 1. After ultrasonic lysis of the tumor tissues, place them on ice for lysis for 30 minutes, with multiple vortex oscillations during this period. After the lysis is completed, centrifuge at 13,000×g for 10 min using a low-temperature centrifuge. The supernatant after centrifugation is the cell protein obtained after lysis.

[0050] 2. Use the Bradford method for protein quantification and determine the protein concentration according to the kit instructions. Finally, respectively pipette the same amount of protein + tissue lysate + loading buffer (when preparing 50 mL of loading buffer, 5 g of SDS, 250 mg of bromophenol blue, 25 mL of glycerol, and 12.5 mM of Tris-HCl are required) to prepare protein samples for protein gels, and then boil the protein samples in a metal bath for 5 - 10 min.

[0051] 3. Gel preparation: Subsequently, according to the experimental requirements and the molecular weight of the target protein, prepare a polyacrylamide gel with a concentration of 8%, and the specific preparation ratio is as follows:

[0052] 30% polyacrylamide: Weigh 290 g of acrylamide and 10 g of bisacrylamide, dissolve them in water, and finally make up the volume to 1 L.

[0053] 4×SDS-Tris-HCl: pH 8.8. Weigh 90.86 g of Tris, dissolve it in pure water, then add 2 g of SDS powder, and then use concentrated hydrochloric acid HCl to adjust the pH to 8.8, and finally make up the volume to 500 mL.

[0054] 10% APS: The Chinese name of APS is ammonium persulfate. Weigh 5 g of the powder and dissolve it in 50 mL of pure water to obtain 10% APS.

[0055] 4×SDS-Tris-HCl: pH 6.8. Weigh 30.29 g of Tris, dissolve it in pure water, then add 2 g of SDS powder, and then use concentrated hydrochloric acid HCl to adjust the pH to 6.8, and finally make up the volume to 500 mL.

[0056] Table 1 8% protein gel separating gel formula (1×)

[0057] Component Volume 30% Polyacrylamide 2.66 mL 4×SDS-Tris-HCl (pH 8.8) 2.5 mL <![CDATA[H2O]]> 4.84 mL 10% APS 33.3 μL TEMED (Tetramethylethylenediamine) 6.67 μL

[0058] Table 2 8% protein gel stacking gel formula (1×)

[0059] Component Volume 30% Acrylamide 0.43 mL 4×SDS-Tris-HCl (pH 6.8) 0.83 mL <![CDATA[H2O]]> 2.03 mL 10% APS 16.67 μL TEMED 3.33 μL

[0060] 4. Loading: Assemble the prepared protein gel into a special electrophoresis tank, pour in the protein gel electrophoresis buffer (taking the preparation of 4 L of electrophoresis buffer as an example, add 121 g of Tris, 720 g of glycine, and 40 g of SDS reagent, and finally make up the volume to 4 L with double-distilled water). Subsequently, load the protein sample into the sample wells of the protein gel. According to the experimental needs, the loading volume of the sample can be adjusted and selected by yourself, as long as the total protein amount in each well is the same. Then, power on the electrophoresis tank and start electrophoresis at a constant voltage of 80 V. When all the samples in the lanes are compressed into a line and the protein marker begins to separate, showing marker bands of different molecular weights, the voltage can be increased to a constant voltage of 120 V until the bottom bromophenol blue just runs out of the inner solution, and the electrophoresis is completed.

[0061] 5. Membrane transfer: Before the electrophoresis ends, materials required for membrane transfer need to be prepared in advance. Pre-cool the membrane transfer buffer (2.9 g of glycine, 5.8 g of Tris, 0.37 g of SDS, 200 ml of methanol, made up to 1000 ml with ddH2O) at 4°C. Prepare the filter paper, membrane transfer clamp, nitrocellulose membrane, and absorbent cotton required for membrane transfer. After the electrophoresis ends, membrane transfer can begin. First, place the membrane transfer clamp in a tray filled with membrane transfer buffer. Open the membrane transfer clamp, with the white side down, place a layer of absorbent cotton, a layer of filter paper, and a nitrocellulose membrane, then place the protein gel on the nitrocellulose membrane, and use a scraper to drive away air bubbles to ensure tight fitting. Subsequently, cover with a layer of filter paper and a layer of absorbent cotton, then place the black side of the membrane transfer clamp and clamp the membrane transfer clamp in the form of a "sandwich". Place the membrane transfer clamp into a dedicated membrane transfer tank, start membrane transfer after power on, and transfer the membrane at a constant voltage of 80V for 150 min.

