Combination therapy for treating cancer

By combining KDM5C inhibitor with AKT, PI3K-α and mTOR inhibitors, the problem of the reduction in the effectiveness of existing breast cancer treatment methods after the emergence of resistance is solved, and efficient therapeutic effect in the case of resistance is achieved.

CN120187416APending Publication Date: 2025-06-20ASTRAZENECA AB
View PDF 22 Cites 0 Cited by

Patent Information

Application Number
CN202380077985.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-11-11
Filing Date
2023-11-10
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

Existing methods of treating breast cancer may not be effective in certain types of cancer, especially after early resistance to capacasetinib-based therapy.

Method used

By combining KDM5C inhibitors with AKT, PI3K-α and mTOR inhibitors, the antiproliferative effects of cancer treatment are enhanced and the onset of resistance are prevented or delayed.

Benefits of technology

This combination therapy can sensitive certain types of cancer cells to inhibit AKT, PI3K-α or mTOR, providing a method to improve treatment effectiveness before and after the advent of resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120187416A_ABST
    Figure CN120187416A_ABST
Patent Text Reader

Abstract

The present specification relates to the use of an AKT inhibitor, a PI3K-alpha inhibitor or an mTOR (such as mTORC1) inhibitor in combination with a KDM5C inhibitor for the treatment of cancer, such as breast cancer. Also described is a pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient wherein the compound is an AKT inhibitor, a PI3K-alpha inhibitor, or an mTOR inhibitor.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] This specification relates to the use of a combination of an AKT inhibitor, a PI3K-α inhibitor or an mTOR (such as mTORC1) inhibitor and a KDM5C inhibitor for the treatment of cancer such as breast cancer. BACKGROUND ART

[0002] Breast cancer remains a leading cause of death. Although effective treatments (especially endocrine therapies such as aromatase inhibitors and selective estrogen modulators) have been developed in the past 50 years, they may not be effective in all cancer types or may lose efficacy over time due to the development of tumor resistance. Thus, there remains a need for new methods of treating cancer (and especially advanced or metastatic breast cancer).

[0003] A modern approach to treating breast cancer relies on the use of targeted therapies - such as receptor tyrosine kinase inhibitors (TKIs) - to address cancers that are not managed under the current paradigm or to overcome pathways by which cancer cells develop resistance. For example, AKT is a serine / threonine-specific protein kinase that functions as part of the PI3K / AKT / PTEN pathway and plays a key role in multiple cellular processes such as glucose metabolism, apoptosis, cell proliferation, transcription, and cell migration. Mammalian cells express three closely related AKT isoforms encoded by different genes: AKT1 (protein kinase Bα), AKT2 (protein kinase Bβ), and AKT3 (protein kinase Bγ). Capivasertib (also known as AZD5363, chemical name (S)-4-amino-N-(1-(4-chlorophenyl)-3-hydroxypropyl)-1-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide) is a selective inhibitor of all three AKT isoforms. Capivasertib is currently being evaluated in clinical studies for the treatment of cancer, including breast cancer, where (among other applications) it can be used to overcome drug resistance. However, the evolving nature of cancer means that resistance to Capivasertib treatment itself may develop over time, reducing its efficacy.

[0004] The KDM5C gene encodes lysine-specific demethylase 5C, which is an enzyme member of the α-ketoglutarate-dependent hydroxylase superfamily. From genome-scale CRISPR screens, KDM5C has been identified as a gene that increases sensitivity to Capivasertib in estrogen receptor-positive (ER+) breast cancer cell lines when "knocked out". Thus, this specification discloses that KDM5C inhibition can further sensitize certain types of cancer cells to AKT inhibition, potentially providing a method of increasing the efficacy of drugs such as Capivasertib before and after resistance develops to early Capivasertib-based therapies.

[0005] For AKT inhibitors, similar beneficial effects have also been disclosed when the KDM5C inhibitor is combined with two other drug classes targeting the PI3K / AKT / PTEN and mTOR pathways: PI3K-α inhibitors (such as selective PI3K-α inhibitors or specific PI3K-α inhibitors) and mTOR inhibitors (such as selective mTORC1 inhibitors). Thus, it has been determined that treatment with a KDM5C inhibitor can overcome resistance and resensitize cancer to the therapeutic effects of inhibiting AKT, PI3K-α, or mTOR. Accordingly, combinations of AKT, PI3K-α, or mTOR inhibitors and KDM5C inhibitors can act synergistically together in a therapy to prevent resistance or delay its onset. SUMMARY OF THE INVENTION

[0006] This specification provides a means of enhancing the anti-proliferative effects of AKT, PI3K-α, and mTOR therapies in cancer (such as breast cancer) using combinations of KDM5C inhibitors with AKT, PI3K-α, and mTOR inhibitors.

[0007] In one aspect, provided is a compound for treating cancer, wherein the compound is administered in combination with a KDM5C inhibitor and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0008] In one aspect, provided is a compound for treating cancer, wherein the compound is administered in combination with a KDM5C inhibitor and the compound is an AKT inhibitor.

[0009] In one aspect, provided is a compound for treating cancer, wherein the compound is administered in combination with a KDM5C inhibitor and the compound is a PI3K-α inhibitor.

[0010] In one aspect, provided is a compound for treating cancer, wherein the compound is administered in combination with a KDM5C inhibitor and the compound is an mTOR inhibitor.

[0011] The term "treatment" refers to at least partially alleviating, suppressing, preventing, and / or ameliorating a disorder, condition, or disease (such as breast cancer). The term "cancer treatment" includes both ex vivo and in vivo treatments, including in warm-blooded animals (such as humans). The effectiveness of cancer treatment can be evaluated in a variety of ways, including but not limited to: inhibiting cancer cell proliferation (including reversal of cancer growth); promoting cancer cell death (e.g., by promoting apoptosis or another cell death mechanism); improvement of symptoms; duration of remission from treatment; delay of disease progression; and extension of survival. Treatment can also be evaluated based on the nature and extent of side effects associated with the treatment. In addition, effectiveness can be evaluated based on biomarkers, such as the expression or phosphorylation level of a protein known to be associated with a particular biological phenomenon. Other evaluations of effectiveness are known to those skilled in the art.

[0012] The phrase "in combination with" and similar terms encompass administering two or more active pharmaceutical ingredients to a subject and include simultaneous administration in separate compositions, administration at different times in separate compositions, or administration in a composition in which two or more active pharmaceutical ingredients are present.

[0013] In an embodiment, the administration of the compound and the KDM5C inhibitor is separate, sequential, or simultaneous.

[0014] In an embodiment, the administration of the compound and the KDM5C inhibitor is separate.

[0015] In an embodiment, the administration of the compound and the KDM5C inhibitor is sequential.

[0016] In an embodiment, the administration of the compound and the KDM5C inhibitor is simultaneous.

[0017] In another aspect, there is provided the use of a compound in the manufacture of a medicament for the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0018] In another aspect, there is provided a method of treating cancer in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of a compound, wherein the compound is administered in combination with a therapeutically effective amount of a KDM5C inhibitor, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0019] The term "therapeutically effective amount" refers to an amount of a compound or combination of compounds as described herein sufficient to achieve the intended application, including but not limited to the treatment of a disease. The therapeutically effective amount can vary depending on the intended application (in vitro or in vivo), or the subject to be treated and the disease condition (e.g., the weight, age and sex of the subject), the severity of the disease condition, the mode of administration, etc., which can be readily determined by one of ordinary skill in the art. The term also applies to the dose that will induce a specific response in a target cell (e.g., the amount of apoptosis). The specific dose will vary depending on the particular compound selected, the dosing regimen to be followed, whether the compound is administered in combination with other compounds, the time of administration, the tissue to which it is administered, and the physical delivery system carrying the compound.

[0020] In another aspect, there is provided a method of treating cancer in a patient in need thereof, the method comprising administering to the patient a first amount of a compound and a second amount of a KDM5C inhibitor, wherein the first amount and the second amount together constitute a therapeutically effective amount, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor or an mTOR inhibitor.

[0021] In another aspect, there is provided a pharmaceutical composition comprising a compound, a KDM5C inhibitor and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor or an mTOR inhibitor.

[0022] The term "pharmaceutically acceptable" is used to indicate that an object (e.g., a salt, a dosage form [such as a tablet or a capsule] or an excipient [such as a diluent or a carrier]) is suitable for a patient. A list of examples of pharmaceutically acceptable salts can be found in "Handbook of Pharmaceutical Salts: Properties, Selection and Use", edited by P.H. Stahl and C.G. Wermuth, Weinheim / Zurich: Wiley-VCH / VFiCA, 2002 or subsequent editions.

[0023] Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids. Inorganic acids from which the salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid. Organic acids from which the salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. Pharmaceutically acceptable base addition salts can be formed with inorganic bases and organic bases. Inorganic bases from which the salts can be derived include, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum. Organic bases from which the salts can be derived include, for example, primary amines, secondary amines, and tertiary amines, substituted amines (including naturally occurring substituted amines), cyclic amines, and basic ion exchange resins. Examples include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine.

[0024] List of Figures

[0025] Figure 1 : KDM5C was identified as a capivasertib sensitizer in a genome-scale CRISPR screen. In MCF7, T47D, and CAMA-1 ER+ breast cancer cell lines, KDM5C, but no other KDM5 demethylases, was identified as a capivasertib sensitizer.

[0026] [For Figures 2 to 19 ; ns = P>0.05, *= P≤0.05, **= P≤0.01].

[0027] Figure 2 : Cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increased sensitivity to capivasertib in PIK3CA-mut estrogen receptor-positive (ER+) breast cancer.

[0028] Figure 3 : End-of-study confluency from cell proliferation assay in MCF7 KDM5C KO pooled cell lines. KDM5C KO increased sensitivity to capivasertib in PIK3CA-mut ER+ breast cancer.

[0029] Figure 4 : Cell proliferation assay in MCF7 KDM5C KO clone cell lines. KDM5C KO increased sensitivity to capivasertib in PIK3CA-mut ER+ breast cancer.

[0030] Figure 5 : End-of-study confluency from cell proliferation assay in MCF7 KDM5C KO clone cell lines. KDM5C KO increased sensitivity to capivasertib in PIK3CA-mut ER+ breast cancer.

[0031] Figure 6 : Cell proliferation assay in MCF7 KDM5C KO clone cell line. KDM5C KO increased the sensitivity to the combination of fulvestrant and capivasertib in PIK3CA-mut ER+ breast cancer.

[0032] Figure 7 : Cell proliferation assay in MCF7 KDM5C KO clone cell line. KDM5C KO increased the sensitivity to the combination of camizestrant and capivasertib in PIK3CA-mut ER+ breast cancer.

[0033] Figure 8 : End-of-study confluence from cell proliferation assay in MCF7 KDM5C KO clone cell line. KDM5C KO increased the sensitivity to the combination of fulvestrant and capivasertib in PIK3CA-mut ER+ breast cancer.

[0034] Figure 9 : Cell proliferation assay in CAMA-1 KDM5C KO pooled cell line. KDM5C KO increased the sensitivity to capivasertib in PTEN-null ER+ breast cancer.

[0035] Figure 10 : End-of-study confluence from cell proliferation assay in CAMA-1 KDM5C KO pooled cell line. KDM5C KO increased the sensitivity to capivasertib in PTEN-null ER+ breast cancer.

[0036] Figure 11 : Cell proliferation assay in MCF7 KDM5C KO pooled cell line. KDM5C KO increased the sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0037] Figure 12 : End-of-study confluence from cell proliferation assay in MCF7 KDM5C KO pooled cell line. KDM5C KO increased the sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0038] Figure 13 : Cell proliferation assay in MCF7 KDM5C KO clone cell line. KDM5C KO increased the sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0039] Figure 14: Study end confluency from cell proliferation assays in MCF7 KDM5C KO clone cell lines. KDM5C KO increased sensitivity to alpelisib in PIK3CA-mut ER+ breast cancer.

[0040] Figure 15 : Cell proliferation assays in MCF7 KDM5C KO pooled cell lines. KDM5C KO increased sensitivity to everolimus in PIK3CA-mut ER+ breast cancer.

[0041] Figure 16 : Study end confluency from cell proliferation assays in MCF7 KDM5C KO pooled cell lines. KDM5C KO increased sensitivity to everolimus in PIK3CA-mut ER+ breast cancer.

[0042] Figure 17 : Acute KDM5C KO increased sensitivity to capivasertib and its combination with fulvestrant in PIK3CA-mut ER+ breast cancer (MCF7 cells).

[0043] Figure 18 : From Figure 17 Study end confluency of the study.

[0044] Figure 19 : Acute KDM5C KO increased sensitivity to capivasertib in PTEN-null ER+ breast cancer (CAMA1 cells).

[0045] [For Figures 20 to 30 , ns = P>0.05, * = P≤0.05, ** = P≤0.01, *** = P≤0.001].

[0046] Figure 20 : Combination studies in MCF7 (PIK3CA-mut) cells. In PIK3CA-mut ER+ breast cancer, KDM5 inhibitor was combined with capivasertib.

[0047] Figure 21 : Combination studies in CAMA-1 (PTEN null) cells. In PTEN-null ER+ breast cancer, KDM5 inhibitor was combined with capivasertib.

[0048] Figure 22 : Combination studies in MCF7 ESR1 Y537S cells. In PIK3CA-mut ER+ breast cancer cells carrying ESR1 mutation, KDM5 inhibitor was combined with capivasertib.

[0049] Figure 23: Combinatorial studies in MCF7 100F P2 cells. In PIK3CA-mut ER+ breast cancer cells less sensitive to fulvestrant, combination of KDM5 inhibitor and capivasertib.

[0050] Figure 24 : Combinatorial studies in T47D 100F1P P1 cells. In PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant, combination of KDM5 inhibitor and capivasertib.

[0051] Figure 25 : Combinatorial studies in T47D 100F1P P2 cells. In PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant + palbociclib, combination of KDM5 inhibitor and capivasertib.

