Immunoassay for detecting biologically active proteins

By expressing heterologous signal peptides and antibodies with different glycosylation modes in diatoms, single-cell plants or green plants, the problems of high production costs and contamination risks in the prior art are solved, and high-quality and quantity of recombinant antibodies are achieved.

CN120188041APending Publication Date: 2025-06-20PHAEOSYNT GMBH
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202380064710.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-09-15
Filing Date
2023-09-15
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The prior art is difficult to cost-effectively produce high-quality and quantity of recombinant antibodies, and methods based on animal or cell culture pose animal pain, high cost and risk of contamination.

Method used

High purity and high yields are achieved by expressing heterologous signal peptides and antibodies with different glycosylation patterns in these plants using recombinant antibodies from diatoms, single-cell plants or green plants.

Benefits of technology

High-quality and quantity of recombinant antibodies are achieved, reducing production costs, avoiding animal pain and contamination risks, and improving the purity and stability of the antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120188041A_ABST
    Figure CN120188041A_ABST
Patent Text Reader

Abstract

The present invention relates to a pure immunoassay for the detection of biologically active antigens, to a device in which such an immunoassay is provided, to a kit comprising such a device and to the use of such an immunoassay and to a method for the detection of biologically active antigens.
Need to check novelty before this filing date? Find Prior Art

Description

Field of the Invention

[0001] The present invention relates to an immunoassay for detecting bioactive proteins, a device provided with such an immunoassay, a kit having such a device, the use of such an immunoassay, and a method for detecting bioactive antigens. Background Art

[0002] There are many different immunoassays available for analyzing the body fluids of an individual, such as whole blood, serum, saliva, milk, or urine.

[0003] One problem with common immunoassays using antibodies is the fact that the antibodies are derived from animals. Thus, the antibodies are either produced in animals or in animal cell cultures. Specifically, CHO cells (Chinese hamster ovary cells) and HEK-293T cells (human embryonic kidney cells) are used. The production costs based on cell culture are very high; therefore, the existing production capacity is mainly used for the production of expensive therapeutic antibodies. In the diagnostic field, the profit margins of antibodies are much lower, so they are still often produced in animals. Such antibodies produced in animals not only cause animal suffering, but also have low reliability of binding properties, limited availability, and a risk of being contaminated with human pathogens. So far, there has been no technical solution capable of manufacturing a vegan assay in an economically efficient manner and in an economically relevant production volume.

[0004] Alternative methods for producing antibodies and other complex proteins are very limited. Bacteria such as Escherichia coli cannot perform the necessary post-translational modifications on antibodies, and the productivity is extremely low. Similar situations exist for yeast- or Pichia-based production systems. Here, the antibodies are also rarely correctly folded by the host cells, and the productivity is as low as in bacteria. For many years, transgenic plants have been discussed as alternative producers, but even then, the extremely low productivity does not allow for economically viable utilization.

[0005] Attempts have been made to use higher plants to produce antibodies, as disclosed, for example, in patent document US 6,080,560 A. Other methods have been disclosed in some publications, such as those of Melnik Stanislav et al. (DOI: 10.1111 / pbi.12746) and Ayala Marta et al. (DOI: 10.1007 / 978-1-59745-407-0_7). The problem with these plants is that the productivity of antibodies in plants is usually very low because only the cells of certain tissues of the plant integrate the antibody gene into their genome, so only certain tissues produce small amounts of antibodies. The plant is a chimera because it contains many tissues that have not integrated any antibody genes, which further reduces the yield. To produce antibodies over several generations, it is also necessary to ensure that the germ cells have integrated the antibody gene into their genome to ensure permanent production. Finally, permanent production requires self-fertilization or grafting of transgenic plants. Through "natural" sexual reproduction, the transgene no longer exists after several generations.

[0006] Another method is the agroinfiltration of genetically modified plant viruses, which are used to infect plants. A problem with these plants is that they are transiently modified, i.e., the antibody gene is not integrated into any plant genome, so they can only stably express antibodies in one generation. In this method, each cell of the plant is indeed capable of producing antibodies because the virus spreads throughout the plant. However, in this case, without integration into the plant genome, the plant cannot survive during this process but dies within a few days. This means that continuous and stable production cannot be ensured, and legally, it always involves the regeneration of transgenic plants and all the corresponding regulatory implications.

[0007] In addition, purification is problematic because higher plants produce large amounts of fibrous material, which makes it difficult to separate and isolate the antibodies, so they are not suitable for providing antibodies of comparable quality and quantity to animal alternatives.

[0008] In addition, there are several known research documents and patent specifications for expressing antibodies by diatoms. Examples of antibody secretion by diatoms in the literature include the works published by Hempel et al. (DOI: 10.1186 / 1475-2859-11-126), Samuels et al. (DOI: 10.1038 / s41598-022-11053-7), and Hempel et al. (DOI: 10.1371 / JOURNAL.PONE.0028424). A common feature of these methods is that these antibodies are expressed extracellularly, which has the unfortunate drawback that these methods cannot produce high-quality and technically viable amounts of homogeneous and consistent antibodies for commercial use as substitutes for established animal-derived antibodies. The same is true for the following patent specifications. The production of antibodies in a microalga, Phaeodactylum tricornutum, is described. For example, EP 2 671950A1 discloses the expression and secretion of recombinant, fully assembled protein complexes by microalgae. Here, the microalgae are expressed extracellularly, and in theory, it is easier to isolate the protein; an unfortunate drawback of this method is that the productivity is very low, which means that the antibodies can only be purified at a very high cost. Patent specifications EP 2 444 495A1 and EP 2 660 323 A1 describe a method for producing therapeutic antibodies using transformed microalgae called Phaeodactylum tricornutum. The transformed microalgae contain a nucleic acid sequence encoding a therapeutic antibody, a functional fragment thereof, or a derivative thereof coupled to a heterologous signal peptide, all of which are operably linked to a promoter. These transformed microalgae express the therapeutic antibody extracellularly into the culture medium, i.e., the antibody is secreted. Unfortunately, this method only produces a small amount of therapeutic antibodies, which is attributed to the inefficient use of extracellular expression. Summary of the Invention

[0009] Technical Objectives

[0010] Therefore, the technical objective of the present invention is to provide an immunoassay method that overcomes the known drawbacks of the prior art, and in particular, to provide high-quality and technically available amounts of recombinant antibodies from diatoms or single-celled plants.

[0011] Technical Solution

[0012] To solve the technical problems of the prior art, a preferred embodiment of the present invention for detecting bioactive antigens in an individual biological sample, particularly hormones, proteins, or vaccines, includes using recombinant antibodies, such as primary antibodies, secondary antibodies, and / or other antibodies, which are derived from diatoms, single-celled plants, or green plants, wherein the recombinant antibody comprises a heterologous diatom-, plant-, or microalga-specific signal peptide and / or a glycosylation pattern different from that of a natural antibody obtained from an individual (as defined herein).

[0013] According to a preferred embodiment of the present invention, at least two antibodies, such as a first antibody and a second antibody, and particularly preferably all the antibodies used are from diatoms, unicellular plants or green plants.

[0014] This object is solved by an immunoassay having the features of claim 1 and by devices and methods having the features of the dependent claims. Further advantageous embodiments can be found in the dependent claims, the description and the exemplary embodiments. The advantages of the immunoassay and other components will be shown in the further description below.

[0015] According to a preferred embodiment of the present invention, there is provided an immunoassay for detecting a bioactive antigen, particularly a hormone, protein or vaccine, in an individual biological sample, which comprises the following components:

[0016] - A sample application area for applying an individual biological sample, wherein the biological sample is preferably urine, whole blood, saliva, milk or serum of an individual;

[0017] - A capture area, wherein the capture area has an immobilized first antibody against the bioactive antigen, particularly against a hormone, protein or vaccine;

[0018] - A binding area, wherein the binding area has a second antibody against the bioactive antigen, particularly against a hormone, protein, peptide or vaccine; and optionally

[0019] - A control area that provides an antibody against the detection antibody;

[0020] wherein the first antibody and / or the second antibody is a recombinant antibody obtained from diatoms, unicellular plants or green plants, particularly a recombinant antibody obtained by the method defined herein,

[0021] wherein the recombinant antibody has a signal peptide specific to heterologous diatoms, plants or microalgae and / or a glycosylation pattern different from that of a natural antibody obtained from an individual (as defined herein).

[0022] Particularly preferably, the problem is solved by an immunoassay for detecting a bioactive antigen, particularly a hormone, protein or pharmaceutical substance, in an individual biological sample, which has:

[0023] - A sample application area for applying an individual biological sample, wherein the biological sample is preferably urine, whole blood, saliva, milk or serum;

[0024] - A capture area, wherein the capture area has an immobilized first antibody against the bioactive antigen, particularly against a hormone, protein, peptide or pharmaceutical substance;

[0025] - A binding region, wherein the binding region has a second antibody directed against a bioactive antigen, in particular against a hormone, protein, peptide or pharmaceutical substance;

[0026] wherein the first antibody and / or the second antibody is a recombinant antibody obtained from diatoms or unicellular plants,

[0027] wherein the purity of the recombinant antibody is at least 90%, preferably at least 95%. In an alternative preferred embodiment, the purity of the recombinant antibody is 80 to 99%, more preferably 85 to 99%, more preferably 90 to 99%, and most preferably 95 to 99%.