[0062] 6. Blocking: Take out the nitrocellulose membrane after membrane transfer is completed, put it into Ponceau S staining solution, and then cut different position bands according to experimental needs. Wash the bands with TBST. After thoroughly removing the Ponceau S staining solution, block the bands with a blocking solution containing 5% skim milk powder to remove non-specific binding.

[0063] 7. Primary antibody incubation: Wash the blocked bands once with TBST buffer, then place different bands into the corresponding prepared specific primary antibody tubes and incubate the primary antibody overnight at 4°C.

[0064] 8. Secondary antibody incubation: Wash the incubated primary antibody with TBST buffer for 30 min, changing the TBST buffer every 10 min. Subsequently, place the bands into the corresponding secondary antibody and incubate at room temperature for 2 hours.

[0065] 9. Development: After the secondary antibody incubation ends, wash the bands with TBST buffer for 30 min, during which the TBST buffer needs to be changed every 10 min. Finally, add an appropriate developing solution to the washed bands, place them in a developer for development, and save the final developed experimental results.

[0066] The results are as Figure 1 shown. FOXRED2 protein was significantly highly expressed in multiple (n = 11) clinical liver cancer tissue samples, while the expression level of FOXRED2 protein was relatively low in normal tissues, indicating that FOXRED2 protein can be used as a detection marker during tumor development, and its high expression is significantly correlated with the tumor process.

[0067] This suggests that FOXRED2 is a previously unreported cancer-promoting factor and can be used as a detection marker for tumor occurrence and development. Detecting the expression level of FOXRED2 protein can indicate whether cancer has occurred. If the level of FOXRED2 is abnormally elevated, it indicates the presence of cancer.

[0068] Figure 2 The results of the immunohistochemical experiment are shown. The brownish-yellow color indicates the expression level of FOXRED2. The darker the color, the higher the expression level of the FOXRED2 protein. I, II, and III are the clinical stages of liver cancer patients. Figure 2 The results show that as the liver cancer progresses, while the liver cancer gets worse, the expression level of FOXRED2 also increases significantly. The higher the liver cancer stage, the higher the expression level of the FOXRED2 protein. It indicates that the expression level of the FOXRED2 protein has a positive proportional relationship with the liver cancer progression, and FOXRED2 can be used as a biomarker to detect the progression of liver cancer.

[0069] Example 2 FOXRED2 Promotes the Proliferation of Liver Cancer Cells

[0070] 1. Detect the FOXRED2 protein level in liver cancer cells with overexpressed or knocked-down FOXRED2 by Western blot, and confirm the effect of FOXRED2 on the proliferation rate of liver cancer by cell counting method.