[0052] Figure 26 : Combinatorial studies in T47D 100F1P P1 cells. In PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant, combination of KDM5 inhibitor and alpelisib.

[0053] Figure 27 : Combinatorial studies in T47D 100F1P P2 cells. In PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant + palbociclib, combination of KDM5 inhibitor and alpelisib.

[0054] Figure 28 : Combinatorial studies in T47D 100F1P P2 cells. In PIK3CA-mut ER+ breast cancer cells resistant to fulvestrant + palbociclib, combination of KDM5 inhibitor and everolimus.

[0055] Figure 29 : Control study showing the effect of fulvestrant in resistant PIK3CA-mut MCF7 ER+ breast cancer cells.

[0056] Figure 30 : Control study showing the effect of fulvestrant in resistant PIK3CA-mut T47D ER+ breast cancer cells. Detailed Description

[0057] Cancer treatment

[0058] In an embodiment, the treatment of cancer is the treatment of animal cancer (e.g., mammalian cancer such as human cancer).

[0059] In embodiments, the cancer is a hormone-sensitive cancer (e.g., estrogen-sensitive cancer or androgen-sensitive cancer). "Estrogen-sensitive or androgen-sensitive" means that the growth of the cancer is at least partially driven by the corresponding hormone pathway such that blocking the hormone attenuates growth and affects treatment.

[0060] In embodiments, the cancer is breast cancer (e.g., advanced breast cancer or metastatic breast cancer).

[0061] In embodiments, the cancer is advanced breast cancer.

[0062] In embodiments, the cancer is metastatic breast cancer.

[0063] In embodiments, the cancer is hormone-sensitive breast cancer.

[0064] In embodiments, the cancer is estrogen-sensitive breast cancer.

[0065] In embodiments, the cancer is ovarian cancer.

[0066] In embodiments, the cancer is estrogen-sensitive ovarian cancer.

[0067] In embodiments, the cancer is endometrial cancer.

[0068] In embodiments, the cancer is estrogen-sensitive endometrial cancer.

[0069] In embodiments, the cancer is prostate cancer.

[0070] In embodiments, the cancer is androgen-sensitive prostate cancer.

[0071] Patient selection and diagnostic methods

[0072] In embodiments, the patient is a human patient or an animal (e.g., mammalian) patient.

[0073] In embodiments, the patient is a human patient.

[0074] In embodiments, the cancer is estrogen receptor positive (ER+) breast cancer.

[0075] "Estrogen receptor positive" cancers include tumors that have estrogen receptors (e.g., in at least 1%, at least 10%, at least 20%, or at least 50% of the tumor cells) and are capable of metabolizing estrogen for growth. The ER+ status can be determined by methods known in the art, such as by IHC testing.

[0076] In embodiments, the cancer is PTEN-deficient (e.g., including cancer cells (e.g., a population of cancer cells, such as the majority of cancer cells in a given population) in which the normal amount [e.g., compared to non-cancerous cells in the same patient] or function of the PTEN tumor suppressor protein is reduced). PTEN status can be determined by methods known in the art.

[0077] In embodiments, the cancer comprises a PIK3CA mutation (e.g., a gain of function mutation, or a deletion, substitution, or insertion mutation, such as PIK3CA E542K PIK3CA E545K PIK3CA Q546R PIK3CA 1047L PIK3CA H1047R Mutation). PIK3CA mutation status can be determined by methods known in the art.

[0078] In an embodiment, the PIK3CA mutation is selected from one or more of the following: R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R.

[0079] In embodiments, the PIK3CA mutation is E545K.

[0080] In embodiments, the patient is a postmenopausal woman or a premenopausal woman.

[0081] Women are adult human females designed to produce large gametes (eggs).

[0082] In embodiments, the patient is a postmenopausal woman.

[0083] In embodiments, the patient is a premenopausal woman.

[0084] In embodiments, the patient has previously been treated with a selective estrogen receptor degrader (SERD), a selective estrogen receptor modulator (SERM), or an aromatase inhibitor (AI).

[0085] In embodiments, the patient's cancer has reached a maximal response stage (minimal residual disease) during or after treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator, or an aromatase inhibitor.

[0086] In embodiments, the cancer is resistant to treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator, or an aromatase inhibitor.

[0087] In an embodiment, the patient's cancer has progressed during or after prior treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator, and / or an aromatase inhibitor. When the growth of the cancer has "progressed", its growth is no longer appropriately controlled by the therapy under discussion.

[0088] In an embodiment, the patient has previously received treatment with a CDK4 / 6 inhibitor.

[0089] In an embodiment, during or after treatment with a CDK4 / 6 inhibitor, the patient's cancer has reached a stage of maximum response (minimal residual disease).

[0090] In an embodiment, the cancer is resistant to treatment with a CDK4 / 6 inhibitor.

[0091] In an embodiment, the patient's cancer has progressed during or after prior treatment with a CDK4 / 6 inhibitor.

[0092] Triplet and quadruplet combinations

[0093] In one embodiment, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor and a SERD, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0094] In an embodiment, the administration of the compound, the KDM5C inhibitor, and the SERD is separate, sequential, or simultaneous.

[0095] In an embodiment, the administration of the compound, the KDM5C inhibitor, and the SERD is separate.

[0096] In an embodiment, the administration of the compound, the KDM5C inhibitor, and the SERD is sequential.

[0097] In an embodiment, the administration of the compound, the KDM5C inhibitor, and the SERD is simultaneous.

[0098] In one embodiment, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0099] In one embodiment, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor and fulvestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0100] In one embodiment, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor and camizestrant or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0101] In one embodiment, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor, a SERD, and a CDK4 / 6 inhibitor, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0102] In embodiments, the administration of the compound, the KDM5C inhibitor, the SERD, and the CDK4 / 6 inhibitor is separate, sequential, or simultaneous.

[0103] In embodiments, the administration of the compound, the KDM5C inhibitor, the SERD, and the CDK4 / 6 inhibitor is separate.

[0104] In embodiments, the administration of the compound, the KDM5C inhibitor, the SERD, and the CDK4 / 6 inhibitor is sequential.

[0105] In embodiments, the administration of the compound, the KDM5C inhibitor, the SERD, and the CDK4 / 6 inhibitor is simultaneous.

[0106] In one embodiment, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof, and palbociclib or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0107] AKT inhibitor

[0108] In embodiments, an AKT inhibitor is any molecule that binds and inhibits the activity of one or more AKT isoforms (e.g., having a pIC 50 ) greater than 4.5, greater than 5, greater than 6, greater than 7, greater than 8, or greater than 9 relative to the isoform in question when tested in a standard potency assay as described, for example, in WO2009 / 047563.

[0109] In embodiments, the AKT inhibitor is a proteolysis-targeting chimera (PROTAC).

[0110] In an embodiment, the AKT inhibitor is selected from miransertib (ARQ-092) or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof.

[0111] In an embodiment, the AKT inhibitor is selected from capivasertib or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and ipatasertib or a pharmaceutically acceptable salt thereof.

[0112] In an embodiment, the AKT inhibitor is selected from capivasertib or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, and ipatasertib (GDC-0068) or a pharmaceutically acceptable salt thereof.

[0113] In an embodiment, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.

[0114] Capivasertib has the following chemical structure:

[0115]

[0116] The chemical name of the free base of capivasertib is known to be (S)-4-amino-N-(1-(4-chlorophenyl)-3-hydroxypropyl)-1-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)piperidine-4-carboxamide). Capivasertib is disclosed in WO2009 / 047563, which discloses capivasertib (in Example 9) and describes its synthesis.

[0117] Perifosine has the following chemical structure:

[0118]

[0119] The chemical name of perifosine is known to be 1,1-dimethylpiperidin-4-yl octadecyl phosphate. Perifosine is disclosed in US8383607. -4-yl octadecyl phosphate. Perifosine is disclosed in US8383607.

[0120] MK-2206 has the following chemical structure:

[0121]

[0122] The chemical name of the free base of MK-2206 is known to be 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl[1,2,4]triazolo[3,4-f][1,6]naphthyridin-3(2H)-one. MK-2206 is disclosed in WO2008070016.

[0123] GSK690693 has the following chemical structure:

[0124]

[0125] The chemical name of the free base of GSK690693 is known to be 4-(2-(4-amino-1,2,5- diazol-3-yl)-1-ethyl-7-{[(3S)-3-piperidinylmethyl]oxy}-1H-imidazo[4,5-c]pyridin-4-yl)-2-methyl-3-butyn-2-ol. GSK690693 is disclosed in WO2007058850.

[0126] Alflotrig (GSK2110183) has the following chemical structure:

[0127]

[0128] The chemical name of the free base of afuresertib is N-[(1S)-2-amino-1-[(3-fluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-thiophenecarboxamide. Afuresertib is disclosed in WO2008098104.

[0129] Upaforesertib (GSK2141795) has the following chemical structure:

[0130]

[0131] The chemical name of the free base of upaforesertib is N-[(1S)-2-amino-1-[(3,4-difluorophenyl)methyl]ethyl]-5-chloro-4-(4-chloro-1-methyl-1H-pyrazol-5-yl)-2-furancarboxamide. Upaforesertib is disclosed in WO2008098104.

[0132] Patasertib has the following chemical structure:

[0133]

[0134] The chemical name of the free base of patasertib is 2-(4-chlorophenyl)-1-(4-((5R,7R)-7-hydroxy-5-methyl-6,7-dihydro-5H-cyclopenta[d]pyrimidin-4-yl)piperazin-1-yl)-3-(isopropylamino)propan-1-one. Patasertib is disclosed in WO2008006040.

[0135] PI3K-α inhibitor

[0136] In an embodiment, the PI3K-α inhibitor is any molecule that binds to and inhibits the activity of PI3K-α (e.g., having a pIC 50 ) greater than >4.5, >5, >6, >7, >8, or >9 relative to PI3K-α when tested in a standard potency assay as described, for example, in WO2010029082.

[0137] In an embodiment, the PI3K-α inhibitor is a PI3K-α selective inhibitor. The PI3K-α selective inhibitor has greater activity against the activity of PI3K-α (e.g., >10-fold, >100-fold, or >1000-fold activity) than against any other PI3K isoform.

[0138] In an embodiment, the PI3K-α inhibitor is selective for one or more PI3K-α mutant isoforms (e.g., H1047X, such as H1047R or H1047L) relative to any other PI3K-α isoform.

[0139] In an embodiment, the PI3K-α inhibitor is a PI3K-α specific inhibitor. A PI3K-α specific inhibitor has activity against PI3K-α, but has no appreciable (e.g., measurable using standard potency assays, e.g., pIC 50 ≤ 4.5) activity against any other PI3K isoform.

[0140] In an embodiment, the PI3K-α inhibitor is selected from LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib (e.g. ) or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof, and serabelisib or a pharmaceutically acceptable salt thereof.

[0141] In an embodiment, the PI3K-α inhibitor is selected from alpelisib (e.g. ) or a pharmaceutically acceptable salt thereof, inavolisib or a pharmaceutically acceptable salt thereof, and serabelisib or a pharmaceutically acceptable salt thereof.

[0142] Alpelisib has the following chemical structure:

[0143]

[0144] The free base of alpelisib is known as the chemical name (2S)-1-N-[4-methyl-5-[2-(1,1,1-trifluoro-2-methylpropan-2-yl)pyridin-4-yl]-1,3-thiazol-2-yl]pyrrolidine-1,2-dicarboxamide. Alpelisib is disclosed in WO2010 / 029082.

[0145] Inavolisib has the following chemical structure:

[0146]

[0147] The free base of inavolisib is known as the chemical name (2S)-2-[[2-[(4S)-4-(difluoromethyl)-2-oxo-1,3- oxazolidin-3-yl]-5,6-dihydroimidazo[1,2-d][1,4]benzoxazepin-9-yl]amino]propanamide. Inavolisib is disclosed in WO2017001645.

[0148] Serabelisib (GDC-0077; RG6114) has the following chemical structure:

[0149]

[0150] The free base of serabelis is known as the chemical name [6-(2-amino-1,3-benz oxazol-5-yl)imidazo[1,2-a]pyridin-3-yl](4-morpholinyl)methanone. Serabelis is disclosed in WO2011022439.

[0151] In an embodiment, the PI3K-α inhibitor is alpelisib or a pharmaceutically acceptable salt thereof.

[0152] In an embodiment, the PI3K-α inhibitor is inalisib or a pharmaceutically acceptable salt thereof.

[0153] In an embodiment, the PI3K-α inhibitor is serabelis or a pharmaceutically acceptable salt thereof.

[0154] mTOR inhibitor

[0155] In an embodiment, the mTOR inhibitor is any molecule that binds to and inhibits the activity of mTOR (e.g., having a pIC 50 ) greater than 4.5, >5, >6, >7, >8, or >9 relative to mTOR when tested in a standard potency assay.

[0156] In an embodiment, the mTOR inhibitor is an mTORC1 inhibitor.

[0157] In an embodiment, the mTOR inhibitor is an mTORC1 selective inhibitor. The mTORC1 selective inhibitor has greater activity against the activity of mTORC1 (e.g., >10-fold, >100-fold, or >1000-fold activity) than against any other mTOR complex.

[0158] In an embodiment, the mTOR inhibitor is selected from everolimus (e.g., ) or a pharmaceutically acceptable salt thereof and temsirolimus (e.g., ) or a pharmaceutically acceptable salt thereof.

[0159] Everolimus has the following chemical structure:

[0160]

[0161] Everolimus is disclosed in WO9409010.

[0162] Temsirolimus has the following chemical structure:

[0163]

[0164] Temsirolimus is disclosed in WO9528406.

[0165] In an embodiment, the mTOR inhibitor is everolimus or a pharmaceutically acceptable salt thereof.

[0166] In an embodiment, the mTOR inhibitor is temsirolimus or a pharmaceutically acceptable salt thereof.