[0028] The biological sample of the individual can be whole blood, serum, saliva, urine or milk. Preferably, the biological sample of the individual is urine, whole blood or serum, particularly preferably urine.

[0029] According to a preferred embodiment of the invention, the immunoassay is a lateral flow immunoassay. For example, the lateral flow immunoassay provides a sample application area, a binding region and a capture region disposed on a membrane, wherein the sample application area and the capture region on the membrane are fluidly connected to each other through a flow path, and wherein the binding region is disposed in the flow path. For example, the membrane is a nitrocellulose membrane.

[0030] In a preferred embodiment, the immunoassay provides a nitrocellulose membrane.

[0031] Alternatively preferably, the immunoassay is an enzyme-linked immunosorbent assay (ELISA), such as a direct ELISA, an indirect ELISA, a direct sandwich ELISA or an indirect sandwich ELISA, preferably the ELISA is a direct sandwich ELISA or an indirect sandwich ELISA.

[0032] Cheaply, the first antibody and / or the second antibody (especially the mobile antibody of the two antibodies) can be labeled with a dye and / or an optically active nanoparticle (especially a gold nanoparticle).

[0033] Nevertheless, it can be provided that the first antibody and / or the second antibody (especially the mobile antibody of the two antibodies) is conjugated to an enzyme suitable for inducing a dye or luminescence reaction.

[0034] General advantages

[0035] To provide an immunoassay or a method for detecting a bioactive antigen in an individual's biological sample, recombinant antibodies from non-mammalian synthetic sources are used, so it is advantageous that animal or animal cell cultures, especially mammalian cell cultures, can be dispensed with.

[0036] In addition, the synthesis / expression of the recombinant antibodies used herein not only enables a similar high expression rate to be achieved in diatoms with much lower energy and resource requirements, but also eliminates the risk of antibody contamination by human pathogens, as is the case with synthesis / expression in animals or animal cell cultures. Detailed Description

[0037] In one embodiment of the present invention, there is provided an immunoassay for detecting a bioactive antigen in an individual biological sample, particularly a hormone, protein or drug substance, having:

[0038] - A sample application area for applying an individual biological sample, wherein the biological sample is preferably urine, whole blood, saliva, milk or serum;

[0039] - A capture area having an immobilized first antibody against the bioactive antigen, particularly against a hormone, protein, peptide or drug substance;

[0040] - A binding area having a second antibody against the bioactive antigen, particularly against a hormone, protein, peptide or drug substance;

[0041] wherein the first antibody and / or the second antibody is a recombinant antibody obtained from diatoms, unicellular plants or green plants, and the recombinant antibody contains a signal peptide specific to heterologous diatoms, plants or microalgae.

[0042] In a particularly preferred embodiment of the present invention, there is provided an immunoassay for detecting a bioactive antigen in an individual biological sample, particularly a hormone, protein or drug substance, providing:

[0043] - A sample application area for applying an individual biological sample, wherein the biological sample is preferably urine, whole blood, saliva, milk or serum;

[0044] - A capture area having an immobilized first antibody against the bioactive antigen, particularly against a hormone, protein, peptide or drug substance;

[0045] - A binding area having a second antibody against the bioactive antigen, particularly against a hormone, protein, peptide or drug substance;

[0046] wherein the first antibody and / or the second antibody is a recombinant antibody obtained from diatoms or unicellular plants, and the purity of the recombinant antibody is at least 90%, preferably at least 95%. In an alternative preferred embodiment, the purity of the recombinant antibody is 80 to 99%, more preferably 85 to 99%, more preferably 90 to 99%, and most preferably 95 to 99%.

[0047] Here, two different types of contamination can be distinguished:

[0048] - Non - protein contaminants, such as pigments;

[0049] - Other protein contaminants that are not antibodies.

[0050] These two groups of impurities interfere with antibody purification and function by having an adverse effect on the stability of the antibody and by reducing the specificity of immunoassays.

[0051] Non - proteins can generally be residues from the separation process, especially cell parts, culture medium components, such as fibers in higher plants. In the production of antibodies in diatoms, this group mainly includes pigments, which can be detected by spectrophotometry and easily separated because they have a much lower molecular weight than antibodies and different chemical properties. For this purpose, common methods known to experts, such as dialysis, ultrafiltration, size - exclusion chromatography, or charge - dependent separation (e.g., ion - exchange chromatography), are suitable. This separation is related to the amount of antibody separated. The lower the proportion of antibody in the culture, the greater the effort for separation. After separation, the amount of non - protein is preferably determined by gravimetric analysis, and for pigments, spectrometric methods are particularly preferred.

[0052] Protein contamination by non - antibodies can be analyzed by denaturing SDS - polyacrylamide gel electrophoresis (SDS - PAGE), on the one hand in combination with Coomassie Brilliant Blue staining and on the other hand in combination with immunostaining to identify the antibody, preferably the antibody chains produced in diatoms. For this purpose, after adding an appropriate buffer and denaturing (10 minutes at 80 °C), the protein mixture separated from diatoms is separated according to size. This standard procedure in molecular biology is well - known to experts (e.g., Reinard, Molekularbiologische Methoden 2.0 (UTB, p. 229ff; ISBN 978 - 3825287955)). The proteins separated in SDS - PAGE are stained with Coomassie Brilliant Blue, and the color intensity is measured by densitometry and / or comparison with standards. In this way, it is possible to determine how much protein is present in each band.

[0053] At the same time, another SDS - PAGE can be applied to the same sample that is not stained but transferred to a nitrocellulose membrane. The bands of the two chains of the antibody are clearly visible on this membrane. By adding a first antibody specific for the antibody chain, which is labeled, for example, with biotin, a radioactive isotope, a reporter enzyme, an oligonucleotide, or a fluorophore, or by adding a second labeled antibody directed against the first antibody, the two chains of the antibody to be detected become clearly visible. All bands that are not labeled in this way are contaminating proteins.

[0054] In a preferred embodiment, after separating and spectroscopically quantifying non-proteins, the ratio of the recombinant antibody to the total protein is determined by SDS-PAGE. This method enables the determination of the absolute amounts of antibody, total protein, and non-protein of the recombinant antibody obtained according to the present invention.

[0055] The purity of the purified recombinant antibody provided by the present invention for immunoassay is calculated according to the following formula:

[0056]

[0057] The purity of the recombinant antibody is determined after purification, before applying the antibody to the immunoassay according to the present invention or otherwise providing it.

[0058] In an alternative embodiment of the present invention, the protein purity of the recombinant antibody is at least 90%, preferably at least 95%. In an alternative preferred embodiment, the protein purity of the recombinant antibody is 80 to 99%, more preferably 85 to 99%, more preferably 90 to 99%, and most preferably 95 to 99%.

[0059] The protein purity of the recombinant antibody is calculated according to the following formula:

[0060]

[0061] According to a preferred embodiment, the ratio of the recombinant antibody to the total protein is determined by SDS-PAGE. After purification, the protein purity of the recombinant antibody is determined before applying the antibody to the immunoassay according to the present invention or otherwise providing it.

[0062] A particularly preferred embodiment is that due to the high productivity of the recombinant antibody according to the present invention, it is obtained at a high concentration of preferably 20 - 1000 mg / L of culture. Here, since there are no interfering fibers, cell debris and diatom-specific proteins can be easily separated. Therefore, the purity of the recombinant antibody according to the present invention is at least 90%, preferably at least 95%. Due to the high antibody purity, combined with the high homogeneity and consistency of the glycosylation pattern according to the present invention, the antigen can be specifically detected at a low concentration, that is, the detection limit of the immunoassay is low, thus achieving an improvement over the previously used animal antibody-based immunoassays. Due to the higher homogeneity of the antibody, the number of non-specific cross-reactions (non-specific signals) is lower, making the results of the immunoassay according to the present invention more reliable, where the sensitivity of the antibody is always high.

[0063] Due to their higher purity, antibodies are more stable and have a longer shelf life because the proteases that degrade antibodies are also removed along with the foreign proteins. In addition, the purity and homogeneity of antibodies mean that the number of non-specific cross-reactions (non-specific signals) is low, resulting in more reliable and reproducible results.

[0064] In a particularly preferred embodiment, as Figure 13 shown, commercially available antibodies clearly show additional bands due to non-specific reactions. These bands are absent in the gel lanes of the antibodies produced in diatoms, indicating that it has higher specificity than commercially available animal antibodies. In addition to reducing false positive signals, it also has the advantage of requiring less protein mass for immunoassays.

[0065] An "immunoassay" is a test method that uses the binding of antibodies to antigens to identify specific substances and / or quantify the amount of substances present. Immunoassays can be used for disease diagnosis and also for analyzing the physiological state of an individual (such as a human individual). Examples of disease diagnosis are the detection of various cancers and the detection of infections (such as Covid-19). Examples of physiological condition analysis are female conception (ovulation test) or pregnancy test. The terms immunoassay and immunassay can be used interchangeably.

[0066] Immunoassays can be used in different technical variants. The most well-known technical variants are enzyme-linked immunosorbent assay (ELISA or ELISA test) and lateral flow immunoassay (LFA), where a membrane (such as a paper-based platform) is used to detect and quantify analytes in complex mixtures, where a biological sample is placed on the test device and the result is shown within 5 - 30 minutes. Well-known examples of antibody-based LFA are the Covid-19 rapid test or pregnancy test.