[0071] Method: Overexpress or knockdown FOXRED2 in the hepatocellular carcinoma cell line HepG2. First, construct plasmids for overexpressing or knocking down FOXRED2. The construction of the plasmid for overexpressing FOXRED2 is as follows: Amplify the cDNA sequence (SEQ ID NO: 4) of the FOXED2 CDS region from the hepatocellular carcinoma cell line by PCR (forward primer: 5’-ATGGGCCTCTCCGCTGCGGCC-3’ (SEQ ID NO: 5); reverse primer: 5’-GAGCTCCTCTTTGTTGCTATC-3’ (SEQ ID NO: 6)). The amplified FOXRED2 fragment needs to be homologous recombined with the pSin-puro vector (Addgene). Subsequently, transform the recombinant reaction product into competent Escherichia coli cells. Finally, evenly spread the bacterial solution on a plate containing ampicillin resistance by the plate coating method, send the possible positive colonies to the company for sequencing, and use them for experiments after the sequencing results are correctly aligned. The construction of the plasmid for knocking down FOXRED2 is as follows: Design specific primers targeting the FOXRED2 sequence. The forward primer sequence of ShFOXRED2 is: 5’-CCTCAGACTTAACTCGGGAAA-3’ (SEQ ID NO: 7), and the reverse primer sequence is: 5’-TTTCCCGAGTTAAGTCTGAGG-3’ (SEQ ID NO: 8). Similar to the construction of the overexpression plasmid above, ligate the products amplified by the forward and reverse primers of shFOXRED2 with the pLKO-puro vector (Addgene), and then perform the same steps as above, namely transformation, plate coating, colony PCR, and sending positive colonies to the company for sequencing. After the plasmids for overexpressing or knocking down FOXRED2 are successfully constructed, the next experiment can be carried out. Transfect the plasmid into 293T cells to produce lentivirus. The specific steps for producing the virus are as follows: Use the PEI transfection reagent for transfection. Prepare the plasmid mixture in advance: The mixing system is: 1.5 mL Opti-MEM (Giboco) + 12 μg of the target plasmid + 36 μL of PEI (DNA:PEI = 1:3 (μg / μL)). After pipetting and mixing evenly, let it stand at room temperature for 15 minutes. The plasmid mixture needs to be gently added drop by drop to the culture dish. After gently swirling evenly, place it in a 37 °C cell culture incubator. The above is the transient transfection of ordinary plasmids. If lentivirus needs to be produced, additional virus packaging plasmids need to be added. The packaging plasmids are 6 μg of Δ8.9 (purchased from addgene) and 1.5 μg of VSVG (purchased from addgene). At this time, add 60 μL of PEI to the mixing system. After culturing for 6 - 8 hours, aspirate the medium containing PEI and add 10 mL of fresh pre-warmed DMEM medium at 37 °C. Be careful not to blow up the 293T cells when adding, place it in the cell culture incubator, and continue to culture for 48 hours. Then collect the supernatant of the medium as lentivirus.Subsequently, wash the HepG2 cells in a 6-well plate or 6-cm culture dish once with PBS. Add 1-2 mL of filtered lentivirus supplemented with polybrene to the HepG2 cells. After culturing the cells at 37 °C for 6 hours, supplement with pre-warmed fresh DMEM medium to the normal culture volume, and culture the cells in a 37 °C cell culture incubator for 48 h. Passage the cells according to the cell status and density. After passage, perform puromycin resistance screening. After several generations of screening, a HepG2 cell line with overexpression or knockdown of FOXRED2 can be successfully established.

[0072] Harvest the cells after stable overexpression or knockdown. Lyse the cells with cell lysis buffer to break the cells and incorporate the cell contents (including proteins) into the cell lysis buffer. Adjust the protein quantification of the cell lysate under the same conditions. Finally, detect and analyze the samples of each component with the same protein content by Western blot. The specific steps are as follows: After separating the proteins by SDS-PAGE electrophoresis, transfer the proteins onto a nitrocellulose membrane and block the proteins with skim milk; After fully binding with monoclonal antibodies (primary antibodies) that specifically bind to the two proteins FOXRED2 and Actin respectively, then bind with a secondary antibody that specifically binds to the primary antibody, and perform chemical development and fixation; Scan the pictures and analyze them.

[0073] The results are as Figure 3 shown. In the hepatocellular carcinoma cell line overexpressing FOXRED2, the proliferation rate of hepatocellular carcinoma cells increases; in the hepatocellular carcinoma cell line with knockdown of FOXRED2, the proliferation rate of hepatocellular carcinoma cells decreases significantly. The cell proliferation experiment shows that as time goes by, the number of cells in the control group increases slowly, but the number of cells in the group overexpressing FOXRED2 increases significantly. On the fourth day, the number of cells in the group overexpressing FOXRED2 has reached more than 1.2 million, but at this time, the number of cells in the control group is only less than 750,000. The comparison between the two groups shows that overexpression of FOXRED2 significantly promotes the proliferation of hepatocellular carcinoma cells. After knockdown of FOXRED2, it is also found that on the fourth day, the number of cells in the knockdown group is only 400,000, but at this time, the number of cells in the control group is more than 800,000, indicating that knockdown of FOXRED2 significantly inhibits cell proliferation.