[0167] KDM5C inhibitor

[0168] In an embodiment, the KDM5C inhibitor is any molecule that binds to and inhibits the activity of KDM5C (e.g., having a pIC 50 ) greater than 4.5, greater than 5, greater than 6, greater than 7, greater than 8, or greater than 9 relative to KDM5C when tested in a standard potency assay as described, for example, in WO2015035062, WO2015135094, or WO2016057924.

[0169] In an embodiment, the KDM5C inhibitor is selected from any compound disclosed in WO2015035062, WO2015135094, or WO2016057924.

[0170] In an embodiment, the KDM5C inhibitor is selected from C70 or a pharmaceutically acceptable salt thereof, KDOAM25 (Tumber et al., Cell Chemical Biology 2017, 24, 371–380) or a pharmaceutically acceptable salt thereof, CPI-455 (Vinogradova et al., Nature Chemical Biology 2016, 12, 531–538) or a pharmaceutically acceptable salt thereof, GS-701644 or a pharmaceutically acceptable salt thereof, GS-5801 or a pharmaceutically acceptable salt thereof, and CPI-48 or a pharmaceutically acceptable salt thereof.

[0171] In an embodiment, the KDM5C inhibitor is CPI-48 or a pharmaceutically acceptable salt thereof.

[0172] CPI-48 has the following chemical structure:

[0173]

[0174] The free base of CPI-48 is known as 5-(1-(tert-butyl)-1H-pyrazol-4-yl)-6-isopropyl-7-oxo-4,7-dihydropyrazolo[1,5-a]pyrimidine-3-carbonitrile. CPI-48 is disclosed in Liang, J. et al., Bioorg. & Med. Chem. Lett. 2016, 26(15), 4036-4041 (https: / / doi.org / 10.1016 / j.bmcl.2016.06.078).

[0175] CDK4 / 6 inhibitor

[0176] In embodiments, a CDK4 / 6 inhibitor is any molecule that binds to and inhibits the activities of CDK4 and CDK6 (e.g., having a pIC 50 ) > 4.5, > 5, > 6, > 7, > 8, or > 9 relative to CDK4 and CDK6 when tested in a standard potency assay as described, for example, in WO03062236, WO2010020675, or WO2010075074. In embodiments, the CDK4 / 6 inhibitor is selected from palbociclib (e.g., ) or a pharmaceutically acceptable salt thereof, ribociclib (e.g., ) or a pharmaceutically acceptable salt thereof, and abemaciclib (e.g., ) or a pharmaceutically acceptable salt thereof.

[0177] Palbociclib has the following chemical structure:

[0178]

[0179] The free base of palbociclib is known as 6-acetyl-8-cyclopentyl-5-methyl-2-{[5-(1-piperazinyl)-2-pyridinyl]amino}pyrido[2,3-d]pyrimidin-7(8H)-one. Ribociclib is disclosed in WO03062236.

[0180] Ribociclib has the following chemical structure:

[0181]

[0182] The free base of ribociclib is known as 7-cyclopentyl-N,N-dimethyl-2-{[5-(1-piperazinyl)-2-pyridinyl]amino}-7H-pyrrolo[2,3-d]pyrimidine-6-carboxamide. Ribociclib is disclosed in WO2010020675.

[0183] Abemaciclib has the following chemical structure:

[0184]

[0185] The free base of abemaciclib is known by the chemical name N-{5-[(4-ethyl-1-piperazinyl)methyl]-2-pyridinyl}-5-fluoro-4-(4-fluoro-1-isopropyl-2-methyl-1H-benzimidazol-6-yl)-2-pyrimidinamine.

[0186] Palbociclib is disclosed in WO2010075074.

[0187] In an embodiment, the CDK4 / 6 inhibitor is palbociclib or a pharmaceutically acceptable salt thereof.

[0188] In an embodiment, the CDK4 / 6 inhibitor is ribociclib or a pharmaceutically acceptable salt thereof.

[0189] In an embodiment, the CDK4 / 6 inhibitor is abemaciclib or a pharmaceutically acceptable salt thereof.

[0190] Endocrine therapy

[0191] “Selective estrogen degrader” (SERD) binds to the estrogen receptor, causing its degradation and thus downregulation.

[0192] In an embodiment, the SERD is selected from fulvestrant or a pharmaceutically acceptable salt thereof, amcenestrant or a pharmaceutically acceptable salt thereof, giredestrant or a pharmaceutically acceptable salt thereof, elacestrant or a pharmaceutically acceptable salt thereof, imlunestrant or a pharmaceutically acceptable salt thereof, and camizestrant or a pharmaceutically acceptable salt thereof.

[0193] Amcenestrant (SAR439859) has the following chemical structure:

[0194]

[0195] The free base of amcenestrant is known by the chemical name 6-(2,4-dichlorophenyl)-5-[4-[(3S)-1-(3-fluoropropyl)pyrrolidin-3-yl]oxyphenyl]-8,9-dihydro-7H-benz[7]annulen-2-carboxylic acid. Amcenestrant is disclosed in WO2017140669.

[0196] Camizestrant (AZD9833) has the following chemical structure:

[0197]

[0198] The chemical name of the free base of camizestrant is N-(1-(3-fluoropropyl)azetidin-3-yl)-6-((6S,8R)-8-methyl-7-(2,2,2-trifluoroethyl)-6,7,8,9-tetrahydro-3H-pyrazolo[4,3-f]isoquinolin-6-yl)pyridin-3-amine. Camizestrant is disclosed in WO2018077630A1.

[0199] Elacestrant has the following chemical structure:

[0200]

[0201] The free base of elacestrant is known as the chemical name (6R)-6-[2-(ethyl{4-[2-(ethylamino)ethyl]benzyl}amino)-4-methoxyphenyl]-5,6,7,8-tetrahydro-2-naphthol. Elacestrant is disclosed in WO2008002490.

[0202] Elumetinib (LY-3484356) has the following chemical structure:

[0203]

[0204] The chemical name of the free base of elumetinib is known as (5R)-5-[4-[2-[3-(fluoromethyl)azetidin-1-yl]ethoxy]phenyl]-8-(trifluoromethyl)-5H-chromeno[4,3-c]quinolin-2-ol. Elumetinib is disclosed in WO2020014435.

[0205] Giredestrant (GDC-9545) has the following chemical structure:

[0206]

[0207] The chemical name of the free base of giredestrant is known as 3-[(1R,3R)-1-[2,6-difluoro-4-[[1-(3-fluoropropyl)azetidin-3-yl]amino]phenyl]-3-methyl-1,3,4,9-tetrahydropyrido[3,4-b]indol-2-yl]-2,2-difluoropropan-1-ol. Giredestrant is disclosed in WO2016097072A1.

[0208] In an embodiment, the SERD is fulvestrant or a pharmaceutically acceptable salt thereof.

[0209] In an embodiment, the SERD is amcenestrant or a pharmaceutically acceptable salt thereof.

[0210] In an embodiment, the SERD is giredestrant or a pharmaceutically acceptable salt thereof.

[0211] In an embodiment, the SERD is elacestrant or a pharmaceutically acceptable salt thereof.

[0212] In an embodiment, the SERD is elumelestrant or a pharmaceutically acceptable salt thereof.

[0213] In an embodiment, the SERD is camizestrant or a pharmaceutically acceptable salt thereof.

[0214] A "selective estrogen receptor modulator" (SERM) is a compound that agonizes or antagonizes the estrogen receptor, typically depending on the tissue on which it acts. In an embodiment, the selective estrogen receptor modulator has an anti-estrogenic effect on cancer. In an embodiment, the selective estrogen receptor modulator is selected from tamoxifen (e.g., ) or a pharmaceutically acceptable salt thereof, toremifene (e.g., ) or a pharmaceutically acceptable salt thereof, and raloxifene (e.g., ) or a pharmaceutically acceptable salt thereof.

[0215] In an embodiment, the SERM is tamoxifen or a pharmaceutically acceptable salt thereof.

[0216] In an embodiment, the SERM is toremifene or a pharmaceutically acceptable salt thereof.

[0217] In an embodiment, the SERM is raloxifene or a pharmaceutically acceptable salt thereof.

[0218] An "aromatase inhibitor" is a compound that blocks estrogen biosynthesis. In an embodiment, the aromatase inhibitor is selected from anastrozole (e.g., ) or a pharmaceutically acceptable salt thereof, letrozole (e.g., ) or a pharmaceutically acceptable salt thereof, and exemestane (e.g., ) or a pharmaceutically acceptable salt thereof.

[0219] In an embodiment, the aromatase inhibitor is anastrozole or a pharmaceutically acceptable salt thereof.

[0220] In an embodiment, the aromatase inhibitor is letrozole or a pharmaceutically acceptable salt thereof.

[0221] In an embodiment, the aromatase inhibitor is exemestane or a pharmaceutically acceptable salt thereof.

[0222] Specific combinations

[0223] In one aspect, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor selected from: C70 or a pharmaceutically acceptable salt thereof, KDOAM25 or a pharmaceutically acceptable salt thereof, CPI-455 or a pharmaceutically acceptable salt thereof, GS-701644 or a pharmaceutically acceptable salt thereof, GS-5801 or a pharmaceutically acceptable salt thereof, and CPI-48 or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor selected from: milciclib or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib or a pharmaceutically acceptable salt thereof, uprosertib or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and pactolisib or a pharmaceutically acceptable salt thereof; a PI3K-α inhibitor selected from: LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib or a pharmaceutically acceptable salt thereof, iniparib or a pharmaceutically acceptable salt thereof, and sarecycline or a pharmaceutically acceptable salt thereof; or an mTOR inhibitor selected from: everolimus or a pharmaceutically acceptable salt thereof, and temsirolimus or a pharmaceutically acceptable salt thereof.

[0224] In one aspect, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor selected from the following: milciclib or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, borussertib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib or a pharmaceutically acceptable salt thereof, uprosertib or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and patritumab or a pharmaceutically acceptable salt thereof.

[0225] In one aspect, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is a PI3K-α inhibitor selected from the following: LOXO-783 or a pharmaceutically acceptable salt thereof, RLY-2608 or a pharmaceutically acceptable salt thereof, STX-478 or a pharmaceutically acceptable salt thereof, alpelisib or a pharmaceutically acceptable salt thereof, iniparib or a pharmaceutically acceptable salt thereof, and ceralasertib or a pharmaceutically acceptable salt thereof.

[0226] In one aspect, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an mTOR inhibitor selected from the following: everolimus or a pharmaceutically acceptable salt thereof and temsirolimus or a pharmaceutically acceptable salt thereof.

[0227] In one aspect, a compound for treating cancer is provided, wherein the compound is administered in combination with a KDM5C inhibitor, the KDM5C inhibitor is CPI-48 or a pharmaceutically acceptable salt thereof, and the compound is an AKT inhibitor, the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof; is a PI3K-α inhibitor, the PI3K-α inhibitor is alpelisib or a pharmaceutically acceptable salt thereof; or an mTOR inhibitor, the mTOR inhibitor is everolimus or a pharmaceutically acceptable salt thereof.

[0228] Pharmaceutical compositions and dosage forms

[0229] In one embodiment, a pharmaceutical composition is provided that comprises a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0230] "Pharmaceutically acceptable excipient" includes diluents, disintegrants, or lubricants. In a further embodiment, the pharmaceutical composition comprises one or more pharmaceutical diluents, one or more pharmaceutical disintegrants, or one or more pharmaceutical lubricants.

[0231] In one embodiment, a pharmaceutical composition is provided that comprises a compound, a KDM5C inhibitor, a SERD, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0232] In one embodiment, a pharmaceutical composition is provided that comprises a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0233] In one embodiment, a pharmaceutical composition is provided that comprises a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0234] In one embodiment, a pharmaceutical composition is provided that comprises a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0235] In one embodiment, a pharmaceutical composition is provided that comprises a compound, a KDM5C inhibitor, a SERD, a CDK4 / 6 inhibitor, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0236] In one embodiment, a pharmaceutical composition is provided that comprises a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, or camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

[0237] In one embodiment, a pharmaceutical composition is provided, the pharmaceutical composition comprising a compound, a KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor or an mTOR inhibitor.

[0238] In one embodiment, a pharmaceutical composition is provided, the pharmaceutical composition comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor or an mTOR inhibitor.

[0239] In one embodiment, a pharmaceutical composition is provided, the pharmaceutical composition comprising a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, palbociclib or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is capmatinib or a pharmaceutically acceptable salt thereof.

[0240] In an embodiment, the composition is an oral dosage form.

[0241] In an embodiment, the composition is in the form of a tablet or a capsule.

[0242] In the combinations disclosed in this specification, capmatinib or a pharmaceutically acceptable salt thereof is generally administered to a subject at a daily dose of about 100 mg to about 1600 mg.

[0243] In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 150 mg to about 1500 mg. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 200 mg to about 1400 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 300 mg to about 1300 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 400 mg to about 1200 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 500 mg to about 1100 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered at a daily dose of about 600 mg to about 1000 mg. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered to a subject once daily (QD).

[0244] In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 100 mg to about 1000 mg.

[0245] In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 150 mg to about 900 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 200 mg to about 850 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 250 mg to about 800 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 300 mg to about 750 mg.

[0246] In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 350 mg to about 700 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of about 400 mg to about 650 mg.

[0247] In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered to a subject twice daily (BID). In one embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 50 mg to about 900 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 100 mg to about 875 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 200 mg to about 850 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 250 mg to about 825 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 150 mg to about 250 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 250 mg to about 350 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 350 mg to about 450 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 450 mg to about 550 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 550 mg to about 650 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 650 mg to about 750 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 750 mg to about 850 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 160 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 200 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 240 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 280 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 320 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 360 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 400 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 440 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 480 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 520 mg.In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 560 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 600 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 640 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 680 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 720 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 760 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 800 mg.