[0067] The term "bioactive antigen" (also referred to as "antigen") used in the present invention refers to any substance, especially a molecule with a molecular weight of about 4,000 daltons or greater, preferably about 2,000 daltons or greater, and most preferably about 770 daltons or greater, which causes the body to trigger an immune response against the substance. Antigens include toxins, chemicals, bacteria, viruses, proteins, peptides, or other substances from outside the body. Antibodies are produced during the humoral immune response of vertebrates. These antibodies formed for the humoral immune response can also be used in vitro, independent of the immune response, to identify, characterize, and / or quantify antigens. For the purposes of the present invention, bioactive antigen and bioactive protein can be used interchangeably.

[0068] From a biological perspective, a bioactive antigen is understood to be a molecule (as defined herein) that is present in an individual and is recognized by an antibody. Specifically, this refers to molecules that represent proteins and / or hormones of humans and mammals, which can serve as markers for individual diseases (e.g., diagnosing breast cancer by detecting the Herceptin2 receptor) or for an individual's physiological state (e.g., pregnancy). Alternatively, preferably, the term refers to molecules that represent proteins and / or hormones in animals and / or plants, particularly for food analysis. The sequences of bioactive antigens, particularly hormones, proteins, or vaccine or drug substances, particularly preferably hormones (which can serve as markers for individual diseases (e.g., diagnosing breast cancer by detecting the Herceptin2 receptor) or for an individual's physiological state (e.g., pregnancy)), are known to those skilled in the art or can be obtained from relevant databases and specialized books.

[0069] Furthermore, bioactive antigens should be understood to be proteins from human pathogenic organisms, particularly bacteria (e.g., Streptococcus mutans (which cause tooth decay)) or viruses (e.g., the spike protein from Covid 19).

[0070] Preferably, the bioactive antigen is a hormone of an individual, such as human hormones selected from cortisol, thyroxine, growth hormone, antidiuretic hormone, testosterone, estrogen. The corresponding natural antibodies for detecting the hormones are known to those skilled in the art or can be found in the relevant literature.

[0071] According to a preferred embodiment, the bioactive antigen is a peptide hormone of an individual, such as human peptide hormones selected from gonadotropin-releasing hormone (10 amino acids), insulin (A chain: 21 amino acids, B chain: 30 amino acids), somatostatin (14 amino acids), glucagon (29 amino acids). The corresponding natural antibodies for detecting the hormones are known to those skilled in the art or can be found in the relevant literature.

[0072] According to a preferred embodiment, the bioactive antigen is a protein hormone of an individual, such as a human protein hormone, which is, for example, used as a physiological marker. Suitable protein hormones are, for example, selected from the group including parathyroid hormone (84 amino acids), HCG (human chorionic gonadotropin (hCG): alpha subunit: 92 amino acids, beta subunit: 145 amino acids). The corresponding natural antibodies for detecting the hormones are known to those skilled in the art or can be found in the relevant literature.

[0073] In addition, the bioactive antigen can be a protein, particularly a human protein, which is used as a disease marker and is selected from the group comprising Her2 (human epidermal growth receptor 2, which is overexpressed on the surface of cancer cells and is a cancer marker); IgE antibodies (which are produced by the human body in allergic reactions); small signaling proteins such as interleukin 5 (which is associated with allergic diseases, including allergic rhinitis and asthma); interferons (which have immunostimulatory effects, particularly antiviral and antitumor effects and can be used as markers for viral infections). The corresponding natural antibodies for detecting hormones are known to those skilled in the art or can be found in the relevant literature.

[0074] The bioactive antigen can be a protein of a human pathogen, such as the spike protein of a coronavirus (e.g., SARS-CoV-1 (for detecting SARS infection) or SARS-CoV-2 (for detecting Covid-19 infection)), or the HIV-1 nucleocapsid protein (for detecting HIV infection).

[0075] According to a preferred embodiment, the bioactive antigen is a hormone, a protein, and / or a drug substance. Particularly preferably, the bioactive antigen is a hormone, particularly a hormone that is a marker of the physiological state of an individual (such as pregnancy), particularly preferably human chorionic gonadotropin, and most preferably human chorionic gonadotropin.

[0076] In a lateral flow immunoassay (also referred to herein as "LFA"), three antibodies are typically used:

[0077] - A first immobilized antibody, which is arranged in the capture zone (also called the test zone) and is also called the capture antibody. Like the second antibody (also called the detection antibody), this also targets the antigen, preferably a different antigen epitope from the detection antibody;

[0078] - A second antibody, which is preferably arranged in the binding zone and is also called the detection antibody, which targets an epitope of an antigen (such as a hormone, a protein, or a peptide, such as human chorionic gonadotropin), wherein,

[0079] The second antibody is preferably conjugated to a labeled particle, such as gold, silver, latex, carbon, nanoparticles, fluorescent dyes, or enzymes.

[0080] - Other antibodies, which are preferably located in the control area (control zone),

[0081] Preferably immobilized and targeting the detection antibody / control antibody.

[0082] Preferably, the first antibody (e.g., capture antibody), the second antibody (e.g., detection antibody), and / or other antibodies (e.g., capture antibody in the control region), and particularly preferably all antibodies are from diatoms, unicellular plants, or green plants, and are characterized by the features defined herein.

[0083] Particularly preferably, the first antibody (e.g., capture antibody), the second antibody (e.g., detection antibody), and / or other antibodies (e.g., capture antibody in the control region), and particularly preferably all antibodies are from diatoms and are characterized by the features defined herein.

[0084] Compared with the use of animal antibodies, the advantage is also that the antibodies used in the test have consistent quality and reproducibility, thus improving the quality of the entire immunoassay, because, for example, the animals producing the antibodies die after a certain time, and the antibodies from another animal have different characteristics, i.e., the quality of the antibodies produced in the conventional manner fluctuates greatly. In addition, contrary to polyclonal antibodies obtained from an individual (as defined herein), the antibodies and accessory proteins obtained from diatoms, unicellular plants, or green plants are precisely defined antibodies, i.e., their amino acid sequences are predefined and consistent.

[0085] The term "individual" (also referred to herein as "subject") used in the present invention refers to any mammal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate), particularly rodents, ungulates, hoofed animals (preferably odd-toed), or primates. In a particularly preferred embodiment, the individual is a primate, particularly a human. Unless otherwise specified, the term "individual" does not denote a specific age and thus includes adults, the elderly, children, and newborns.

[0086] In a preferred embodiment of the immunoassay, the individual is a mammal, preferably a primate, and more preferably a human.

[0087] According to a preferred embodiment of the present invention, recombinant antibodies, such as the first antibody and / or the second antibody and / or other antibodies, are obtained by expression from diatoms (also known as Bacillariophyta), green algae (also known as Chlorophyta), or seed plants. Particularly preferred are recombinant antibodies obtained from diatoms or green algae, particularly diatoms, such as Phaeodactylum tricornutum. One advantage of this is that antibodies from plants (particularly from diatoms) cannot contain endogenous pathogens. Bovine spongiform encephalopathy (BSE) is an example, which is why animal antibodies may pose risks, particularly for therapeutic applications. Therefore, these antibodies must be strictly tested for the presence of possible human pathogens, which is not necessary for the recombinant antibodies according to the present invention (particularly preferably antibodies obtained from diatoms).

[0088] As used herein, the term "antibody" refers to an immunoglobulin (Ig) or a derivative of an immunoglobulin produced by the acquired immune system of a vertebrate. Examples of naturally occurring antibodies are IgM antibodies, IgG antibodies, IgA antibodies, and IgE antibodies, especially from mammals such as humans, rabbits, mice, rats, camels, llamas, goats, and / or horses. In addition, it also includes artificial forms based on such proteins, such as scFvs or scFv-Fc.

[0089] In some preferred embodiments of immunoassays, "antibody" herein refers to an immunoglobulin (Ig) or a derivative of an immunoglobulin, such as an immunoglobulin produced by the acquired immune system of a vertebrate and / or a chondrichthyan. Examples of natural antibodies are IgM antibodies, IgD antibodies, IgG antibodies, IgA antibodies, IgE antibodies, IgNAR antibodies, especially from mammals such as humans, rabbits, mice, rats, camels, llamas, goats, and / or horses and / or chondrichthyans such as sharks. In addition, it also includes artificial forms based on such proteins, examples of which are scFv, scFv-Fc, or single-domain antibodies / nanobodies.

[0090] "Natural antibody" in the context of the present invention is a natural antibody as it exists in an individual as defined herein, especially a vertebrate, particularly preferably a mammal, and most preferably a primate, especially a human.

[0091] According to a preferred embodiment, the antibody comprises at least a variable region and a constant / conserved region.

[0092] Preferably, the variable region is of vertebrate origin, preferably of mammalian origin, particularly preferably of human, murine, equine, canine, and / or camelid origin, very particularly preferably of human, murine, equine, and / or camelid origin, especially of human, murine, and / or equine origin. The variable region may have at least 50% sequence identity with a homologous sequence region of a vertebrate, preferably a mammalian (as defined above), preferably a human antibody in its amino acid sequence.