[0074] The above cell experiments show that in hepatocellular carcinoma cells, the protein expression level of FOXRED2 is positively correlated with the tumor cell proliferation rate. For example, according to the overexpression group, FOXRED2 significantly promotes tumor proliferation, and as time goes by, this phenomenon becomes more obvious. Tumor cells with high expression of FOXRED2 survive better, suggesting that FOXRD2 can be used as a detection marker for cancer development.

[0075] Example 3 Construction of a Fluorescent Reporter System for the Function of FOXRED2 Protein

[0076] 1. Construct a CD3δ fluorescent reporter plasmid and establish a stable CD3δ-expressing cell line in the HEK293T tool cells.

[0077] Method: Integrate the CD3δ sequence and the YFP sequence on the pSin plasmid backbone to construct a CD3δ fluorescent reporter plasmid. The CD3δ sequence and the YFP fluorescent sequence can be replaced with any misfolded protein sequence and any reporter gene. The construction process is the same as the above plasmid construction steps. PCR amplify the CD3δ sequence and the YFP sequence (SEQ ID NO:1 and SEQ ID NO:2), and ligate the amplified fragments into the pSin-puro vector (Addgene) to obtain the plasmid overexpressing CD3δ-YFP. In the HEK293T tool cell line, transfect 12 μg of the pSin-CD3δ-YFP plasmid, 6 μg of the Δ8.9 plasmid (purchased from Addgene), and 1.5 μg of the VSVG plasmid (purchased from Addgene) using the PEI reagent (Polysciences, catalog number 23966-1) to produce lentivirus capable of packaging the pSin-CD3δ-YFP plasmid. The specific steps are as follows: Use PEI and related transfection reagents to produce lentivirus containing the misfolded protein reporter system in the HEK293T tool cells. Replace the DMEM medium of the tool cells 6-8 hours later. After 48 hours, use a 0.22 μm virus filter and syringe to collect the supernatant of the tool cell culture medium as lentivirus for subsequent experiments. Add about 3 ml of the collected lentivirus to the cultured HepG2 liver cancer cells, and use the polybrene reagent to increase the lentivirus infection efficiency. After 48 hours, perform cell passage experiments on the infected cells, and use puromycin to screen for positive liver cancer cells after infection. After culturing for 1-2 generations, collect the cells for western blot experiments to detect whether the liver cancer cells are infected with the misfolded protein reporter gene. The purpose of the virus infection experiment is to detect whether the infected liver cancer cells can express the CD3δ protein contained in the virus, determine the expression of the CD3δ fluorescent reporter system, and whether the construction of the stable expression cell line is successful. As Figure 4 shown, the present invention successfully constructed a misfolded protein reporter gene detection system. Based on this cell line, the misfolded proteins in cells can be quantitatively detected, and at the same time, the degradation of misfolded proteins can be detected under different conditions in combination with FOXRED2.

[0078] Example 4 Mechanism study on the promotion of misfolded protein degradation by FOXRED2

[0079] The FOXRED2 protein promotes the degradation of misfolded proteins in liver cancer cells

[0080] (1) In the hepatocellular carcinoma cell line HepG2 stably expressing the CD3δ fluorescence reporter system, a stable cell line with knockdown or overexpression of FOXRED2 was constructed.

[0081] Method: In the HEK293T tool cell line, the overexpression plasmid of FOXRED2 and the knockdown shRNA plasmid were transfected using the PEI reagent to package lentiviruses capable of knocking down or overexpressing FOXRED2. The lentiviruses were collected and concentrated, and an appropriate amount of lentiviruses were used to infect the hepatocellular carcinoma cell line HepG2 stably expressing the CD3δ fluorescence reporter gene. Through puromycin screening, a hepatocellular carcinoma cell line with both the CD3δ fluorescence reporter system and the characteristics of FOXRED2 knockdown or overexpression was finally obtained.

[0082] (2) With the help of the CD3δ fluorescence reporter system and cycloheximide (CHX) (the role of cycloheximide is to inhibit the translation process in cells, prevent the synthesis of new proteins, and keep the total protein in the cells consistent at present), the functional activity of the FOXRED2 protein in the hepatocellular carcinoma cell line was detected.