[0248] In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered under a continuous dosing schedule. In one embodiment, for example, capmatinib or a pharmaceutically acceptable salt thereof is administered for more than 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, or 56 days. In another embodiment, the dosing cycle is 28 days. Administration of capmatinib or a pharmaceutically acceptable salt thereof and repetition of the dosing cycle can continue as long as it is tolerable and beneficial to the subject.

[0249] In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily (QD) on a continuous dosing schedule. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 100 mg to about 900 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 150 mg to about 875 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 175 mg to about 850 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 200 mg to about 825 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 225 mg to about 800 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 250 mg to about 750 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 275 mg to about 700 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily at a dose of from about 300 mg to about 650 mg on a continuous dosing schedule. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily (BID) on a continuous dosing schedule. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 100 mg to about 800 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 150 mg to about 750 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 200 mg to about 700 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 225 mg to about 650 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 250 mg to about 650 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 300 mg to about 600 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 200 mg to about 300 mg on a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of from about 300 mg to about 400 mg on a continuous dosing schedule.In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 400 mg to about 500 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 500 mg to about 600 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 600 mg to about 700 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 700 mg to about 800 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 160 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 200 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 240 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 280 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 320 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 360 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 400 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 440 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 480 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 520 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 580 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 600 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 640 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 680 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 720 mg under a continuous dosing schedule.In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 760 mg under a continuous dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 800 mg under a continuous dosing schedule. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered to a subject under an intermittent dosing schedule. Administering capmatinib or a pharmaceutically acceptable salt thereof under an intermittent dosing schedule can, for example, have greater efficacy and / or tolerability than under a continuous dosing schedule. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered intermittently according to a 1-day dosing / 6-day drug holiday schedule (i.e., capmatinib or a pharmaceutically acceptable salt thereof is administered for one day, followed by a six-day holiday). In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered intermittently according to a 2-day dosing / 5-day drug holiday schedule (i.e., capmatinib or a pharmaceutically acceptable salt thereof is administered for two days, followed by a five-day holiday). In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered intermittently according to a 3-day dosing / 4-day drug holiday schedule (i.e., capmatinib or a pharmaceutically acceptable salt thereof is administered for three days, followed by a four-day holiday). In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered intermittently according to a 4-day dosing / 3-day drug holiday schedule (i.e., capmatinib or a pharmaceutically acceptable salt thereof is administered for four days, followed by a three-day holiday). In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered intermittently according to a 5-day dosing / 2-day drug holiday schedule (i.e., capmatinib or a pharmaceutically acceptable salt thereof is administered for five days, followed by a two-day holiday). In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered intermittently according to a 6-day dosing / 1-day drug holiday schedule (i.e., capmatinib or a pharmaceutically acceptable salt thereof is administered for six days, followed by a one-day holiday). The dosing cycle of such an embodiment will then be repeated as long as it is tolerable and beneficial for the subject. In an embodiment, the dosing cycle is 7 days. In an embodiment, the dosing cycle is 14 days. In another embodiment, the dosing cycle is 21 days. In another embodiment, the dosing cycle is 28 days. In another embodiment, the dosing cycle is two months. In another embodiment, the dosing cycle is six months. In another embodiment, the dosing cycle is one year.

[0250] In an embodiment, the dosing cycle is 28 days, but capmatinib or a pharmaceutically acceptable salt thereof is not co-administered to the subject during the fourth week of the dosing cycle (i.e., there is a drug holiday of capmatinib or a pharmaceutically acceptable salt thereof during the last week of the dosing cycle).

[0251] In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily (QD) on an intermittent dosing schedule. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 100 mg to about 900 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 150 mg to about 850 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 175 mg to about 800 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 200 mg to about 750 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 225 mg to about 725 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 250 mg to about 700 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 275 mg to about 675 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered once daily on an intermittent dosing schedule at a dose of about 300 mg to about 650 mg. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily (BID) on an intermittent dosing schedule. In an embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 100 mg to about 800 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 150 mg to about 750 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 200 mg to about 700 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 225 mg to about 675 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 250 mg to about 650 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 300 mg to about 625 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 200 mg to about 300 mg. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily on an intermittent dosing schedule at a dose of about 300 mg to about 400 mg.In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 400 mg to about 500 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 500 mg to about 600 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 600 mg to about 700 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 700 mg to about 800 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 160 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 200 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 240 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 280 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 320 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 360 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 400 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 440 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 480 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 520 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 580 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 600 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 640 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 680 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 720 mg under an intermittent dosing schedule.In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 760 mg under an intermittent dosing schedule. In another embodiment, capmatinib or a pharmaceutically acceptable salt thereof is administered twice daily at a dose of about 800 mg under an intermittent dosing schedule.

[0252] In any embodiment where a commercially available or approved drug is mentioned, the commercially available or approved drug can be administered according to its dosing instructions (e.g., as approved by the US FDA or any other similar regulatory agency).

[0253] In any embodiment where a drug studied in human trials is mentioned, the drug can be administered according to the dosing regimen described in any of its publicly available clinical trial protocols (e.g., as described on clinicaltrials.gov or the like).

[0254] Examples

[0255] The following specific examples with reference to the accompanying drawings are provided for illustrative purposes only and should not be construed as limiting the teachings herein.

[0256] Example 1: Cell line generation

[0257] 1A. HEK-293T cell line: HEK-293T is an epithelial-like cell line isolated from human embryonic kidney and expressing large T antigen. This cell line was purchased from GeneHunter Corporation (catalog number Q401) and used for virus production. HEK-293T cells were routinely cultured in DMEM medium supplemented with 10% fetal bovine serum (FCS) and 1% L-glutamine and incubated at 37 °C, 5% CO2.

[0258] 1B Cas9 lentivirus production. HEK-293T cells were seeded in 75 cm 2 flasks pre-coated with 0.1% gelatin. 2 Number of HEK-293T cells per 75 cm 2 flask: 8,000,000 cells (1x75 cm

[0259] Table 1: Transfection mixture

[0260] Component Amount per flask Opti-MEM 4ml Lentiviral transfer vector 7.2 μg psPAX2 7.2 μg pMG2.G 1.6 μg PLUS reagent 16 μL Lipofectamine LTX 48 μL

[0261] Then, Lipofectamine LTX was added to the solution containing DNA and mixed by pipetting or vortexing for 2 seconds. The resulting solution was incubated at room temperature for 30 minutes. The old medium was aspirated, and the cells were washed once with 10 mL of Opti-MEM medium. Then, 7 mL of Opti-MEM was added to a 75-cm 2 flask, and then the DNA / Lipofectamine complex was added using a pipette and vortexed very gently. Finally, the contents of the container were incubated at 37 °C for 6 hours, and the transfection medium was replaced with 30 mL of DMEM medium containing 10% FCS and 2% glutamine. After 48 hours (day 2), the Cas9 lentiviral supernatant was collected using a 10 mL syringe (3 syringes in total) and filtered through a 0.45 μm filter cartridge. The HEK-293T plate was discarded appropriately according to the risk assessment. The Cas9 lentiviral supernatant was aliquoted into 1.5 mL cryovials (400 μL per cryovial, 75 cryovials in total) for storage at -80 °C.

[0262] 1C. T-47D stable cell line expressing spCas9: T-47D is a cell line derived from intrapleural fluid / exudate obtained from a patient with breast ductal carcinoma (also referred to as T47D herein). This cell line was obtained from ATCC HTB-133 and carries an activating mutation in PIK3CAE545K. T47D cells were routinely cultured in RPMI medium (Gibco#11835-063) supplemented with 5% fetal bovine serum (FCS) and 1% L-glutamine and incubated at 37 °C, 5% CO2. T47D cells constitutively expressing spCas9 were prepared in 6-well plates using the following protocol:

[0263] 1. The lentivirus was taken out of the -80 °C freezer and thawed at room temperature.

[0264] 2. A virus transduction mixture was prepared in a 1.5 mL Eppendorf tube. For each cell line,

[0265] the Cas9 mixture and the virus-free control mixture were prepared as described below.

[0266] Table 2. The table outlines the transduction volume required per well.

[0267] Transduction conditions Volume of medium Volume of polybrene (40 μg / mL stock solution) Volume of Cas9 virus Cas9 650 μL 200 μL 150 μL Virus-free control 800 μL 200 μL -

[0268] 3. Seed 100,000 cells in 1 mL of medium per well in a 6-well plate (set up three wells for each cell line). Two wells for each cell line (T47D) - one well is labeled "Cas9" and the other well is labeled "virus-free control".

[0269] 4. Immediately after seeding the cells, add 1 mL of transduction mixture (Cas9 or virus-free control) to each well of the cells. Gently shake the 6-well plate to mix and place it in the incubator.

[0270] 5. At 24 hours post-transduction, remove the medium containing rvirus from each well and replace it with 3 mL of fresh medium.

[0271] 6. At 72 hours post-transduction, transfer all the cells (Cas9 or virus-free control) from each well

[0272] to a T75 flask with blasticidin selection (using 40 μg / mL blasticidin).

[0273] 7. Select the cells with blasticidin until no live cells remain in the virus-free control flask. If the cells become confluent during selection, transfer them to a T175 and continue blasticidin selection.

[0274] 8. After completing blasticidin selection of the Cas9 cell line, expand the cells for at least one week before testing Cas9 activity.

[0275] Determine the Cas9 activity of the new Cas9 cell line using a reporter gene assay. The Cas9 activity assay consists of two separate lentiviral vectors. Introduce an sgRNA targeting GFP into the cell line using a lentivirus (pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W) labeled with BFP and GFP. In the absence of functional Cas9, cells transduced with this lentivirus will express BFP and GFP. However, in the presence of Cas9, the gRNA will target GFP and the cells will no longer express GFP (BFP+GFP-). The activity of Cas9 in the cells is the fraction of transduced cells that are BFP positive but GFP negative. Cas9 cells transduced with a control reporter virus (pKLV2-U6gRNA5(empty)-PGKBFP2AGFP-W) should express BFP and GFP. The total number of transduced cells is determined as: BFP+-GFP+ double-positive cells plus BFP+ cells. Determine the Cas9 activity (%) in a large cell population from (BFP+ positive cells) / (total number of transduced cells). Determine the Cas9 activity in T-47D cells constitutively expressing spCas9 in a 6-well plate using the following protocol:

[0276] 1. Remove the lentivirus from the -80°C freezer and thaw it at room temperature.

[0277] 2. Prepare the virus transduction mixture in 1.5 mL Eppendorf tubes as described in Table 3. For each cell line, prepare three separate mixtures: 1) BFP-GFP (empty), 2)

[0278] BFP-GFP (gRNA GFP) and 3) virus-free control.

[0279] Table 3. The table outlines the transduction volume required per well (in 6-well plates)

[0280]

[0281] 3. Seed 100,000 cells in each well of a 6-well plate in 1 mL of medium per well (three wells are set up for each cell line).

[0282] 4. Immediately after seeding the cells, add 1 mL of the transduction mixture (BFP-GFP empty, BFP-GFP gRNA GFP, and virus control) to each well of the cells. Gently rock the 6-well plate to mix and place it in the incubator.

[0283] 4. Twenty-four hours after transduction, remove the medium containing the virus from each well and replace it with 3 mL of fresh medium.

[0284] 5. Seventy-two hours after transduction, fix the cells and measure BFP-GFP expression (BFP-GFP empty, BFP-GFP gRNA GFP, and virus control) by flow cytometry on a MaxQuant VYB

[0285] (Cambridge Institute Flow cytometry facility). "Virus-free control" cells are used to gate BFP-GFP negative cells.

[0286] 6. For each cell line, Cas9 activity is calculated as: Cas9 activity (%) in the large cell population = (BFP+ positive cells) / (total number of transduced cells).

[0287] 7. Expand the cell lines with Cas9 activity higher than 75% into a stock solution.

[0288] 1D. MCF7 Stable Cell Line Expressing spCas9: MCF7 is a cell line derived from intrapleural fluid / exudate obtained from a breast ductal carcinoma patient. This cell line was obtained from ATCC HTB-22 and carries an activating mutation in PIK3CA E545K. MCF7 cells were routinely cultured in RPMI medium (Gibco#11835-063) supplemented with 5% fetal bovine serum (FCS) and 1% L-glutamine and incubated at 37 °C, 5% CO2. The MCF7 cell line from ATCC HTB-22 was used Figure 20 in this study. An MCF7 stable cell line expressing spCas9 was prepared by a method similar to that of 1B, but cells were selected using 10 μg / mL blasticidin.

[0289] 1E. CAMA-1 Stable Cell Line Expressing spCas9: CAMA-1 is a cell line derived from intrapleural fluid / exudate obtained from a breast adenocarcinoma patient. This cell line was obtained from ATCC HTB-21 and has a loss-of-function mutation in PTEN D92H / F278fs. CAMA-1 cells were routinely cultured in RPMI medium (Gibco#11835-063) supplemented with 5% fetal bovine serum (FCS) and 1% L-glutamine and incubated at 37 °C, 5% CO2. A CAMA1 stable cell line expressing spCas9 was prepared by a method similar to that of 1B, but cells were selected using 25 μg / mL blasticidin.