[0093] According to a preferred embodiment, the constant region is of vertebrate origin, preferably of mammalian origin, particularly preferably of human, canine, murine, equine, caprine, and / or camelid origin. The constant region may have at least 50% sequence identity with a homologous sequence region of a vertebrate, preferably a mammalian (as defined above), preferably a human antibody in its amino acid sequence.

[0094] In a preferred embodiment, the present invention is embodied as providing a nucleic acid sequence with an increased expression rate for producing a recombinant protein, which is provided with at least one expression cassette for expressing one or more peptides. Herein, the expression cassette according to the present invention comprises at least one promoter element and at least one first transcription unit encoding a protein, wherein the promoter element consists of the nucleic acid sequence of SEQ ID NO:1 or a nucleic acid sequence having at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% homology with SEQ ID NO:1.

[0095] The term "promoter" used in the present invention refers to a polynucleotide sequence located upstream of a gene and regulating the transcription of a functional gene. The promoter forms the recognition and binding site for RNA polymerase that initiates the transcription of the gene.

[0096] The term "homology" used in the present invention refers to the similarity between the nucleotide sequences of DNA or RNA and / or between the amino acid sequences of proteins.

[0097] In a preferred embodiment, SEQ ID NO:1 represents a promoter, hereinafter referred to as HASP1mod, which has been found to be particularly suitable for regulating protein production. Among them, the HASP1mod promoter is a promoter element derived from the natural HASP1 promoter, in which a partial sequence of the natural HASP1 promoter is duplicated.

[0098] SEQ ID NO:1 is as follows, where the underlined part represents the duplication:

[0099] 5'- CATACAGTGAATGTAACTTTCGAATTGACAGTATTAGTAGTCGT ATTGACAGTGAGGCACGCCC CTCAATGTGCGAGGTGGAAAATATACCAGCATGACAATGAATCTTGGAGATTCTTTTGCTGTCATCAAGATTCACC GCCAAATCTTCAGGAACCTATCACGTCCACAGGCGATGTTAATTCTTGAGTCGTCAAAACAAAGTCCTGTCCTACC TGTAGAAGTTGACAGCGAGCAATTGTATGCAAACTTCTGACTTTGTTATAATAACATTAAAGGTAATTAAGTATCT TCAATTAGGCATTTTGTCACTGTCAGTCCGTTCCGACAATATAGGTAGATTTGGAATGAATCTTTTCTATGCTCATACAGTGAATGTAACTTTCGAATTGACAGTATTAGTAGTCGTATTGACAGTGAGGCACGCCCCTCAATGTGCGAGGTGGAAAATATACCAGCATGACAATGAATCTTGGAGATTCTTTTGCTGTCATCAAGATTCACCGCCAAATCTTCAGGAACCTATCACGTCCACAGGCGATGTTAATTCTTGAGTCGTCAAAACAAAGTCCTGTCCTACCTGTAGAAGTTGACAGCGAGCAATTGTATGCAAACTTCTGACTTTGTTATAATAACATTAAAGGTAATTAAGTATCTTCAATTAGGCATTTTGTCACTGTCAGTCCGTTCCGACAATATAGGTAGATTTGGAATGAATCTTTTCTATGCTGCTGCGAATCTTGTACACCTTTGAGGCCGTAGATTCTGTCCGACGAAGCGATAATTATTGCAAAATACATGGACTCATTATTTTGATTCGATTTCTTTTTGGTATCCGACTCGAAAAGATCCATCACGGCGAGC-3'

[0100] In a preferred embodiment, the present invention comprises providing a nucleic acid sequence, the promoter element of which has repeated single HASP1 sequence fragments, for example between -100 and -1, between -200 and -101, between -300 and -201, between -400 and -301, and / or between -500 and -401 relative to the start codon ATG. Here, these fragments can be combined in any combination and copy number. This results in a new sequence with less than 85% homology to the native HASP1 promoter.

[0101] According to a preferred embodiment of the present invention, at least one transcription unit comprises a polynucleotide encoding the amino acid sequence of SEQ ID NO:2 or an amino acid sequence having at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, and further preferably at least 99% homology to SEQ ID NO:2.

[0102] SEQ ID NO:2 represents the amino acid sequence of an antibody hinge region, which is derived from a horse immunoglobulin sequence and has been shown to have particular protease resistance. Using this protease-resistant hinge region can significantly reduce the proteolysis of antibodies produced in different forms and from different species, both in vivo and in vitro.

[0103] SEQ ID NO:2 is as follows:

[0104] VIKEPCCCPKCP

[0105] In a preferred embodiment of the present invention, a vector or isolated nucleic acid comprising the nucleic acid according to the present invention in simple or repeated form can be provided, and a cell comprising the vector according to the present invention or the isolated nucleic acid according to the present invention or the nucleic acid sequence according to the present invention or the amino acid sequence according to the present invention can be provided.

[0106] In addition, an amino acid comprising SEQ ID NO:2 or an amino acid sequence having at least 70%, preferably at least 80%, particularly preferably at least 90%, very particularly preferably at least 95%, further preferably at least 99% homology with SEQ ID NO:2 is also provided.

[0107] According to the present invention, the cell is a photosynthetically active cell, particularly a unicellular plant, preferably a diatom.

[0108] Preferably, the recombinant antibody has a cysteine-rich amino acid sequence in the hinge region, which sequence comprises at least 20 amino acids, preferably at least 15 amino acids, particularly preferably at least 12 amino acids, wherein at least 33% of the amino acids comprise cysteine. According to a particularly preferred embodiment, the amino acid sequence in the hinge region comprises or consists of the following: (a) the sequence VIKEPCCCPKCP or (b) a sequence with a sequence identity deviating from this amino acid sequence by at most 30%, particularly at most 20%, particularly preferably at most 15%, or (c) an amino acid sequence having only one amino acid substitution compared to the variant according to (a).

[0109] In a particularly preferred embodiment, the productivity reaches 20 mg / L to 1000 mg / L, particularly preferably 30 mg / L to 1000 mg / L of antibody per liter of culture. Such high productivity is absolutely necessary for the technical utilization of the antibody, because separation and purification at concentrations below 20 mg / L are technically not feasible and thus absolutely necessary for economic applicability at reasonable purification costs. These values are within the typical range of commercially used animal CHO (Chinese hamster ovary) cell cultures and are thus far higher than the production capacities achieved by diatoms, microalgae, unicellular plants, and / or green plants to date. Diatoms or other microalgae may become a real competitor to CHO cells with their production capabilities, which was unforeseeable before.

[0110] Particularly preferred embodiments are those in which a recombinant antibody is obtained in a concentration of 20 mg / L to 1000 mg / L, more preferably 30 mg / L to 800 mg / L, or at least 30 mg / L to 160 mg / L in a diatom or unicellular plant culture. This high productivity is the result of the inventors' discovery that various modifications to diatoms can lead to unexpectedly high yields, such as at least a 100-fold increase compared to the prior art. This makes it technically feasible to obtain and purify antibodies with high purity and homogeneity from diatoms. The productivity in diatoms can be increased from a conventional maximum of 3 mg of antibody per liter of culture to, for example, at least 160 mg of antibody per liter of culture. Particularly preferably, the productivity in diatoms can be increased from a conventional maximum of 3 mg of antibody per liter of culture to 300 mg of antibody per liter of culture, corresponding to a 100-fold increase. In some very preferred embodiments, the productivity can be increased to 1000 mg / L of culture, corresponding to a 333-fold increase.

[0111] The cultures in the present invention include diatoms, a culture medium, and all other additives required to provide the recombinant antibody according to the present invention.

[0112] The culture medium according to the present invention includes a liquid, preferably an aqueous liquid containing salts, which provides appropriate nutrients, temperature, pH value, and other conditions to promote the growth and proliferation of cells (particularly preferably microalgae, and even more preferably diatoms).

[0113] In some embodiments of the present invention, the recombinant antibody is provided at a concentration of at least 100 mg / L of culture, more preferably at least 250 mg / L; most preferably at least 500 mg / L. Here, it is at least 33-fold, more preferably at least 83-fold, and most preferably 166-fold higher than the previously reported values.

[0114] According to a preferred embodiment of the immunoassay method, the glycosylation of the first antibody and / or the second antibody has an altered glycosylation pattern compared to the corresponding native antibody. Preferably, the glycosylation has a more homogeneous pattern, with a homogeneity factor in the range of 1 to 3. Particularly preferably, the glycosylation has a homogeneous, mannose-rich N-glycan pattern, and the homogeneity factor is preferably in the range of 1 to 3.

[0115] In the present invention, the homogeneity factor refers to the ratio of the number of well-separated and defined peaks in the chromatogram between an antibody in the sense of the compounds of the present invention, preferably an antibody expressed from diatoms, and the corresponding native antibody and / or animal antibody, as determined by HPLC (High Performance Liquid Chromatography) and / or UPLC (Ultra Performance Liquid Chromatography) in combination with MS and / or HRMS and / or UV / Vis and / or diode array. A homogeneity factor of 1 means 1 less peak, a homogeneity factor of 2 means 2 less peaks, and so on. In a particularly preferred embodiment (Figs. 5 - 7), a homogeneity factor of 3 is achieved; the comparative antibodies derived from human cell cultures (Figs. 5 and 6) each have 6 peaks, while the recombinant antibodies according to the present invention have only 3 peaks.