[0083] Method: In hepatocellular carcinoma cells, the cells were infected with lentiviruses. The lentiviruses carried the CD3δ protein and the FOXRED2 protein respectively. Subsequently, puromycin drug screening was used. After determining that the hepatocellular carcinoma cells had successfully expressed the two proteins, the CHX inhibitor was used to stop intracellular protein translation, and the change in the fluorescence intensity of the misfolded protein CD3δ was observed. Fluorescence imaging of the hepatocellular carcinoma cell line was performed at different treatment time points, and the shooting parameters (exposure time and magnification) were fixed, and the fluorescence imaging results were analyzed.

[0084] The results are as Figure 5 shown. Within the same time, the FOXRED2 protein can significantly promote the degradation of misfolded proteins, resulting in a decrease in the CD3δ fluorescence signal. As shown in the figure, in the EV group (Empty Vector), that is, the control group, there was no very obvious change in the fluorescence intensity in the shooting results from 0 to 6 hours. However, in the experimental group, that is, after overexpressing FOXRED2, it can be seen that the shooting result at 0 hour shows that the fluorescence intensity of CD3δ is very strong and the fluorescence signal is very bright. But after 2 hours, the signal has started to decay, and the brightness and intensity of the fluorescence signal have both decreased significantly. In the shooting result at 6 hours, a very weak and small fluorescence signal with very low brightness was observed. This indicates that the FOXRED2 protein can significantly promote the degradation of misfolded proteins, resulting in a decrease in the CD3δ fluorescence signal.

[0085] FOXRED2 can promote the degradation rate of misfolded proteins and enhance the tolerance of liver cancer cells to endoplasmic reticulum stress. Over time, after overexpressing FOXRED2, the fluorescence signal of CD3δ decreases continuously over time, indicating that a large amount of the misfolded protein CD3δ is cleared. Since misfolded proteins are harmful to cells, after being largely cleared, the cells can survive better.

[0086] (3) Construct a CD3δ-Flag tag system and, in combination with cycloheximide treatment, detect the functional activity of the FOXRED2 protein in liver cancer cell lines

[0087] Method: In liver cancer cell lines with both the CD3δ-Flag tag system and the characteristics of FOXRED2 knockdown or overexpression, treat the cells with 1 mM CHX inhibitor for 0, 2, 4, and 6 h, then collect the liver cancer cells treated at different time points, perform quantification using Bradford, and detect the protein expression of FOXRED2, ACTIN, and CD3δ-Flag by immunoblotting.

[0088] The results are as Figure 6 shown. Within the same time, the FOXRED2 protein can significantly promote the reduction of the CD3δ-Flag protein. In the overexpression group, at 2 hours, the expression level of the misfolded protein CD3δ was already very low, basically 10% of the CD3δ protein content in the 0-hour treatment group, and it was hardly detectable, indicating that it had been largely degraded. However, in the control group, a lot of misfolded protein still remained, and 50% of the CD3δ protein content in the 0-hour treatment group still remained in the control group.

[0089] Result analysis: FOXRED2 can promote the degradation rate of misfolded proteins and enhance the tolerance of liver cancer cells to endoplasmic reticulum stress, suggesting that as an oncogenic factor, FOXRED2 promotes the proliferation of tumor cells by alleviating the endoplasmic reticulum stress pressure faced by tumor cells.

[0090] Example 5 FOXRED2 helps liver cancer cells resist endoplasmic reticulum stress and thus accelerates the progression of liver cancer

[0091] 1. Experiment on inducing in situ liver cancer in FOXRED2 knockout mice

[0092] Methods: Orthotopic hepatocellular carcinoma was induced in FOXRED2-knockout C57BL / 6 mice by high-pressure tail vein injection of NRAS / shP53 / SB13 plasmid (this system can induce orthotopic hepatocellular carcinoma in mice, purchased from Addgene). The specific steps are to use normal saline to dilute the plasmid used to induce tumors and prepare the working solution (taking the injection amount of one mouse as an example, when each adult mouse is about 20g, about 2mL of working solution is injected. The three plasmids NRAS / shP53 / SB13 are mixed at a mass ratio of 25μg:29μg:37μg, and finally normal saline is added to supplement to 2mL), and the injection amount of each mouse is 10% of its own body weight; use a syringe to draw up the working solution and inject it into the tail vein of the mouse, and deliver the plasmid to the experimental mouse through this high-pressure tail vein injection method; feed the mice that have been injected with the working solution normally, observe the growth status of the mice at any time, and then observe whether the abdomen of the mice is bulging to judge the size of the induced tumor; when the induction time and tumor size of the mice are appropriate, the mice can be sacrificed, and the tumor in the liver is removed to observe and detect the experimental results.