[0290] 1F. MCF7 ESR1 Y537S (mut / - / -) cell line: The MCF7 ESR1 Y537S (mut / - / -) cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in Example 1D. Cells were transfected using Fugene (Promega) with the sgRNA CAS9 T2AGFP vector and the donor vector with the neomycin cassette as the non-digested plasmid at a ratio of 2:1. The gRNA sequence was ctccagcagcaggtcataga [SEQ_ID 35]. The donor cassette contained 800bp and 1kb homology regions for incorporation of the Y537S mutation via homology-directed repair (HDR). Between the homology regions, the neomycin resistance gene was encoded, which was expressed under the PKG promoter and used to select for HDR events 48 hours after transfection. Two weeks after selection, single-cell clones were generated and characterized. To confirm the knock-in, digital droplet PCR was performed using ddPCR primers (Fwd: AAGGCATGGAGCATCTGT [SEQ_ID 1] & Rev: GCTAGTGGGCGCATGTA [SEQ_ID 2]) and specific probes (C{C}CTC{TAT}GACC{T}G [SEQ_ID 3] and CTC{T}AT{GGC}C{T}GC [SEQ_ID 4]). The location of the insertion was confirmed using ligation PCR with the following primer pairs: Fwd TTAGATCATGCTGTAGGCCCTG [SEQ_ID 5] & Rev CTGGAACCCATGACCGGAAAG [SEQ_ID6], Fwd GCAGATCCAGGGGGCATTTA [SEQ_ID 7] & Rev GATGTGGAATGTGTGCGAGC [SEQ_ID 8] and Fwd GGATCAATTCTCTAGAGCTCGC [SEQ_ID 9] & Rev CTGGAACCCATGACCGGAAAG [SEQ_ID 6]. TIDE analysis was used to confirm the frameshift mutation of the second ESR1 allele. Targeted locus amplification (TLA) sequencing (de Vree et al. 2014) confirmed the genotypes of the 3 ESR1 alleles (knock-in, single-base insertion knockout, and inactivated 48bp deletion; mut / - / -).

[0291] 1G. MCF7 100F P2 cell line: The MCF7 100F P2 cell line was generated from the parental ATCC HTB-22 stock. Cells were cultured as described in Example 1D. To set up the initial treatment flask, the medium was removed from the T175 flask, the cells were washed with 10 mL DPBS, and 2 mL of trypsin was added to detach the cells. Once detached, the cells were resuspended in 10 mL of growth medium and used with trypan blue and CountessTM Counted using a Countess cell counter (ThermoFisher). Then, 10 mL of cells at 3.0 x 10 4 / mL were added to 3 x T25 flasks, with 1 flask dosed with DMSO to measure the growth of the resistant cell pool relative to cells in the same % DMSO, while 2 flasks were dosed with fulvestrant to generate a resistant pool. The cells were transferred to an incubator to adhere overnight. The cells were initially dosed with 30 nM fulvestrant, with the intention of ramping up to 100 nM once the cells began to grow. The medium in the flasks was removed and replaced with 10 mL of medium containing fulvestrant (2.2 μL of 300 μM fulvestrant stock solution was added to 22 mL of growth medium, a 1:10,000 dilution to give a final product of 30 nM). The cells were re-dosed twice a week. After one week, the cells began to grow and the fulvestrant concentration was increased to 100 nM. The cells were re-dosed twice a week for 15 days. After that, the cells were expanded to generate a stock solution for cryopreservation.

[0292] 1H.T47D 100F1P P1 and T47D 100F1P P2 cell lines: The T47D 100F1P P1 and P2 cell lines were generated from the parental ATCC HTB-133 stock. Cells were cultured as described in Example 1C. To set up the initial treatment flasks, the medium was removed from the T175 flask, the cells were washed with 10 mL of DPBS, and 2 ml of trypsin was added to detach the cells. Once detached, the cells were resuspended in 10 mL of growth medium and counted using trypan blue and a Countess TM cell counter (ThermoFisher). Then, 10 mL of cells at 2.0 x 10 4 / ml cells were added to 3 x T25 flasks. One flask was dosed with DMSO to measure the growth of the resistant cell pool relative to cells in the same % DMSO, while 2 flasks were dosed with 30 nM fulvestrant and 300 nM palbociclib to generate a resistant pool. The cells were transferred to an incubator to adhere overnight. The cells were initially dosed with 30 nM fulvestrant and 300 nM palbociclib, with the intention of ramping up to 100 nM fulvestrant / 1 μM palbociclib once the cells started growing. The medium in the flasks was removed and replaced with 10 mL of medium containing fulvestrant / palbociclib (fulvestrant: 2.2 μL of 300 μM fulvestrant stock solution was added to 22 mL of growth medium, diluted 1:10,000 to get a final product of 30 nM / palbociclib: 2.2 μL of 3 mM stock solution was added to 22 mL of growth medium, diluted 1:10,000 to get a final product of 300 nM). The cells were redosed twice a week and maintained for 6 months as they grew slowly from a small viable cell fraction. The cells were expanded into T75 flasks and the dose was ramped up to 100 nM fulvestrant + 1 μM palbociclib. Subsequently, the cells were expanded for 40 days to generate a stock solution for cryopreservation.

[0293] 1 I.MCF7 KDM5C KO clone A9 cell line: KO of KDM5C was performed in parental MCF7 breast cancer cells. A KDM5C KO pool was established by RNP delivery of spCas9 protein and the following guide:

[0294] 1. Prepare guide RNA (gRNA) by combining crRNA and tracrRNA in a PCR tube (Table 4) incubated at 95 °C for 5 min in a thermocycler and allowing it to cool to room temperature.

[0295] Double-strand.

[0296] Table 4: Volumes for gRNA duplex preparation

[0297] Component Amount (μL) 200 μM crRNA 5'-CTGAGCCGGCATCTGCACATGGG-3' [SEQ_ID 10] 1 200 μM tracrRNA 1.1 IDT duplex buffer 2.8 Total volume 5

[0298] 2. Dilute recombinant spCas9 protein according to the following:

[0299] Table 5: Volumes for spCas9 preparation

[0300] Component Amount (μL) Cas9 (10 μg / μL) = 63 μM 2 R buffer 1.33 Total volume 3.33

[0301] 3. Generate a crRNA:tracrRNA:Cas9 RNP complex by mixing the gRNA double-strand and recombinant spCas9 in a low-binding tube. Incubate the mixture at room temperature for 15 min until the solution becomes clear.

[0302] Table 6: Volumes for RNP complex preparation

[0303] Component Amount (μL) crRNA:tracrRNA duplex 2 Diluted Cas9 2 Total volume 4

[0304] 4. Prepare a single-cell suspension of MCF7 cells for Neon electroporation as follows: Wash the cells with PBS, separate with solution, and resuspend in the medium. Resuspend 5x10 5 cells in 10.8 μL of Neon Buffer R for electroporation.

[0305] 5. Prepare the electroporation mixture according to Table 7. Collect 10 mL of the mixture with a Neon 10 μL tip and place it in the Neon TM Transfection System (Thermo Scientific), avoiding the formation of air bubbles. The program is 1250 volts, 20 milliseconds, 2 pulses for electroporation.

[0306] Table 7: Volumes for electroporation reaction.

[0307] Component Amount (μL) crRNA:tracrRNA:Cas9 RNP complex from Table 6 1.2 Cell suspension 10.8 100 μM electroporation enhancer (*) 0.6 Total volume 12.6

[0308] (*) Electroporation enhancer or carrier Oligo-IDT enhancer CCA GCA GAA CAC CCC CAT CGG CGACGGCCC CGT GCT GCT GCC CGA CAACCA CTA CCT GAG CAC CCA GTC CGCCCT GAG CAA AGA CCCCAA CGA GA [SEQ_ID 11]

[0309] 6. Immediately after electroporation, place the cells on a 12-well tissue culture plate containing 1 mL of medium. Place 100 μL aliquots on a 24-well plate for genomic DNA extraction and KO validation by TIDE.

[0310] 7. After 48 hours, remove the medium from the 24-well plate, wash the cells with PBS, and extract the DNA with 80 μL of DirectPCR Lysis Buffer (Viagen BioTech) according to the manufacturer's protocol.

[0311] 8. To generate amplicons suitable for TIDE analysis of KO efficiency, design primers around the guide RNA binding site (PCR product size 307 bp). Prepare the PCR reaction mixture using the following: 7.5 μL of H2O, 10 μL of 2x PhusionMix, 0.5 μL of forward primer (5'-CGATCTGCCATACCCAGGAC-3', [SEQ_ID 12], 10 mM),

[0312] 0.5 mL reverse primer (5'-AGCCCAGTCATTCCCTCTCT-3', [SEQ_ID 13], 10 mM); 1.5 mL genomic DNA. Amplification was carried out using the following conditions: i. 98 °C for 1 minute. ii. 30 cycles: 98 °C for 5 seconds, 65 °C for 5 seconds, 72 °C for 10 seconds. iii. 72 °C for 1 minute.

[0313] 9. The PCR products were verified using a 1% agarose gel, purified using the GFX Illustra PCR Purification Kit (Cytiva), and Sanger sequenced using the forward primer. The gene editing efficiency in the target region was evaluated using TIDE analysis (efficiency of the pool was 64.7%).

[0314] 10. Four days after electroporation, use the platform (Scienion) to complete single-cell cloning of the MCF7

[0315] KDM5C KO pool.

[0316] 11. Single-cell suspensions were obtained by washing the cells with PBS and separating them with solution. 100 μL of the single-cell suspension was transferred to an Eppendorf tube and diluted with up to 500 μL of PBS. The cell suspension was mixed by gently pipetting up and down, and 50 μL was loaded into a 384-well sciSource plate (Scienion).

[0317] 12. The single-cell clones were embossed into a 384-well tissue culture plate (Corning) together with 50 μL of 30% conditioned medium (pre-allocated using a Multidrop Combi) as follows:

[0318] Load the samples into CellenONE, plot to determine the appropriate radius / elongation rate parameters for sorting, and use the CellenONE basic Destatic target program for embossing.

[0319] 13. At time zero and then every 7 days, clone growth was analyzed using Cell Metric (Solentin), and the conditioned medium was updated once a week.

[0320] 14. By performing TIDE analysis of the Sanger sequencing traces as described above, we verified the high percentage of KDM5C KO in the growing single-cell clones: PCR products with primers located around the guide RNA binding site were generated as described above and Sanger sequenced; the sequencing traces were compared to the wild-type sequence using TIDE.

[0321] 15. Then, anti-KDM5C antibody (Abcam, ab190180 – diluted 1:1000) and anti-Vinculin (Cell Signalling, #13907 – diluted 1:1000) antibodies were used as loading controls to analyze the depletion of KDM5C protein in clones with high TIDE efficiency (>85%) and no in-frame indels by Western blotting.

[0322] Example 2: Pooled CRISPR knockout screening

[0323] The experiments in this example have been conducted to identify genes that regulate the response to capesicitinib after gene knockout in ER+ breast cancer cells. A genome-wide pooled CRISPR knockout screen was performed in MCF7, CAMA-1, and T47D stable cell lines expressing spCas9, which led to the identification of KDM5C as a capesicitinib sensitizer in all three cell lines.

[0324] Resuscitate cell lines from frozen stock prior to screening, culture with 1% Pen / Strep, and reselect with blasticidin as described in Example 1C, Example 1D, and Example 1E. Seed a total of 120,000,000 cells (T47D / MCF7) or 200,000,000 cells (CAMA-1) in 5-layer stacks (Corning #CLS3319-2EA) and transduce with the YusaV3 human lentiviral library at a multiplicity of infection (MOI) of approximately 0.3 and a coverage of at least 150x (human-improved whole-genome knockout CRISPR library) using polybrene, repeating twice. Change the medium the next day and culture the cells for 2 days. Then select the transduced cells with puromycin (2 μg / mL) and expand to maintain a representation of approximately 750x. Monitor the transduction efficiency by analyzing the % of BFP-positive cells with FACS Melody. After selection, pool and count the cells, keeping the replicates separate. Using 5-layer stacks, resuspend each replicate in a batch with a total volume of 625 mL, 100,000,000 cells for MCF7 / T47D and 150,000,000 cells for CAMA-1. Treat the batches with DMSO or capesertib, 750 nM for MCF7 / T47D and 400 nM for CAMA-1. Also prepare pellets with approximately 50,000,000 cells and freeze as baseline measurements. Then, culture the cells by continuous passaging and reseeding 100,000,000 cells (MCF7 / T47D) and 150,000,000 cells (CAMA-1) until the end of screening. Treat the cells with fresh compound twice a week (or every 3 - 4 days). After 24 days for MCF7, 23 days for T47D, and 29 days for CAMA-1, harvest the cells and pellet for genomic DNA extraction.

[0325] For preparation and generation for deep sequencing For the library, genomic DNA was extracted using the QiAMP Blood DNA MAxi Kit (Qiagen, #51194), and the sgRNA cassette was amplified by PCR using Q5 Hot Start High-Fidelity 2x MasterMix and primers specific to the lentiviral CRISPR backbone for sgRNA. The PCR product was purified using the QIAquick PCR Purification Kit. During this amplification step, Illumina 5' and 3' adapters were added to the 5' and 3' ends of the sgRNA cassette. Ideally, we aimed to use an amount of DNA corresponding to 200x coverage of the pooled sgRNA library for the first PCR (150 μg / sample for the Yusa V3 CRISPR library). A second PCR was performed to add Illumina indexes to the gRNA library and to allow pooling of individual samples for sequencing (barcodes for demultiplexing). The second PCR was carried out using the Kapa HiFi HotStart mix and the compatible dual-indexed DNA-seq 48 Dual Index Kit (Takara #R400406). The PCR product was purified using AMPure XP beads. DNA concentration was measured using Qubit (HS ds DNA Kit) and the quality was confirmed in a Bioanalyzer with a high-sensitivity DNA chip. Up to 6 libraries were pooled to a final concentration of 10 nM - 15 nM in a total volume of 20 μL and submitted for sequencing.

[0326] Figure 1 The results in

[0327] Example 3: Arrayed CRISPR knockout experiments

[0328] were generated from sequencing data by determining the gRNA counts of 6x sgRNAs in the Yusa V3 human library targeting KDM5A, KDM5B, KDM5C, and KDM5D in each sample. The figure plots the fold change in gRNA counts between cells treated with capesertib and DMSO control. The data show that gRNAs targeting the KDM5C gene, but not KDM5A, KDM5B, or KDM5D, were significantly depleted when MCF7, T47D, and CAMA-1 cells were treated with capesertib compared to DMSO. Thus, the results indicate that loss of KDM5C sensitizes MCF7, T47D, and CAMA-1 cells to capesertib.Experiments were conducted in this example to verify KDM5C as a drug sensitizer in ER+ breast cancer cells. KDM5C was knocked out in ER+ breast cancer cell lines generated by different methods, and proliferation assays were performed to determine whether the loss of KDM5C reduced cell growth and increased the anti-proliferative effects of capesertib, fulvestrant in combination with capesertib, alpelisib, and everolimus.