[0116] In a preferred embodiment of the immunoassay, the glycosylation of the first antibody and / or the second antibody exhibits a higher homogeneity of glycosylation pattern compared to the corresponding native antibody, preferably a homogeneous high-mannose N-glycan pattern, without the additional addition of mannose in the culture medium.

[0117] The difference in the glycosylation pattern of the antibodies according to the present invention from the mammalian system stems from the presence of different "high-mannose" N-glycans (from mannose-5 to mannose-9). However, compared to native mammalian cells with a relatively low mannose content, commercially used cell cultures (such as CHO cells) have a higher mannose content due to the intentional addition of mannose. Antibodies based on CHO typically exhibit a significantly heterogeneous glycosylation profile. A clear distinction can be seen in Figs. 5 - 7. Consistency in glycosylation (recognizable by the numerous peaks in the boxed area of Fig. 5) is not typically given in CHO, Expi, and other animal or human cells or cell cultures.

[0118] This inconsistency affects the specificity and stability of the antibody. Therefore, to achieve higher consistency (despite the associated drawbacks), mannose is usually added to animal or human cell cultures. Diatoms are naturally rich in mannose. In addition, our antibodies exhibit significant homogeneity, i.e., antibodies from different cells in the culture exhibit a homogeneous glycosylation pattern (Fig. 5). Therefore, the likelihood of adverse characteristics (such as the detection of foreign proteins and fluctuations in antibody stability) is greatly reduced.

[0119] Today, recombinant antibodies are either produced in animals or through human- or animal-based expression systems (i.e., eukaryotic cell lines). Here, mammalian cell systems are preferred, especially when it comes to complex proteins (such as antibodies), where complex post-translational modifications are crucial for their analytical or therapeutic efficacy. These post-translational modifications include the glycosylation pattern of the antibody. A major problem with currently produced recombinant proteins is that they have inconsistent glycosylation patterns. Thus, recombinant antibodies from currently used expression systems (especially from individuals) are often hyperglycosylated, i.e., for example, more mannose residues are inserted, and these mannose residues often also have unusual branching. These mannose residues may "break" (degrade) and / or this may lead to protein ineffectiveness or unwanted side reactions in the immune system.

[0120] According to a preferred embodiment of the present invention, the glycosylation (also referred to as the glycosylation pattern) of an antibody (as defined herein), such as a first antibody and / or a second antibody and / or any other antibody, is different from the corresponding natural antibody present in an individual. Particularly preferred is that the glycosylation pattern of a recombinant antibody (as defined herein) is more homogeneous than the glycosylation pattern of the natural antibody expressed in an individual (as defined herein) (compare with Figure 7, see Figures 5 and 6 for example). Thus, the glycosylation pattern of a recombinant antibody (as defined herein) has fewer branches compared to the natural antibody (e.g., which may "break" (degrade) as described above and / or (in combination) may lead to antibody ineffectiveness or adverse side reactions in the immune system). The recombinant antibodies disclosed herein (i.e., antibodies obtained from diatoms, unicellular plants, or green plants) represent so-called biosimilars. Preferably, such antibodies with a glycosylation pattern different from the corresponding natural antibody are preferably used as markers of an individual's disease or as markers of an individual's physiological state.

[0121] In a preferred embodiment of the immunoassay, the recombinant antibody is a chimeric antibody, where the chimeric antibody comprises at least one first sequence selected from at least one first organism and at least one second sequence selected from at least one second organism. The first and second organisms are different organisms. The first sequence can be a heavy chain or a part of the heavy chain, and the second sequence can be a light chain or a part of the light chain. The hinge region, which is a defined part of the heavy chain sequence, can be derived from the same organism as the rest of the heavy chain sequence or preferably from a different organism.

[0122] In an alternative embodiment, the first sequence can be selected from the first organism and the second organism. In a further alternative embodiment, the second sequence can be selected from the first organism and the second organism.

[0123] The provision of chimeric antibodies results in new non-naturally occurring antibodies. These antibodies are carefully designed using computer simulation processes to generate sequences not found in nature. Process optimization leads to the creation of antibody regions with sequences that match database sequences from a range of animal and human sources. Thus, the resulting antibodies are chimeric antibodies or chimeric proteins that contain genetic sequences from different species.

[0124] The present invention differs from traditional methods of producing chimeric antibodies. Although chimeric antibodies have been produced in animal cell cultures, this method requires the use of transgenic animals. In contrast, the invention described in the patent is capable of producing chimeric antibodies in diatoms and thus does not require transgenic organisms, particularly transgenic animals.

[0125] For example, the antibodies synthesized using this method have a basic structure corresponding to the human immunoglobulin IgG4 sequence.

[0126] In a preferred embodiment, the chimeric protein can have the following general structure consisting of a heavy chain, a light chain, and a hinge region:

[0127] a) Heavy chain (exemplary structure):

[0128] · C H 1–C H 3 - Without a hinge region, at least 80% homologous to human IgG4; for example, hinge-less C H 1 contains 116 - 118 amino acids, C H 2 and C H 3 together contain 215–220 amino acids, where the hinge region typically contains 10 - 14 amino acids, and 80% homology means that C H 1, C H 2 and C H 3 have a minimum of 331 amino acids and a maximum of 338 amino acids, with 264 - 270 amino acids at 80%.

[0129] · The hinge region corresponds to a protected sequence, at least 80% of the template of the further hinge region, which is particularly protease-resistant and preferably derived from the order Perissodactyla, particularly preferably the family Equidae.

[0130] · The variable chain is homologous to IgG sequences of very different organisms (preferably selected from humans, mice, and rabbits).

[0131] b) Light chain (exemplary structure):

[0132] · The constant region of the light chain is homologous to the constant region of the light chain of the order Perissodactyla (particularly preferably the family Equidae).

[0133] · The variable chain is homologous to the light chain IgG sequences of very different organisms, preferably selected from humans, mice, rabbits, and particularly preferably the variable chain of the human kappa light chain. These are also found to have an impact on production yield and protease resistance.

[0134] Preferably, depending on the sequences used, different combinations result in an increase or decrease in the productivity of the target protein or antibody.

[0135] An important feature of the present invention is the variability of the intra-sequence domain combinations. Depending on the selected sequence arrangement, different productivities of the target protein can be achieved. This flexibility enables the adjustment of protein productivity to the desired level.

[0136] In summary, the present disclosure provides a method for producing antibodies using diatoms, which produces non-naturally occurring chimeric antibodies and / or chimeric proteins having sequences from multiple species. This innovation bypasses the reliance on transgenic animals and provides benefits such as customizable protein design, improved production control, and potential applications in various fields such as diagnostics and therapeutics. In particular, properties such as stability, selectivity, and productivity can be specifically optimized and controlled through the targeted design of these antibodies.

[0137] In a preferred embodiment, the immunoassay according to the present invention comprises at least one other antibody and / or accessory protein, wherein preferably, the other antibody and / or accessory protein is obtained from diatoms and / or single-celled plants and / or green plants, and particularly preferably is vegan.

[0138] Vegan in the context of the present invention, specifically a vegan immunoassay in the context of the present invention, is an assay produced by biotechnological methods and methods in accordance with the principles of veganism. This means that the development of these products does not use animal materials and / or animal cell cultures or by-products, and no animal testing is performed during the manufacturing process.

[0139] In addition to the first antibody and / or the second antibody, the immunoassay can also provide another antibody and / or another accessory protein. The accessory protein, for example, serves as a blocker to saturate the free surface of the reaction vessel or membrane (i.e., the region where the antibody is not immobilized and non-specific binding may occur). For example, the accessory protein is bovine serum albumin (BSA), casein, modified BSA, or modified casein, which is used as a blocker, for example, to saturate the free surface.

[0140] The accessory protein (as defined herein) can perform multiple functions:

[0141] - Membrane saturation: The membrane (e.g., nitrocellulose membrane) binds proteins from any source efficiently. Thus, antibodies can bind firmly to the membrane in immunoassays (e.g., LFA). However, between the regions where the antibody saturates the membrane, there are still membrane regions that are not bound to proteins. Proteins in the sample to be tested will bind to them, resulting in false results. If the antigen is immobilized (e.g., in ELISA), the antibodies used in the test will bind specifically to the antigen but also non-specifically to the surface. Evaluation cannot be carried out. These protein-blocking proteins bind to the protein-binding surface, enabling the antibody to bind specifically only to its antigen, and thus play a central role in immunoassays.

[0142] - These auxiliary proteins are also useful during the incubation of antibodies and antigens. An excess of auxiliary proteins (e.g., BSA and / or casein in milk) ensures that proteases contained in the sample (which can degrade the antigen or antibody) can also use BSA or casein as a substrate for proteolysis. The more BSA there is in the solution, the lower the risk (statistically) of accidental proteolytic destruction of the antibody due to the excess of casein / BSA in the solution.

[0143] According to a particularly preferred embodiment, in addition to the recombinant antibody, the immunoassay can further include another antibody and / or one or more other auxiliary proteins. Generally, auxiliary proteins are used, for example, to saturate (block) free binding sites on the matrix (i.e., regions that have not yet immobilized the proteins in the sample to be analyzed). Since the matrix usually binds proteins and antibodies are proteins, the antibodies will non-specifically bind to these free regions and can no longer bind to their immobilized antigens. Therefore, in all immunoassays, these regions of the reaction vessel, microtiter plate, or membrane are saturated with one or more auxiliary proteins. Generally, especially in the prior art, these auxiliary proteins of animal origin, such as bovine serum albumin (BSA), are casein, which saturates the free surface on the matrix as a blocking agent. Casein and casein can be used interchangeably.