[0093] The mouse liver was weighed, and the tumor points and diameter were counted and measured. Liver tumor and adjacent tissue samples were obtained, and each tissue was crushed into a tissue homogenate using a tissue crusher, and then each component cell was crushed by a cell lysate, and the cell contents (including protein) were dissolved in the cell lysate. The protein of the cell lysate was quantified under the same conditions, and finally the same amount of each component sample was analyzed by immunoblotting. The specific steps were as follows: after separating the protein by SDS-PAGE electrophoresis, the protein was transferred to a nitrocellulose membrane, and the protein was blocked by skim milk; monoclonal antibodies (primary antibodies) that specifically bind to FOXRED2, CHOP, Calnexin and other proteins (Anti-CHOP was purchased from proteintech, item number 15204-1-AP; Anti-Calnexin was purchased from Santa cruz, item number sc-46669) were fully combined with it, and then a secondary antibody that specifically binds to the primary antibody was combined with it, and then chemical development and fixation were performed; the image was scanned and analyzed.

[0094] The results are as follows Figure 7 As shown, knockout of FOXRED2 significantly inhibited the occurrence and development of liver cancer. The loss of FOXRED2 caused an increase in the degree of endoplasmic reticulum stress in liver cancer tissues, aggravated endoplasmic reticulum stress pressure, and slowed down the progression of liver cancer. Figure 7 A shows that after knocking out FOXRED2, the progression of in situ liver cancer in mice was significantly slowed down and the tumor growth in mice was significantly inhibited. Figure 7 Figure B and Figure 7Both the liver weight ratio and the number of foci in Figure C can indicate that the knockout of FOXRED2 significantly inhibits the progression of mouse tumors in vivo. Compared with the control group, the volume of liver tumors in mice is significantly reduced, and the number of foci is significantly decreased, indicating the important role of FOXRED2 in promoting tumor development. In the mouse experiment, it can be seen that the average liver weight ratio in the WT control group is about 30%, but after knocking out FOXRED2, the liver weight ratio significantly decreases to about 5%. At the same time, it can be clearly seen that there are differences in the number of foci of liver cancer in the mouse experiment. In the WT control group, an average of about 40 foci can be seen, but only sporadic foci can be seen after knocking out FOXRED2, about 5. This result significantly shows that FOXRED2 can promote the occurrence and development of liver cancer. FOXRED2 can be used as a biomarker in the process of liver cancer occurrence and development. Knocking out FOXRED2 can inhibit the proliferation of liver cancer cells and the growth of tumors in mice. Result analysis: FOXRED2 promotes the occurrence and development of liver cancer by downregulating the degree of endoplasmic reticulum stress. In the in vivo mouse model, we also demonstrated that FOXRED2 can act as a pro-cancer factor, which can significantly promote the growth of mouse tumors, and FOXRED2 is significantly highly expressed in mouse tumor tissues, indicating that FOXRED2 can be used as a detection biomarker in the process of tumor occurrence and development, providing new ideas for clinical detection and treatment of liver cancer.