[0329] 2A. CRISPR knockout of KDM5C using gRNA lentiviral expression vectors. The experiment involved three main steps: (1) cloning gRNAs targeting KDM5C into an expression vector to generate KDM5C gRNA lentiviruses; (2) generating and validating KDM5C-knockout ER+ breast cancer cell lines (CAMA-1, T47D, MCF7) with the lentiviruses; and then (3) performing proliferation assays to compare KDM5C knockout with DMSO (control), capesertib, alpelisib, and everolimus and wild-type ER+ breast cancer cells with DMSO (control), capesertib, alpelisib, and everolimus.

[0330] 1. Generation of CRISPR gRNA lentiviral expression vectors:

[0331] The KDM5C guide RNA (gRNA) was cloned into the Yusa CRISPR lentiviral expression vector according to the following protocol, which describes how to synthesize individual gRNAs and clone them into the CRISPR lentiviral single-guide RNA (sgRNA) expression vector to target a single genomic locus. These vectors can then be transfected into HEK-293T cells to generate infectious sgRNA lentiviruses for transduction into human or mouse cells to generate a heterogeneous cell population with a mixture of CRISPR-induced indels, called a knockout cell pool. The knockout efficiency in the cell pool is typically 80%-90%. Once the knockout (KO) efficiency in the pool has been analyzed, the cells can be immediately used for assays while still in the heterogeneous population.

[0332] Table 8: List of materials for generating lentiviral expression vectors

[0333]

[0334] Table 9: Lentiviral CRISPR sgRNA vectors

[0335]

[0336] gRNA and oligonucleotide design: Six gRNAs targeting the KDM5C gene were selected from the V3 Yusa CRISPR knockout gRNA library. The gRNA oligonucleotides described in Table 10 were ordered from IDT in 100 nM ready-to-use solution (standard desalting). The oligonucleotides of the gRNAs were designed to have the following configuration:

[0337] Forward oligonucleotide: 5'CACCG---19bp gRNA---3'

[0338] Reverse oligonucleotide: 5'AAAC---19bp gRNA---C 3'

[0339] Example:

[0340] Genome: 5'-tggcgtgTAAGAGAGCATCATGGGCCACGGcagagaa-3'[SEQ_ID 14]

[0341] Guide RNA: 5'-GAAGAGAGCATCATGGGCCA-3'[SEQ_ID 15]

[0342] Forward oligonucleotide: 5'-CACCGAAGAGAGCATCATGGGCCA-3'[SEQ_ID 16]

[0343] Reverse oligonucleotide: 3'-CTTCTCTCGTAGTACCCGGTCAAA-5'[SEQ_ID 17]

[0344] The forward oligonucleotide and the reverse oligonucleotide pair with each other and generate two overhangs (5'CACC and 5'AAAC), which can be ligated to the linearized (BbsI) gRNA expression vector. The two oligonucleotides are designed as reverse complements because they are cloned into the vector as an annealed oligonucleotide pair.

[0345] Table 10: KDM5C gRNA sequences

[0346] Name KDM5C gRNA sequence (+5'CACC & 5'AAAC) KDM5C_v3_6-1gRNA 1 forward CACCGCGGCACCTAACCCCCGAAG [SEQ_ID 18] KDM5C_v3_6-2_gRNA 2 forward CACCGATCCCCTCGAGAACACATC [SEQ_ID 19] KDM5C_v3_6-3_gRNA 3 forward CACCGCGCAGGTACTGCCGGCTAC [SEQ_ID 20] KDM5C_v3_6-4_F gRNA 4 forward CACCGTCCAAGGTATACCGATACC [SEQ_ID 21] KDM5C_v3_6-5_F gRNA 5 Forward CACCGGGCTACCCGAGCCCACCGA[SEQ_ID 22] KDM5C_v3_6-6_F gRNA 6 Forward CACCGTCGTAGTGGGAGCGTAGCA[SEQ_ID 23] KDM5C_v3_6-1_R gRNA 1 Reverse AAACCTTCGGGGGTTAGGTGCCGC[SEQ_ID 24] KDM5C_v3_6-2_R gRNA 2 Reverse AAACGATGTGTTCTCGAGGGGATC[SEQ_ID 25] KDM5C_v3_6-3_R gRNA 3 Reverse AAACGTAGCCGGCAGTACCTGCGC[SEQ_ID 26] KDM5C_v3_6-4_R gRNA 4 Reverse AAACGGTATCGGTATACCTTGGAC[SEQ_ID 27] KDM5C_v3_6-5_R gRNA 5 Reverse AAACTCGGTGGGCTCGGGTAGCCC[SEQ_ID 28] KDM5C_v3_6-6_R gRNA 6 Reverse AAACTGCTACGCTCCCACTACGAC[SEQ_ID 29]

[0347] Vector linearization and cloning of gRNA into the CRISPR lentiviral expression vector:

[0348] The CRISPR gRNA expression vector was linearized with the restriction enzyme BbsI according to the manufacturer's instructions (New England Biolabs; NEB). The linearized vector was separated by agarose gel, purified from the gel and quantified using NanoDrop (Thermo Fisher). The concentration was adjusted to 20 ng / μL. The gRNA oligonucleotide cloning starts with the phosphorylation and annealing of the forward oligonucleotide and the reverse oligonucleotide. For this purpose, the components described in Table 11 were mixed in a PCR tube strip. The strip was placed in a PCR machine to run the program: starting from 37°C for 30 minutes; then 95°C for 50 minutes; decreasing to 25°C at 0.1°C / second.

[0349] Table 11: Phosphorylation and annealing reactions of sgRNA oligonucleotides.

[0350] Component Volume 100 μM Top strand oligonucleotide 1 μL 100 μM Bottom strand oligonucleotide 1 μL 10x T4 Ligation Buffer 1 μL T4 PNK 0.5 μL Nuclease-free water 6.5 μL

[0351] To ligate double-stranded oligonucleotides (ds-oligos) to the vector, they were first diluted on ice in EB buffer (Qiagen) as follows:

[0352] · First dilution (142 fmol / μL): 139 μL of Eb buffer + 2 μL of 10 μM ds-oligos

[0353] · Second dilution (7.1 pmol / μL): 57 μL of Eb buffer + 3 μL of the first dilution

[0354] The ligation reaction was carried out by mixing the volumes described in Table 12 in a PCR tube on ice. A negative control (linearized CRISPR vector without annealed oligonucleotides) was prepared by adding 2 μL of nuclease-free water instead of ds-oligo. The annealed oligonucleotides were ligated into the vector by incubating the linearized vector / oligonucleotide mixture at 16 °C for 4 hours to overnight.

[0355] Table 13: Ligation reaction of ds-oligonucleotide with the vector.

[0356] Component Volume 20 ng / μL Linearized lentiviral vector 1 μL (= 3.7 fmol) 7.1 fmol / μL ds-oligo 2 μL (= 14.2 fmol) 10x T4 DNA Ligase Buffer (B0202S) 1 μL T4 DNA Ligase (NEB M0202S) 1 μL Nuclease-free water 5 μL

[0357] To transform bacteria with the ligated vector, 5 μL of the ligation mixture was placed in a 1.5 mL microtube and kept on ice. 50 μL of DH5α chemically competent cells were added to the tube and vortexed with the ligation mixture for 1 second. The mixture was incubated on ice for 10 minutes and immediately placed in a heat shock at 42 °C for 30 seconds. Then the bacterial mixture was incubated on ice for an additional 2 minutes. Next, 400 μL of S.O.C. medium was added to the transformed bacteria and incubated in a shaking incubator at 37 °C for 30 minutes. The transformed bacteria were plated on an LB agar plate with ampicillin antibiotic and incubated overnight at 37 °C. The next day, the colony growth on the plates was examined, and it was confirmed that there was no colony growth on the negative control plate (ligating the linearized CRISPR vector without annealed sgRNA oligonucleotides). Two colonies were picked for each KDM5C gRNA construct using a sterile pipette and placed in 2 mL of 2xTY medium (+ ampicillin, 50 μg / ml) in a 15-ml falcon tube. The bacteria were incubated at 37 °C in an orbital shaker for 14 - 16 hours. Then, the bacterial culture was centrifuged at 4000 rpm for 10 minutes and the supernatant was discarded. Plasmids were isolated using the Qiagen mini-prep kit according to the manufacturer's instructions and eluted into 50 μL of EB buffer. DNA concentration was measured using NanoDrop (Thermo Fisher), and the plasmids were stored at -20 °C.

[0358] 2. Generate lentiviruses expressing KDM5C gRNA in HEK-293T cells.

[0359] Produce infectious KDM5C gRNA lentiviral particles for transduction into ER+ breast cancer cells according to the following procedure and materials described in Tables 14, 15, and 16.

[0360] Table 14: Materials for the production of HEK-293T cells expressing lentivirus

[0361]

[0362] Table 15: Backbone vector

[0363]

[0364] Table 16: KDM5C gRNA vector for the production of lentivirus

[0365]

[0366] HEK-293T cells were cultured in DMEM medium with 1x GlutaMAX and 10% fetal bovine serum (FBS) at 37 °C under 5% CO2 and maintained according to the manufacturer's recommendations (GeneHunter; catalog number: Q401). For passaging, the medium was aspirated and the cells were rinsed by gently adding 5 mL TrypLE to the side of the T225 flask without dislodging the cells. The TrypLE was removed and the cells were incubated in the flask at 37 °C for 4 - 5 min until they began to detach. Next, 10 mL of warm medium was added to the flask and the cells were dissociated by gently pipetting up and down. The cells were transferred to a 50-ml Falcon tube. HEK293T cells were passaged at a 1:4 ratio every 2 days and were never allowed to reach more than 70% confluence. For lentivirus production, the cells were maintained until the passage number was less than 10.

[0367] On day 0, HEK-293T cells were seeded in a 6-well plate at 8 x 10 5 cells per well in the plate. On the day of transfection, the cells should be 80 - 90% confluent and 3 mL of lentivirus was produced per well. On the morning of day 1, the CRISPR gRNA lentiviral vector described in Table 16, the packaging mixture vectors (psPAX2 and pMG2.G) described in Table 15, and the PLUS reagent were mixed with Opti-MEM medium in a 15-mL tube as described in Table 17. The transfection mixture was mixed by pipetting or vortexing for 2 s and incubated at room temperature for 5 min. Lipofectamine LTX was added, mixed by pipetting or vortexing for 2 s, and incubated at room temperature for 30 min. The old medium in the wells was aspirated and the cells were washed once with 2 mL of Opti-MEM medium per well. Note not to dislodge the cells during this step as HEK-293T cells adhere loosely to the culture vessel. 1.5 mL of Opti-MEM medium was added to each well. The DNA / Lipofectamine complex was added dropwise to each well using a pipette and very gently vortexed. The cells were incubated with the transfection solution at 37 °C for 5 - 7 h. If the cells were <80% confluent at the time of transfection, the transfection incubation time was reduced to 5 h to prevent excessive cell death. Then the medium was replaced with 2.5 mL of fresh cell medium (DMEM GlutaMAX + 10% FBS).

[0368] Table 17: Volumes and amounts used for the transfection step

[0369] Reagent One well of a 6-well plate Opti-MEM 500 μL Lentiviral transfer vector 0.9 μg psPax2 0.9 μg pMG2.G 0.2 μg PLUS reagent 2 μL Lipofectamine LTX 6 μL

[0370] Before collecting the lentivirus, HEK-293T cells were examined under a fluorescence microscope to detect BFP expression and evaluate the transduction efficiency as well as successful virus production. On day 3, 48 h after transfection, the virus supernatant was collected using a 10 mL disposable syringe and filtered through a 0.45 μm filter cartridge. The plate of HEK-293T was discarded following the appropriate waste disposal route. 1 mL of the supernatant was aliquoted into labeled cryovials and stored at -80 °C.

[0371] 3. Infect and generate cell lines expressing MCF7, T47D, and CAMA-1

[0372] with KDM5C gRNA lentivirus and Cas9.

[0373] The purpose of this protocol is to generate a pooled KDM5C KO cell line (Example 1B, Example 1C, and Example 1D) from a stable lentivirus pool of MCF7, T47D, and CAMA-1 Cas9. In a 6-well plate, each Cas9-expressing cell line (cells in each well were transduced with a different KDM5C gRNA lentivirus) was transduced with 3 different KDM5C gRNA lentiviruses (Sequence 1, Sequence 2, Sequence 3). Cells were also transduced with a lentivirus without a gRNA targeting KDM5C (empty vector pKLV-2). These are the wild-type cell lines for proliferation experiments. The KDM5C gRNA lentiviruses were thawed at room temperature and a virus transduction mixture was prepared in 1.5 mL Eppendorf tubes as described in Table 18. 250,000 cells were seeded in a total of 1 mL of medium per well in a 6-well plate. Immediately after seeding the cells, 1 ml of the transduction mixture was added to each well of the cells, the plate was gently mixed, and placed in an incubator. 24 hours after transduction, the medium containing the virus was removed from each well and replaced with 3 mL of fresh medium. 72 hours after transduction, the cells were expanded from each well into T75 flasks with puromycin selection. The puromycin concentration used for each cell line is shown in Table 19. The cells were maintained with puromycin selection until no viable cells remained in the virus-free control flasks. After completion of puromycin selection for the KDM5C KO cell line, the cell line was expanded for at least one week and then the KDM5C protein level was tested using Western blot.