[0144] In a particularly preferred embodiment of the present invention, the auxiliary protein (as defined herein) can perform multiple functions:

[0145] - Membrane saturation: The membrane (e.g., nitrocellulose membrane) binds proteins from any source efficiently. Thus, the proteins to be analyzed in immunoassays (e.g., antibodies in LFAs) can bind firmly to the membrane. However, between the regions where proteins bind to the membrane, there are still membrane regions without bound proteins. In immunoassays such as ELISA or immunoblotting, antibodies will bind to them and can no longer detect their antigens. Using LFAs, proteins from the sample to be tested will be bound by these free membrane regions, leading to false results. These auxiliary proteins block the protein-binding surfaces, enabling antibodies to bind specifically only to their antigens and thus playing a central role in immunoassays.

[0146] - These auxiliary proteins are also useful during the incubation of antibodies and antigens. Excess auxiliary proteins (e.g., BSA and / or casein in milk) ensure that proteases contained in the sample (which can degrade antigens or antibodies) can also use BSA or casein as substrates for proteolysis. Since there is an excess of casein / BSA in the solution, the more BSA there is in the solution, the lower the risk (statistically) of accidental proteolytic destruction of the antibodies.

[0147] Traditionally obtained BSA and casein are from animals. Although initially inexpensive, purifying BSA requires a great deal of technical effort. In particular, removing (human) pathogenic viruses and prions (e.g., BSE, "mad cow disease") requires a huge effort. Other sources (such as bacteria or yeast) cannot heterologously produce BSA because it is not only glycosylated but also contains various post-translationally modified amino acids. Thus, as disclosed herein, extracting vegan BSA from diatoms, unicellular plants, or green plants, particularly from diatoms, has the advantage of not requiring purification and removal of (human) pathogenic viruses and prions.

[0148] Other antibodies or excipients are preferably recombinant antibodies or recombinant proteins, which are obtained from diatoms, unicellular plants, or green plants respectively (as also defined herein), and thus contain heterologous diatom, plant, or microalgae-specific signal peptides and / or a glycosylation pattern different from that of natural antibodies obtained from an individual (as defined herein).

[0149] In a particularly preferred embodiment, the other antibodies or excipients are recombinant antibodies or recombinant proteins respectively, which are obtained from diatoms or unicellular plants respectively (as also defined herein), and thus have heterologous diatom, plant, or microalgae-specific signal peptides and / or a glycosylation pattern different from that of natural antibodies obtained from an individual (as defined herein).

[0150] In a preferred embodiment of the immunoassay, the amino acid sequence of the first antibody and / or the second antibody has a vertebrate antibody, preferably a mammalian antibody, particularly preferably a human antibody; or it has or consists of an amino acid sequence that has at least 80%, preferably at least 85%, particularly preferably at least 90%, most preferably at least 95%, particularly preferably at least 97% sequence identity with the homologous sequence region of a vertebrate antibody and / or a mammalian antibody and / or a human antibody. In this way, compatibility with a series of target antigens can be ensured, and high-quality antibodies can be achieved.

[0151] In a preferred embodiment of the present invention, the nucleic acid sequence encoding the first antibody and / or the second antibody is codon-optimized for the host organism from which the first antibody and / or the second antibody is obtained, preferably codon-optimized for Phaeodactylum tricornutum.

[0152] When codon optimization is carried out, the base sequence is also adjusted simultaneously. For example, for the convenience of cloning recombinant DNA, one aspect is to remove unwanted or undesirable restriction enzyme recognition sites in the recombinant DNA.

[0153] Therefore, the present invention also includes nucleic acids encoding the first antibody, the second antibody, other antibodies and / or accessory proteins, wherein the sequence of the nucleic acid is codon-optimized for expression in diatoms, unicellular plants or green plants, particularly in diatoms.

[0154] Therefore, the present invention preferably also includes nucleic acids encoding the first antibody, the second antibody, other antibodies and / or accessory proteins, wherein the sequence of the nucleic acid is codon-optimized for expression in diatoms or unicellular plants, particularly in diatoms.

[0155] The inventors have also developed a method that does not consider (as is usually the case) each codon individually for codon optimization of the sequence. Instead, a position-specific matrix is used to create a profile of the codon frequency of the entire original sequence, and this profile is used to transfer the codon frequency at each position to the sequence codon-optimized for diatoms. In this way, the folding of the antibody chain is directly optimized after translation because the translation speed of the difficult-to-fold regions in the antibody chain is slightly slower than that of the easy-to-fold regions. This directly affects the amount of antibody produced and is also related to the high homogeneity of the antibodies produced in diatoms.

[0156] In addition, the codon-optimized sequence of the nucleic acid for expression in a host organism (as defined herein) has the following advantages: the folding of the antibody is improved to correspond to the natural counterpart of the antibody, thereby enhancing the stability of the antibody and increasing the biological activity of the antibody expressed in the host organism (as defined herein).

[0157] Furthermore, the codon-optimized nucleic acid sequence has the advantage that, compared to a non-codon-optimized nucleic acid sequence, the expression rate in the host organism is increased by at least 10-fold, preferably by at least 20-fold, particularly preferably by at least 30-fold, and most preferably by at least 40-fold. For example, the productivity in diatoms can be increased from a maximum of 3 mg of antibody per liter of culture to 160 mg of antibody per liter of culture. Particularly preferably, the productivity in diatoms can be increased from a maximum of 3 mg of antibody per liter of culture to 100 - 1000 mg of antibody per liter of culture. Particularly preferably, the productivity in diatoms can be increased from a maximum of 3 mg of antibody per liter of culture to 300 mg of antibody per liter of culture, corresponding to a 100-fold increase. In some very preferred embodiments, the productivity can be increased to 1000 mg / L of culture, corresponding to a 333-fold increase.

[0158] Preferably, the recombinant antibody of the present invention is modified in the hinge region such that it has increased stability against diatom-, plant- or microalgae-specific proteases compared to the native antibody, preferably having a stability of 1.1 to 5-fold. This increases the yield of the antibody during the purification process (also known as the downstream process), and produces fewer interfering degradation products, which reduce the purity of the antibody obtained from the culture, resulting in a higher homogeneity of the recombinant antibodies defined by the present invention obtained from the culture, and these recombinant antibodies provide more specific signals and fewer cross-reactions.

[0159] The increased stability is related to the stability of the diatom's own enzymes, especially proteases, which can attack the hinge region of the antibody and cleave it. The stability factor is related to the increased time that the antibody with a modified hinge region is stable against proteases under culture conditions, which increases the production volume, especially the yield of functional recombinant antibodies after separation. Since there are fewer proteolytically cleaved antibody fragments, the antibody solution is more homogeneous and can be detected more specifically, with significantly fewer cross-reactions.

[0160] In a preferred embodiment, the stability factor between the native hinge antibody and the recombinant antibody with a modified hinge of the present invention is preferably determined in SDS PAGE. The stability factor can be determined by the degradation products of the recombinant antibody, which results in additional bands in Coomassie blue staining. By adding certain proteases (preferably diatom, animal, human, plant or microalgae specific proteases) to the recombinant antibody with a modified hinge and the antibody with a native hinge and performing SDS-PAGE at certain time intervals, it can be determined in SDS-PAGE how many intact antibodies are present after this time and how many proteolytically generated fragments are detected. The absolute ratio can be determined in an OD manner, and the quotient of the recombinant antigen concentration and the native antibody concentration gives the stability factor. In a particularly preferred embodiment, the stability factor is between 1.1 and 10, particularly preferably between 1.1 and 5, and most preferably between 1.1 and 3.

[0161] According to a preferred embodiment of the present invention, the amino acid sequence of the antibody, such as the amino acid sequence of the first antibody and / or the second antibody and / or each other antibody, is modified such that it has increased stability against diatom, animal, human, plant or microalgae specific proteases.

[0162] For example, the amino acid sequence of the antibody, such as the amino acid sequence of the first antibody and / or the second antibody and / or each other antibody, is modified in the hinge region such that it has increased stability against host specific, particularly diatom, plant or microalgae specific proteases. In this way, the stability of the antibody in the host organism expressing the antibody can be increased, and thus the yield of intact antibodies in the culture can also be increased.

[0163] Particularly preferred is an embodiment of the immunoassay in which the recombinant antibody is expressed by a stably transformed diatom or unicellular plant, preferably by a stably transformed diatom for several generations, preferably at least 60 generations, more preferably at least 80 generations, and most preferably at least 100 generations. Thus, a high yield can be ensured while ensuring the high quality of the antibody, and thus the assay quality of different batches can be ensured.

[0164] A generation in the sense of the present invention ends with cell division and represents the unit of cell replication. For example, 60 generations correspond to 60 consecutive cell divisions starting from an initial cell. Similarly, the "generation time" refers to the time interval between two consecutive generations of organisms in a population. It is the time required for a single cell or organism to divide and produce two new cells or organisms. The generation time is a fundamental parameter characterizing the growth rate of unicellular organisms. It provides information on the reproduction rate of a genetically identical cell population under optimal conditions (mitosis). A shorter generation time represents a faster growth rate and higher reproductive ability, while a longer generation time represents a slower growth rate and possibly more complex cell processes.