[0095] Sequence

[0096] SEQ ID NO:1 CD3δ nucleotide sequence

[0097] atggaacatagcacgtttctctctggcctggtactggctacccttctctcgcaagtgagccccttcaagatacctatagaggaacttgaggacagagtgtttgtgaattgcaataccagcatcacatgggtagagggaacggtgggaacactgctctcagacattacaagactggacctgggaaaacgcatcctggacccacgaggaatatataggtgtaatgggacagatatatacaaggacaaagaatctaccgtgcaagttcattatcgaatgtgccagagctgtgtggagctggatccagccaccgtggctggcatcattgtcactgatgtcattgccactctgctccttgctttgggagtcttctgctttgctggacatgagactggaaggctgtctggggctgccgacacacaagctctgttgaggaatgaccaggtctatcagcccctccgagatcgagatgatgctcagtacagccaccttggaggaaactgggctcggaacaag

[0098] SEQ ID NO:2 YFP nucleotide sequence

[0099] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgCagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

[0100] SEQ ID NO:3 Flag amino acid sequence

[0101] DYKDDDDK

[0102] SEQ ID NO:4 FOXRED2 nucleotide sequence

[0103]

[0104] Forward primer for overexpression of FOXRED2, SEQ ID NO:5

[0105] 5’-ATGGGCCTCTCCGCTGCGGCC-3’

[0106] Reverse primer for overexpression of FOXRED2, SEQ ID NO:6

[0107] 5’-GAGCTCCTCTTTGTTGCTATC-3’

[0108] Forward primer for knockdown of FOXRED2, SEQ ID NO:7

[0109] 5’-CCTCAGACTTAACTCGGGAAA-3’

[0110] Reverse primer for knockdown of FOXRED2, SEQ ID NO:8

[0111] 5’-TTTCCCGAGTTAAGTCTGAGG-3’

[0112] Forward primer for amplification of CD3δ, SEQ ID NO:9

[0113] 5’-atggaacatagcacgtttctc-3’

[0114] Reverse primer for amplification of CD3δ, SEQ ID NO:10

[0115] 5’-cttgttccgagcccagtttcc-3’

[0116] References

[0117] [1]Wild CP, Weiderpass E, Stewart BW, editors(2020). World Cancer ReportCancer Research for Cancer Prevention..pdf>[J].

[0118] [2]LLOVET J M, KELLEY R K, VILLANUEVAA, et al. Hepatocellular carcinoma[J]. Nat Rev Dis Primers, 2021, 7(1):6.

[0119] [3] LLOVET J M, Montal R, Sia D, Finn RS (2018) Molecular therapies and precision medicine for hepatocellular carcinoma. Nat Rev Clin Oncol 15:599-616.

[0120] [4] Rashid HO, Yadav RK, Kim HR, Chae HJ. ER stress: Autophagy induction, inhibition and selection. Autophagy 2015, 11(11):1956-1977.

[0121] [5] Chen X, Cubillos-Ruiz JR. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat Rev Cancer 2020.

[0122] [6] Roth GS, Decaens T. Liver immunotolerance and hepatocellular carcinoma: Patho-physiological mechanisms and therapeutic perspectives. Eur J Cancer 2017, 87:101-112.

[0123] The specific embodiments described above further elaborate on the objectives, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting the expression level of FOXRED2 protein in the preparation of a diagnostic or prognostic kit for cancer.

2. The use according to claim 1, wherein The reagents for detecting the expression level of FOXRED2 protein include Western blot, immunohistochemistry or enzyme-linked immunosorbent assay reagents for detecting the expression level of FOXRED2 protein.

3. The use according to claim 1, wherein The reagent for detecting the expression level of FOXRED2 protein is an anti-FOXRED2 antibody.

4. Use of an inhibitor that inhibits the expression of FOXRED2 protein in the preparation of a drug for treating cancer.

5. The use according to claim 4, wherein The inhibitor for inhibiting the expression of FOXRED2 protein is siRNA.

6. The use according to claim 4, wherein The inhibitor for inhibiting the expression of FOXRED2 protein is an inhibitor targeting the substrate binding site of FOXRED2 protein.

7. The use according to claim 4, wherein The inhibitor for inhibiting the expression of FOXRED2 protein is a gene knockout reagent for FOXRED2.

8. The use according to any one of claims 1-7, wherein The cancer is a cancer with high expression of FOXRED2.

9. The use according to claim 8, wherein The cancer is liver cancer, breast cancer, cervical cancer, esophageal cancer, lung cancer, prostate cancer, melanoma, gastric cancer, lymphoma or thymic cancer. Preferably, the cancer is liver cancer.

10. The use according to claim 9, wherein The liver cancer is HepG2, PLC or HUH7 cell line.

Images