[0374] Table 18: Materials for the production of HEK-293T cells expressing lentivirus

[0375]

[0376] Table 19: Puromycin concentrations used in cell lines

[0377] Cell line Puromycin concentration (ug / mL) MCF7 2 CAMA-1 2 T47D 2

[0378] Use Western blotting to confirm that the KDM5C gene has been edited from the cell line. Extract proteins from cells in a T25 flask with 200 μL of lysis buffer (25 mM Tris HCL, 3 mM EDTA, 3 mM EGTA, 50 mM NaF, 2 mM orthovanadate, 0.27 M sucrose, 10 mM β-glycerophosphate, 5 mM pyrophosphate, 0.5% Triton X-100, 0.1% β-mercaptoethanol, deionized water) supplemented with a protease inhibitor cocktail. Clarify the lysate by centrifugation and quantify using the BCA assay. Normalize the protein concentration across samples and prepare with NuPAGE LDS sample buffer (4X). Boil the samples, load them onto a NuPAGE BisTris gel 4%-12% gel, and run the gel tank (XCell Surelock TM Mini-Cell) for 1 hour with NuPAGE MOPSSDS running buffer to separate the proteins. Transfer the proteins from the gel to a nitrocellulose membrane using the Iblot2 dry blotting system according to the manufacturer's instructions with program P3 20V for 10 minutes. Assess the total protein in the membrane using Ponceau S staining, and block the membrane with TBST buffer (TBS containing 0.05% Tween) with 5% non-fat dry milk. Stain the membrane with the primary antibody overnight at 4 degrees with shaking (KDM5C antibody: 1:250; Abcam ab34718; vinculin antibody: 1:1000, Cell Signalling Technology #4650). The next day, wash the membrane three times with TBST for 5 minutes each. Incubate the membrane with the secondary antibody conjugated to HRP peroxidase from the appropriate species (1:2000) for 1 hour at room temperature with shaking. Wash the membrane three times with TBST for 5 minutes each. Finally, incubate the membrane with a substrate that can be detected via chemiluminescence (Pierce Supersignal kit) and develop the image using a CCD camera in the Sygene G-box.

[0379] 4. Perform proliferation assays with MCF7 and CAMA-1 KDM5C KO lentiviral pools. Use the following protocol to establish the proliferation assay and analyze the resulting data, Figure 2 、 Figure 3 、 Figures 9 to 12 、 Figure 15 and Figure 16 。

[0380] CAMA-1 cell line: Seed CAMA-1 WT (parental cell line) and KDM5C KO lentiviral pool at 25,000 cells / well in a 48-well plate. Place the plate in an incubator to allow the cells to attach. After 24 hours, treat the cells with DMSO as vehicle control or 400 nM capesertinib, and place the plate on S3 immediately after adding the compound (day 0 reading). Image the cells on day 2, day 5, day 6, day 7, day 9, day 12, day 14, day 16, day 20, and day 21 (end of the assay).

[0381] MCF7 cell line: Seed MCF7 WT (parental cell line) and KDM5C KO lentiviral pool at 60,000 cells / well and 90,000 cells / well in two replicate 24-well plates. Place the plates in an incubator to allow the cells to attach. After 24 hours, treat the cells with DMSO as vehicle control, 750 nM capesertinib, or 750 nM alpelisib, 10 nM everolimus. And place the plates on Zoom immediately after adding the compound (day 0 reading). Image the cells every 4 hours for 8 days.

[0382] For both cell lines, obtain multiple fields of view per well and use analysis software to quantify the average % confluence of cells per well. Normalize the values at all time points to day 0. Plot the normalized values as a line graph (X-axis = days of proliferation, Y-axis = % cell confluence), while plot the endpoint values (last day of imaging) as a bar graph.

[0383] Figure 2 、 Figure 3 、 Figure 9 、 Figure 10 、 Figure 11 、 Figure 12 、 Figure 13 and Figure 16 show that:

[0384] · Knockout of KDM5C affects the proliferation / growth of MCF7 cells.

[0385] · Knockout of KDM5C sensitizes MCF7 cells to single-agent therapy with capesertinib, alpelisib, or everolimus.

[0386] · Knockout of KDM5C sensitizes CAMA-1 cells to single-agent therapy with capesertinib.

[0387] 2B. Proliferation assay using MCF7 KDM5C KO clonal cell lines. Use the following protocol to establish the proliferation assay and analyze samples from 、 Figures 4 to 8 、 Figure 13and Figure 14 The resulting data. MCF7 WT (parental cell line) and MCF7 KDM5C KO clone A9 were seeded in duplicate 48-well plates at 50,000 cells / well (2 plates) and 75,000 cells / well (3 plates). The plates were placed in an incubator to allow the cells to attach. After 24 hours, the cells were treated with DMSO as a vehicle control, capivasertib (500 nM or 1 μM), alpelisib (500 nM or 1 μM), fulvestrant (10 nM), and camizestrant (10 nM). Immediately after adding the compounds, the plates were placed on S3 or Zoom (Day 0 reading). The cells were imaged for 14 days, and images were acquired every 4 hours for plates seeded at 75,000 cells / well or on Days 4, 8, 10, and 14 for plates seeded at 50,000 cells / well. Multiple fields of view were acquired per well, and the average % confluence of the cells per well was quantified using analysis software. The values at all time points were normalized to Day 0. The normalized values were plotted as a line graph (X-axis = days of proliferation, Y-axis = % cell confluence), while the endpoint values (last day of imaging) were plotted as a bar graph. Statistical analysis was performed on Prism using data from multiple plates. Ns = P>0.05; *= P≤0.05; **P≤0.01; ***P≤0.001; ****P≤0.0001 Significance was determined using a two-tailed t-test.

[0388] Figures 4 to 8 、 Figure 13 and Figure 14 showed that:

[0389] · Knockout of KDM5C affects the proliferation / growth of MCF7 cells.

[0390] · Knockout of KDM5C sensitizes MCF7 cells to capivasertib and alpelisib monotherapies and the combination of capivasertib and fulvestrant or camizestrant.

[0391] 2C. Proliferation assay using acute knockout (KO) of KDM5C. The following protocol was used to establish the proliferation assay and analyze the resulting data from . Acute KO of KDM5C was achieved by reverse transfecting a pool of 4x different synthetic single-guide RNAs (sgRNAs) targeting exon 3 of KDM5C in MCF7 and CAMA-1 cell lines stably expressing spCas9. A sgRNA targeting the safe harbor locus AAVS1 (adeno-associated virus integration site 1) was used as a reference control. Figures 2 to 19 the resulting data.

[0392]

[0393] Table 13: sgRNA ​

[0394] sgRNA Sequence (5'–3') KDM5C sgRNA 1 GCCAAAUUCUGGGAAAUCCA [SEQ_ID 30] KDM5C sgRNA 2 UGCCAAAUUCUGGGAAAUCC [SEQ_ID 31] KDM5C sgRNA 3 GAGAGUGAAACUGAACUACU [SEQ_ID 32] KDM5C sgRNA 4 GUUCAGUUUCACUCUCGUCU [SEQ_ID 33] AAVS1 sgRNA GCCAGTAGCCAGCCCCGTCC [SEQ_ID 34]

[0395] Before starting the proliferation assay, using an acoustic dispenser from 650 (Beckman), 350 nL of the pooled KDM5C sgRNA or the single AAVS1 sgRNA was dispensed per well in a 96-well plate (Thermo Fisher Scientific #165305) to achieve a final concentration of 25 nM / well in a final volume of 140 μL.

[0396] MCF7 and CAMA-1 cells were cultured in phenol red-free RPMI supplemented with 5% fetal bovine serum (FBS), 1X Glutamax, 1 / 100 Pen / Strep (P / S), and incubated at 37 °C under 5% CO2. After dispensing the sgRNA into the 96-well plate, the cells were resuspended from T25 or T75 flasks by washing the cells with PBS at room temperature and the cells were incubated with Accutase TM for 5 minutes. The cell suspension was collected in a falcon and counted using a Vi-CELL counter (Beckman). MCF7 cells were diluted to 85714.29 cells / ml with medium and 9000 cells were seeded per well, while CAMA-1 cells were diluted to 100000 cells / ml with medium and 7000 cells were seeded per well. Reverse transfection was initiated by incubating the synthetic sgRNA with Lipofectamine RNAiMAX (Thermo Fisher Scientific #13778150). Using a Multidrop TM Combi with a standard cassette, 35 μL of 1% Lipofectamine RNAiMAX diluted in serum-free RPMI medium was added to each well. The sgRNA:Lipofectamine mixture was incubated at room temperature for 45 minutes. Immediately afterwards, using a Multidrop TM Combi with a standard cassette, 105 μL of the cell suspension was added on top at low speed. The cells were dispensed in replicate plates containing multiple replicate wells for each treatment. The edge wells in the plate (rows A and H; columns 1 and 12) were excluded. After cell seeding, the plate was placed on a Zoom in the incubator and pre-scheduled bright-field imaging scans were performed every 5 hours using a 10x objective. After 3 days, the medium was removed using a multi-channel pipettor and using a Multidrop TMCombi refilled the wells with fresh medium at low speed (140 μL final volume). Different treatments were given to the plates using a Tecan D300 Digital Dispenser (HP). Dimethyl sulfoxide (DMSO) was used as the vehicle for diluting the drugs and as a neutral control.

[0397] MCF7 cells were treated with two concentrations of capesertib (500 nM and 750 nM), 100 nM fulvestrant, and the combination of 500 nM capesertib and 100 nM fulvestrant. The cells were put back and imaged over the subsequent 10 days of drug treatment. After 4 days, the medium was replaced with fresh cell medium containing the drugs. The medium was removed from the plates as described above and the plates were re - dosed using the Tecan D300 Digital Dispenser (HP) at the same starting concentrations. The medium was replaced again using the same procedure after 3 days and maintained until the end of the assay.

[0398] CAMA - 1 cells were treated with 400 nM capesertib monotherapy. The cells were put back and imaged over the subsequent 7 days of drug treatment. After 3 days, the medium was replaced with fresh cell medium containing the drugs and maintained until the end of the assay. The medium was removed from the plates as described above and the plates were re - dosed using the Tecan D300 Digital Dispenser (HP) at the same starting concentrations.

[0399] For both cell lines, four fields of view were acquired per well and the average % of cell confluence per well was quantified using Zoom analysis software; starting from day 1 (24 h after reverse transfection) until the end of the assay 13 days (MCF7 cells) or 10 days (CAMA - 1 cells) later. The % of cell confluence across time points was normalized to day 1 after reverse transfection.

[0400] The proliferation results plotted in the growth curves ( Figure 17 and Figure 19 ) or the bar graphs of cell confluence at the end of the study ( Figure 18 ) showed that:

[0401] · Acute knockdown of KDM5C affected the proliferation / growth of MCF7 cells.

[0402] · Acute knockdown of KDM5C sensitized MCF7 cells (PIK3CA E545K) to capesertib monotherapy and the combination of fulvestrant and capesertib. Acute knockdown of KDM5C sensitized CAMA - 1 cells (PTEN - null) to capesertib monotherapy.

[0403] Example 4: KDM5 Inhibition and Drug Combination Studies

[0404] Experiments in this example were conducted to verify the drug-sensitizing effect of inhibiting KDM5 with CPI-48 compounds in PIK3CA-mut and PTEN-null ER+ breast cancer cell lines (MCF7 and CAMA-1), as well as in PIK3CA-mut cell lines (MCF7 and T47D) resistant to fulvestrant or fulvestrant + palbociclib.

[0405] Proliferation assay using KDM5 inhibitor CPI-48: The following protocol was used to establish the proliferation assay and analyze the resulting data from Figures 20 to 30 .

[0406] All cell lines were cultured in phenol red-free RPMI supplemented with 5% fetal bovine serum (FBS), 1X Glutamax, and 1 / 100 Pen / Strep (P / S), and incubated at 37 °C in 5% CO2. First, cells were resuspended from T75 flasks by washing with PBS at room temperature and incubated with 2 mL Accutase TM for 5 minutes. The cell suspension was collected in a falcon and counted using a Vi-CELL counter (Beckman). The resuspended cell stock solution was diluted with medium to the appropriate cell density using a Multidrop TM Combi with a standard cassette to seed 50 μL / well in a 384-well plate (Greiner #781090). The following number of cells / well were seeded: MCF7 parental and MCF7 100F P2 (600 cells / well), MCF7 ESR1 (Y537S / - / -) (500 cells / well), T47D 100F1P P1 and T47D 100F1P P2 (1000 cells / well), and CAMA-1 (2000 cells / well). Cells were seeded in columns (3 columns for each cell line), and each plate was repeated to have technical replicates. The edge wells in the plate (row A and row P; column 1 and column 24) were excluded. Each cell line had at least six DMSO wells / plate (twelve in total, two replicate plates), and each drug treatment and plate had at least three biological replicates. For each cell line and plate, only fulvestrant and fulvestrant with palbociclib contained at least 1 sample. After cell seeding, the plates were placed in the incubator until drug treatment.

[0407] At 36 hours after seeding, T47D 100F1P P1 ( Figure 24 , Figure 26 and Figure 30 ), T47D 100F1P P2 ( Figure 25 , Figure 27 , Figure 28 and Figure 30 ), and CAMA-1 ( Figure 21) Cells. Dimethyl sulfoxide (DMSO) was used as a vehicle for diluting the drugs and as a neutral control. Different treatments were administered to the cells using a Tecan D300 digital dispenser (HP). Cells were treated with CPI-48 at 4-point dose responses (1 μM, 5 μM, 10 μM, 15 μM), two concentrations of capesicitinib (T47D: 400 nM and 600 nM; CAMA-1: 200 nM and 400 nM), two concentrations of alpelisib (300 nM and 500 nM), 10 nM everolimus, 100 nM fulvestrant, and a combination of 100 nM fulvestrant and 400 nM palbociclib. The cells were returned to the incubator and grown with the drugs for 10 days. After 2 days, the medium was replaced with fresh medium containing the drugs. The medium was removed from the plates using a Bravo automated liquid handling platform (Agilent), and then 50 μL of fresh medium was added immediately at low speed using a Multidrop TM Combi with a standard cassette. Then the cells were again treated with fresh DMSO and the drugs at the same starting concentrations as above. After 4 days, following the same procedure, the medium was replaced with fresh medium containing the drugs again.