[0165] In a preferred embodiment of the present invention, the generation time is from 6 to 48 hours, preferably from 12 to 24 hours. This generation time is significantly shorter than that of higher green plants known in the prior art, such as tobacco (N. tabacum). Due to the short generation time, the culture grows faster, and thus the antibody production capacity is significantly higher than that of higher plants.

[0166] Transiently modified higher plants are genetically modified plants in which foreign genetic material (such as genes encoding certain proteins or traits) is introduced into plant cells for a short period of time. This change is temporary and does not result in the integration of foreign genes into the plant genome. Instead, the foreign genes are expressed and the desired characteristics are produced only for a limited time. Therefore, this information is lost after one generation, which results in a great deal of effort in culturing the cell culture and in product quality control. In contrast, the antibodies of the present invention can be stably expressed over multiple generations, thus enabling high-quality and controllable conditions.

[0167] The stably transformed cultures according to the present invention are capable of expressing the antibody for at least 60 generations, preferably at least 80 generations, and particularly preferably at least 100 generations.

[0168] In a preferred embodiment, the antibody is stably expressed in the culture for at least 30 days, more preferably at least 40 days, and most preferably at least 60 days after inoculating the culture.

[0169] In addition to other advantages compared to higher plants that produce antibodies transiently or stably, diatoms do not contain fibers, which greatly facilitates the purification of the antibodies.

[0170] Particularly preferably, in the context of the immunoassay according to the present invention, the antibody is expressed intracellularly, preferably in stably transformed diatoms. So far, in the prior art, antibodies have been obtained from diatoms using extracellular secretion because the antibodies are directly released into the culture medium. Theoretically, this would result in easier separation, but the authors unexpectedly found that intracellular expression results in significantly higher production levels.

[0171] This outstanding achievement of the inventors, combined with the other characteristics of the antibodies described herein, results in a sharp increase in antibody production, preferably by more than 100-fold.

[0172] In a preferred embodiment, the first and / or second antibody can be an antibody against human chorionic gonadotropin (hCG), preferably, the antibody is an hCG antibody. hCG is a glycoprotein hormone that is produced before embryo implantation, indicating pregnancy at a very early stage and is mainly produced by the placenta during pregnancy. It plays a crucial role in maintaining the corpus luteum, which in turn produces progesterone to support the early stages of pregnancy. Antibodies against hCG can be used in various applications, including pregnancy diagnostic tests. Pregnancy tests detect the presence of hCG in urine or blood, which indicates pregnancy. These antibodies serve as recognition elements that bind to hCG molecules and generate a measurable signal to confirm pregnancy. This enables early detection of pregnancy, especially as a PoCT. PoC in the present invention represents point-of-care, and similarly, PoCT represents point-of-care testing, i.e., patient-centered self-diagnosis. This concept refers to medical diagnostic tests performed near the patient, usually outside the traditional laboratory environment.

[0173] In a preferred embodiment, the immunoassay for the recombinant antibody against the hCG protein is provided in the form of a lateral flow immunoassay, particularly preferably in the form of a kit. Thus, the immunoassay can be provided near the patient, enabling simple and rapid on-site diagnosis.

[0174] In a preferred embodiment, the bioactive antigen is part of a viral epitope, and the virus is preferably a pathogenic virus, such as influenza virus, SARS-CoV-2, RSV, adenovirus, Streptococcus A (Strep A), norovirus, rotavirus, HIV. Preferably, the immunoassay uses highly specific antibodies to recognize and bind to a selected part of the epitope, enabling rapid and accurate identification of viral infections. This method aids in early diagnosis, thus enabling early and targeted treatment, as well as the ability to continuously and closely monitor the progression of the infection and rapidly detect outbreaks, ultimately contributing to timely public health responses and effective containment strategies.

[0175] In a preferred embodiment, the bioactive antigen is a tumor-associated sequence, preferably a sequence part of the HLA complex and / or tumor epitope and / or tumor marker, such as IFN-γ, IL-8, PSA, CEA, AFP, DCP, CA 125, HER2 / neu. This enables early detection and treatment of malignant degeneration, thus greatly increasing the patient's chance of recovery. In a preferred embodiment, as a lateral flow assay, it can be used as a PoCT for early diagnosis. In a particularly preferred embodiment, as an LFA or ELISA, the immunoassay serves as a diagnostic tool performed by medical staff in a laboratory or medical institution.

[0176] IFN-γ (Interferon-γ) is a cytokine produced by immune cells in response to infection and plays a key role in the immune response against pathogens. Antibody-based immunoassays can accurately detect IFN-γ in patient samples, which helps in diagnosing immune system diseases, monitoring autoimmune diseases, and assessing the response to immunotherapy.

[0177] IL-8 (Interleukin-8) is a chemokine involved in inflammatory responses and immune cell recruitment. Detecting IL-8 using antibody-based immunoassays helps in understanding inflammation-related conditions such as autoimmune diseases, allergies, and infections, and enables accurate monitoring and assessment of treatment.

[0178] PSA (Prostate-Specific Antigen) is a protein produced by the prostate. Elevated levels may indicate problems in the prostate, including cancer. Antibody-based immunoassays can accurately measure PSA, which helps in the early detection of prostate cancer, risk assessment, and monitoring of treatment effectiveness.

[0179] CEA (Carcinoembryonic Antigen) is a glycoprotein that is elevated in certain types of cancer, especially colorectal cancer. Antibody-based immunoassays can sensitively detect CEA, which helps in diagnosing cancer, monitoring treatment progress, and detecting possible recurrence.

[0180] AFP (Alpha-Fetoprotein) is a protein formed during fetal development. Elevated levels in adults may indicate liver disease or certain types of cancer, such as liver cancer. Antibody-based immunoassays can accurately detect AFP, thus supporting early diagnosis and monitoring the success rate of treatment.

[0181] DCP (Des-γ-Carboxy-Prothrombin) is a protein produced by hepatocytes. Elevated DCP levels are associated with liver cancer. Antibody-based immunoassays can accurately measure DCP, which helps in the early detection of hepatocellular carcinoma and monitoring the success rate of treatment.

[0182] CA 125 (Cancer Antigen 125) is a protein that is elevated in certain cancers, especially ovarian cancer. Antibody-based immunoassays provide a reliable method for measuring CA 125 levels, which helps in diagnosing ovarian cancer, monitoring disease progression, and assessing the success rate of treatment.

[0183] HER2 / neu (Human Epidermal Growth Factor Receptor 2) is a protein involved in regulating cell growth. Elevated levels are associated with certain aggressive breast cancers. Detecting HER2 / neu using antibody-based immunoassays helps in determining appropriate treatment strategies in breast cancer patients, predicting disease progression, and monitoring the success rate of treatment.

[0184] In a preferred embodiment of the immunoassay, the bioactive antigen is a characteristic sequence for identifying a protein, preferably an enzyme tag, particularly preferably selected from 6xHis tag, Strep tag, c-Myk tag, Flag tag, and GST tag. This enables the immunoassay to detect these protein tags, thereby providing specificity and sensitivity to accurately quantify, purify, and characterize proteins in various research settings.

[0185] The 6x His tag is a short peptide sequence with 6 histidine residues, which is usually fused to a protein gene. Due to the strong binding affinity between histidine and divalent metal ions (such as nickel), this fusion tag enables the effective purification of the labeled protein using immobilized metal affinity chromatography (IMAC). In antibody-based immunoassays, specific antibodies can recognize and bind to the 6xHis tag, thus facilitating the detection and quantification of proteins. The technical advantage of the immunoassay lies in its high specificity and sensitivity, enabling precise measurement of the labeled protein even in complex biological samples.

[0186] The Strep tag is a peptide tag characterized by an 8-amino acid sequence (WSHPQFEK), which has a high binding affinity for streptavidin protein. When the Strep tag is fused to the target protein, it can be directly purified by interacting with a streptavidin-coated surface. In antibody-based immunoassays, antibodies that recognize the Strep tag can selectively bind to the tag of the target protein. This method can efficiently and specifically detect the target protein, making it valuable for various research and diagnostic applications.

[0187] The c-Myc tag is derived from the c-Myc protein and consists of 10 amino acids (EQKLISEEDL). It is commonly used as a fusion tag to facilitate the detection and purification of proteins. In antibody-based immunoassays, antibodies against the c-Myc tag can specifically bind to the tag, enabling sensitive detection and quantification of the labeled protein. The technical advantage of this technique lies in its versatility, as it can be used for a wide range of protein research and testing.

[0188] The Flag tag is a peptide sequence (DYKDDDDK), usually linked to the N-terminus or C-terminus of a protein to facilitate protein identification and separation. It can be recognized by commercially available anti-flag antibodies and enables easy detection and purification of proteins. The technical advantage of the antibody-based Flag tag immunoassay lies in its stability and wide availability, making it a popular choice for researchers studying recombinant proteins.

[0189] The GST tag is derived from glutathione S-transferase and is commonly used in protein expression, purification, and interaction studies. The combination of this tag with glutathione-conjugated matrices enables one-step efficient purification. In antibody-based immunoassays, specific antibodies against the GST tag can detect and quantify the labeled protein. The technical advantages of such immunoassays lie in their simplicity and the possibility of achieving high protein yields and purity through an affinity purification step.