[0408] MCF7 ( Figure 20 and Figure 29 ), MCF7 100F P2 ( Figure 23 and Figure 29 ), and MCF7 ESR1 (Y537S / − / −) ( Figure 22 and Figure 29 ) cells were treated with drugs 20 hours after seeding. Dimethyl sulfoxide (DMSO) was used as a vehicle for diluting the drugs and as a neutral control. Different treatments were administered to the cells using a Tecan D300 digital dispenser (HP). Cells were treated with CPI-48 at 4-point dose responses (1 μM, 5 μM, 10 μM, 15 μM), two concentrations of capesicitinib (500 nM and 750 nM), 100 nM fulvestrant, and a combination of 100 nM fulvestrant and 400 nM palbociclib. As described above for the T47D and CAMA-1 cell lines, the medium was replaced with fresh medium containing the drugs twice, 3 days and 7 days after the first administration.

[0409] After 10 days of continuous drug treatment, all proliferation assays were terminated by fixing the cells with 50 μL of 8% paraformaldehyde (4% final) for 45 minutes at room temperature. The paraformaldehyde was removed, and the plates were washed 4 times with 75 μL / well of PBS using a BioTek EL406 microplate washer. The plates were stored at 4 degrees.

[0410] To quantify the cell number, the cell nuclei were stained with Hoechst 33342 (Thermo Fisher Scientific #H3570), imaged, and counted. The cells were permeabilized and blocked with a modified blocking buffer (1 liter: 8 g of chloride, 0.2 g of potassium chloride, 1.44 g of disodium hydrogen phosphate, 0.2 g of potassium dihydrogen phosphate, 11 g of 1.1% BSA, 1 g of 0.1% Triton X-100, deionized water) for 60 minutes at room temperature. Using a Multidrop TM Combi, 20 μL of Hoechst dye diluted 1 / 2000 in the modified blocking buffer was added to the plate at a low speed. The plate was incubated in the dark for 2 hours at room temperature. Then, the plate was washed 4 times with 75 μL / well of PBS using a BioTek EL406 microplate washer. Images were acquired using a Cell Voyager 7000 (Yokogawa) spinning disk confocal microscope. Images were acquired with a 10x dry objective at 2x2 binning. Four fields of view were acquired per well with the optimal z-position (1x z-stack). With Columbus TM image analysis system (PerkinElmer) to analyze the images. The analysis sequence for counting cell nuclei involved identifying cell nuclei using Hoechst intensity (method A, common threshold 0.7 (T47D / CAMA-1 cells) or 0.3 (MCF7 cells) and division coefficient 4 (T47D / CAMA-1 cells) or 3 (MCF7 cells)). Objects in the image boundary were excluded, and the morphological and intensity properties of the remaining nuclear objects were calculated. The nuclear objects were filtered to remove artifacts: for T47D cells (nuclear area μm 2 >60 and intensity<20000 and >350), for CAMA-1 cells (nuclear area μm 2 >70 and intensity<20000 and >350), for MCF7 cells (nuclear area μm 2 >70 and intensity<50000 and >350 and circularity > 0.75). The average cell count per well was normalized to the average cell count of the DMSO samples for each cell line within the plate and plotted as fold change relative to DMSO using Prism v8 (GraphPad). Statistical analysis was performed in Prism v8. One-way ANOVA with Bonferroni's post-hoc test (ns = P > 0.05, * = P ≤ 0.05, ** = P ≤ 0.01, *** = P ≤ 0.001) was used to calculate the statistical differences between the following: (A) CPI-48 monotherapy samples relative to DMSO, (B) combinations of CPI-48 with capivasertib, alpelisib, or everolimus relative to capivasertib, alpelisib, or everolimus monotherapy ( Figures 20 to 28 ), and (C) parental and resistant cell lines ( Figure 29 and Figure 30 ).

[0411] Proliferation assays showed that:

[0412] · Inhibition of KDM5 in combination with capivasertib impairs the growth of PIK3CA-mut (MCF7) and PTEN-null (CAMA-1) ER+ breast cancer cell lines. ( Figure 20 、 Figure 21 ).

[0413] · KDM5 inhibition shows monotherapy activity in MCF7 and T47D cell models, both with the PIK3CA E545K mutation ( Figure 20 、 Figures 23 to 27 ).

[0414] · Inhibition of KDM5 in combination with capivasertib and increases its anti-proliferative effect in cell models with lower sensitivity or resistance to fulvestrant and the combination of fulvestrant and palbociclib ( Figures 22 to 25 ).

[0415] · Inhibition of KDM5 in combination with alpelisib and everolimus impairs the growth of T47D cell models resistant to fulvestrant or its combination with palbociclib ( Figures 26 to 28 ).

[0416] · The MCF7 Y537S mutant and 100F P2 cell lines are less sensitive to 100 nM fulvestrant than the parental WT cell line ( Figure 29 ).

[0417] · The T47D 100F1P P1 and T47D 100F1P P2 cell lines are insensitive to fulvestrant or its combination with palbociclib ( Figure 30 ).

Claims

1. A compound for treating cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and the compound is an AKT inhibitor, a PI3K-α inhibitor or an mTOR inhibitor.

2. The compound for use according to claim 1, wherein the compound is an AKT inhibitor.

3. The compound for use according to claim 1, wherein the compound is a PI3K-α inhibitor.

4. The compound for use according to claim 1, wherein the compound is an mTOR inhibitor.

5. The compound for use according to any one of the preceding claims, wherein the administration of the compound and the KDM5C inhibitor is separate, sequential or simultaneous.

6. The compound for use according to any one of the preceding claims, wherein the cancer is PTEN-deficient.

7. The compound for use according to any one of the preceding claims, wherein the cancer comprises a PIK3CA mutation.

8. The compound for use according to claim 7, wherein the PIK3CA mutation is selected from one or more of the following: R88Q, N345K, C420R, E542K, E545A, E545D, E545Q, E545K, E545G, Q546E, Q546K, Q546R, Q546P, M1043V, M1043I, H1047Y, H1047R, H1047L and G1049R.

9. The compound for use according to any one of the preceding claims, wherein the cancer is breast cancer.

10. The compound for use according to any one of the preceding claims, wherein the cancer is advanced breast cancer or metastatic breast cancer.

11. The compound for use according to claim 9 or 10, wherein the breast cancer is estrogen receptor-positive breast cancer.

12. The compound for use according to any one of the preceding claims, wherein the patient is a postmenopausal woman or a premenopausal woman.

13. The compound for use according to any one of claims 9 to 12, wherein the breast cancer is resistant to treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator or an aromatase inhibitor.

14. The compound for use according to any one of claims 9 to 13, wherein the patient's breast cancer has progressed during or after prior treatment with a selective estrogen receptor degrader, a selective estrogen receptor modulator and / or an aromatase inhibitor.

15. A compound for use according to claim 13 or 14, wherein the selective estrogen receptor degrader is selected from fulvestrant or a pharmaceutically acceptable salt thereof, asense group or a pharmaceutically acceptable salt thereof, camis group or a pharmaceutically acceptable salt thereof, and elacestrant or a pharmaceutically acceptable salt thereof.

16. A compound for use according to any one of claims 13 to 15, wherein the selective estrogen receptor modulator is selected from tamoxifen or a pharmaceutically acceptable salt thereof, toremifene or a pharmaceutically acceptable salt thereof, and raloxifene or a pharmaceutically acceptable salt thereof.

17. A compound for use according to any one of claims 13 to 16, wherein the aromatase inhibitor is selected from anastrozole or a pharmaceutically acceptable salt thereof, letrozole or a pharmaceutically acceptable salt thereof, and exemestane or a pharmaceutically acceptable salt thereof.

18. A compound for use according to any one of claims 9 to 17, wherein the breast cancer is resistant to treatment with a CDK4 / 6 inhibitor.

19. A compound for use according to any one of claims 9 to 18, wherein the breast cancer has progressed during or after prior treatment with a CDK4 / 6 inhibitor.

20. A compound for use according to claim 18 or 19, wherein the CDK4 / 6 inhibitor is selected from palbociclib or a pharmaceutically acceptable salt thereof, ribociclib or a pharmaceutically acceptable salt thereof, and abemaciclib or a pharmaceutically acceptable salt thereof.

21. A compound for use as claimed in any one of claims 1, 2 or 5 to 20, wherein the AKT inhibitor is selected from milciclib (ARQ-092) or a pharmaceutically acceptable salt thereof, BAY1125976 or a pharmaceutically acceptable salt thereof, buparlisib or a pharmaceutically acceptable salt thereof, AT7867 or a pharmaceutically acceptable salt thereof, CCT128930 or a pharmaceutically acceptable salt thereof, A-674563 or a pharmaceutically acceptable salt thereof, PHT-427 or a pharmaceutically acceptable salt thereof, Akti-1 / 2 or a pharmaceutically acceptable salt thereof, AT13148 or a pharmaceutically acceptable salt thereof, SC79 or a pharmaceutically acceptable salt thereof, capivasertib or a pharmaceutically acceptable salt thereof, miltefosine or a pharmaceutically acceptable salt thereof, perifosine or a pharmaceutically acceptable salt thereof, MK-2206 or a pharmaceutically acceptable salt thereof, RX-0201 or a pharmaceutically acceptable salt thereof, erucylphosphocholine or a pharmaceutically acceptable salt thereof, PBI-05204 or a pharmaceutically acceptable salt thereof, GSK690693 or a pharmaceutically acceptable salt thereof, afuresertib (GSK2110183) or a pharmaceutically acceptable salt thereof, uprosertib (GSK2141795) or a pharmaceutically acceptable salt thereof, XL-418 or a pharmaceutically acceptable salt thereof, and patritumab (GDC-0068) or a pharmaceutically acceptable salt thereof.

22. A compound for use as claimed in claim 21, wherein the AKT inhibitor is capivasertib or a pharmaceutically acceptable salt thereof.

23. A compound for use as claimed in any one of claims 1, 3 or 5 to 22, wherein the PI3K-α inhibitor is a PI3K-α selective inhibitor.

24. A compound for use as claimed in claim 23, wherein the PI3K-α inhibitor is a PI3K-α specific inhibitor.

25. A compound for use as claimed in claim 23 or claim 24, wherein the PI3K-α inhibitor is selected from alpelisib or a pharmaceutically acceptable salt thereof, iniparib or a pharmaceutically acceptable salt thereof, and sarecycline or a pharmaceutically acceptable salt thereof.

26. A compound for use as claimed in any one of claims 1 or 4 to 25, wherein the mTOR inhibitor is an mTORC1 inhibitor.

27. A compound for use as claimed in claim 26, wherein the mTOR inhibitor is an mTORC1 selective inhibitor.

28. A compound for use as claimed in claim 26 or claim 27, wherein the mTOR inhibitor is selected from everolimus or a pharmaceutically acceptable salt thereof and temsirolimus or a pharmaceutically acceptable salt thereof.

29. A compound for use in the use according to any one of the preceding claims, wherein the KDM5C inhibitor is CPI-48 or a pharmaceutically acceptable salt thereof.

30. A compound for use in the use according to any one of the preceding claims, wherein the compound and the KDM5C inhibitor are administered in combination with a SERD.

31. A compound for use in the use according to claim 30, wherein the administration of the compound, the KDM5C inhibitor, and the SERD is separate, sequential, or simultaneous.

32. A compound for use in the use according to any one of claims 30 to 31, wherein the compound and the KDM5C inhibitor are administered in combination with fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof and palbociclib or a pharmaceutically acceptable salt thereof.

33. A compound for use in the use according to claim 32, wherein the administration of the compound, the KDM5C inhibitor, fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof, and palbociclib or a pharmaceutically acceptable salt thereof is separate, sequential, or simultaneous.

34. Use of a compound in the manufacture of a medicament for the treatment of cancer, wherein the compound is administered in combination with a KDM5C inhibitor, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

35. A method of treating cancer in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of a compound, wherein the compound is administered in combination with a therapeutically effective amount of a KDM5C inhibitor, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

36. A method of treating cancer in a patient in need thereof, the method comprising administering to the patient a first amount of a compound and a second amount of a KDM5C inhibitor, wherein the first amount and the second amount together constitute a therapeutically effective amount, and wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

37. A pharmaceutical composition comprising a compound, a KDM5C inhibitor, and a pharmaceutically acceptable excipient, wherein the compound is an AKT inhibitor, a PI3K-α inhibitor, or an mTOR inhibitor.

38. The pharmaceutical composition according to claim 37, the pharmaceutical composition comprising fulvestrant or a pharmaceutically acceptable salt thereof or camizestrant or a pharmaceutically acceptable salt thereof.

39. The pharmaceutical composition according to claim 38, wherein the pharmaceutical composition comprises a compound, a KDM5C inhibitor, camizestrant or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient, wherein the compound is capmatinib or a pharmaceutically acceptable salt thereof.

40. The pharmaceutical composition according to claim 38 or claim 39, wherein the pharmaceutical composition comprises palbociclib or a pharmaceutically acceptable salt thereof.

Citation Information

Patent Citations

  • Perifosine and capecitabine as a combined treatment for cancer

    US8383607B2

  • O-alkylated rapamycin derivatives and their use, particularly as immunosuppressants

    WO1994009010A1

  • Rapamycin hydroxyesters, process for their preparation and pharmaceutical compositions containing them

    WO1995028406A1

  • 2-(PYRIDIN-2-YLAMINO)-PYRIDO[2,3d]PYRIMIDIN-7-ONES

    WO2003062236A1

  • Inhibitors of AKT activity

    WO2007058850A2