[0190] In a preferred embodiment of the immunoassay, the bioactive antigen is a sequence related to a nutritional parameter, such as transcobalamin II, ferritin, homocysteine, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), or calcitriol. This allows for the examination of important parameters that enable an individual or subject (preferably human) to examine and improve their health status. Specifically, individuals with certain eating habits may be deficient in certain vitamins and trace elements, and the immunoassay according to the present invention, preferably embodied as an LFA and particularly preferably as a PoCT, can help detect and compensate for these deficiencies. In an alternative embodiment, the results of the immunoassay are merely recommendations rather than medical indications.

[0191] Transcobalamin II (TCII) is a transport protein that plays a crucial role in the transport of vitamin B12 (cobalamin) in the body. It binds to vitamin B12 and facilitates its transport to cells for various biochemical processes. The presence of TCII can indicate vitamin B12 deficiency or certain diseases. Immunoassays based on antibodies targeting TCII are capable of accurately detecting and quantifying this protein in clinical samples, contributing to the diagnosis and monitoring of diseases related to vitamin B12 metabolism.

[0192] Ferritin is a protein that stores and releases iron in a controlled manner, contributing to iron homeostasis in the body. Measuring ferritin levels is crucial for assessing iron status and diagnosing diseases such as iron deficiency anemia or iron overload. Antibody-based immunoassays (preferably in the form of an LFA as a PoCT for ferritin) can precisely quantify this protein in blood or tissue samples and provide valuable information about the iron levels and overall health of the human body.

[0193] Homocysteine is an amino acid produced by methionine metabolism. Elevated levels of homocysteine in the blood are associated with an increased risk of cardiovascular diseases and other health problems. Detecting homocysteine using an immunoassay (preferably in the form of an LFA as a PoCT) provides a reliable method to assess an individual's cardiovascular risk and monitor the effectiveness of interventions to lower homocysteine levels.

[0194] Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are omega-3 fatty acids found in certain fish oils and are known for their potential health benefits, which include cardiovascular and cognitive support. Measuring the levels of EPA and DHA in the blood provides information about the body's omega-3 fatty acid status and helps in formulating dietary recommendations. Antibody-based immunoassays, preferably in the form of an LFA as a PoCT for EPA and DHA, can accurately quantify these fatty acids and contribute to personalized dietary assessment.

[0195] Calcitriol is the active form of vitamin D and plays a crucial role in maintaining calcium and phosphorus balance, bone health, and various physiological processes. Monitoring calcitriol levels is important for assessing vitamin D status and diagnosing diseases such as rickets and osteoporosis. Antibody-based immunoassays, preferably in the form of an LFA as a PoCT for calcitriol, can precisely measure this hormone in blood samples, helping to evaluate the body's vitamin D status and determine appropriate interventions.

[0196] In a preferred embodiment, the recombinant antibody is obtained from diatoms. In a particularly preferred embodiment, the diatom is Phaeodactylum tricornutum. This enables the provision of antibodies with the properties disclosed herein, in particular high homogeneity and purity, which enables the provision of the immunoassay according to the invention.

[0197] Preferably, the immunoassay is a lateral flow immunoassay that provides at least one sample application area, a binding area, and a capture area that are fluidly connected and arranged on a membrane.

[0198] In a lateral flow immunoassay (also referred to herein as "LFA"), three antibodies are typically used:

[0199] - A first immobilized antibody that is located in the capture area (also called the test area) and is also referred to as the capture antibody. This antibody, like the second antibody (also called the detection antibody), is also directed against the antigen, preferably against an antigen epitope different from that of the detection antibody;

[0200] - A second antibody that is preferably disposed in the binding area and is also referred to as the detection antibody, which is directed against an epitope of an antigen (such as a hormone, protein, or peptide, such as human chorionic gonadotropin), wherein the second antibody is preferably conjugated to a labeled particle (such as gold, silver, latex, carbon, nanoparticles, or an enzyme).

[0201] - Another antibody that is preferably located in the control area (control zone), preferably immobilized, and is directed against the detection / control antibody.

[0202] Preferably, the first antibody (e.g., capture antibody), the second antibody (e.g., detection antibody), and / or other antibodies (e.g., capture antibody in the control region), particularly preferably all antibodies, are obtained from diatoms, unicellular plants, or green plants and have the characteristics defined herein.

[0203] Particularly preferably, the first antibody (e.g., capture antibody), the second antibody (e.g., detection antibody), and / or other antibodies (e.g., capture antibody in the control region), particularly preferably all antibodies, are obtained from diatoms or unicellular plants and have the characteristics defined herein.

[0204] In a preferred embodiment, the LFA is provided in the form of a PoCT. In a particularly preferred embodiment, the LFA is provided in the form of a kit, which at least includes the LFA and instructions. This enables easy use by the patient himself, so that faster diagnosis can be carried out outside the infrastructure of the healthcare system.

[0205] Preferably, in one embodiment involving the LFA and sandwich ELISA, the first antibody is directed against the first domain of the bioactive antigen (as defined herein). Here, preferably, in one embodiment involving the LFA and sandwich ELISA, the second antibody is directed against the second domain of the bioactive antigen (as defined herein).

[0206] Preferably, in one embodiment, with reference to ELISA, the first antibody is directed against the domain of the bioactive antigen (as defined herein), and the second antibody is preferably directed against the domain of the first antibody.

[0207] In a particularly preferred embodiment, the present invention is carried out by an enzyme-linked immunosorbent assay (ELISA) immunoassay, which at least includes

[0208] a. providing a sample application area for applying a biological sample, the sample application area

[0209] b. defined by a capture area, the capture area being designed as a container boundary and / or a part of the container boundary (preferably a microtiter plate), and

[0210] c. a binding area spatially arranged in the sample application area.

[0211] ELISA (Enzyme-Linked Immunosorbent Assay) is a widely used laboratory technique for detecting and quantifying the presence of specific proteins or antibodies in a sample. In some forms of ELISA, the target antigen or antibody is immobilized on a solid surface, and then specific antibodies conjugated to an enzyme are used to detect and quantify the amount of antigen related to the amount of bound antibody. In sandwich ELISA, two different antibodies are used. The first antibody is immobilized on the ELISA plate and binds specifically to the antigen in the sample. The second antibody (detection antibody) is labeled, for example with an enzyme, and binds to a different epitope on the same antigen. One of the technical advantages of ELISA is its high sensitivity, which enables the detection of low concentrations of target molecules. It is versatile and applicable to a variety of sample types and molecules, including proteins, peptides, and small molecules. ELISA can provide quantitative information about the amount of target molecules present in a sample. It is one of the most important tools in molecular biology and has become indispensable in analysis and diagnosis. In addition to the antibody and sample to be analyzed, a microtiter plate is required as a carrier material and a reading device, the so-called ELISA reader. There are several different test methods. In its simplest form, the antigen to be analyzed is pipetted into the wells of a microtiter plate, where the antigen binds firmly to the polystyrene of the microtiter plate. The remaining free binding sites on the polystyrene are saturated with a blocker (such as vegan BSA) so that the subsequently added antibody can only bind to its antigen and not to the free binding sites on the polystyrene.

[0212] Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) is a widely used laboratory technique for separating proteins based on their molecular weight. In SDS-PAGE, proteins are denatured and coated with the anionic detergent sodium dodecyl sulfate (SDS), giving them a uniform negative charge. They are then loaded onto a porous polyacrylamide gel and exposed to an electric field, causing the proteins to migrate according to their size. One of the technical advantages of SDS-PAGE is its high resolution, which enables the precise separation of proteins in complex mixtures. It provides quantitative and qualitative information about protein samples, helping to identify and characterize proteins. SDS-PAGE is applicable to various sample types and can handle both denatured proteins and, with some modifications, native proteins.

[0213] Proteins separated in SDS-PAGE in this manner can be transferred to a protein-binding membrane (e.g., nitrocellulose membrane) by Western blotting. In this way, the previously separated proteins can be bound to antibodies, which are added after saturating the membrane regions that remain free after Western blotting. As is usually the case in immunoassays, a cascade of at least two different antibodies is typically used. Due to the previously performed cascade, signal amplification occurs when the second antibody binds to the first antibody. The second antibody is usually conjugated to an enzyme (e.g., alkaline phosphatase (AP) or horseradish peroxidase (HRP)) to make the binding visible. Additionally, since the second antibody can bind to the first antibody multiple times, signal amplification usually occurs. After addition, depending on the amount of antigen or antibody bound, an enzyme reaction forms an insoluble product, which directly precipitates at the site where the antigen ran in SDS-PAGE, thus clearly identifying the antigen.

[0214] Alternatively or preferably, the immunoassay is an enzyme-linked immunosorbent assay (ELISA), such as direct ELISA, indirect ELISA, direct sandwich ELISA or indirect sandwich ELISA, preferably the ELISA is direct sandwich ELISA or indirect sandwich ELISA.

[0215] According to a preferred embodiment of the invention, the binding region, the sample application region and the capture region can be spatially located in the same environment, e.g., in a container, preferably designed as a well of a microtiter plate or a test tube, and can be separated from each other by temporally separated addition and washing steps. In one embodiment related to the ELISA according to the invention, the antigen corresponding to the biological sample of an individual is immobilized on the container wall to form the sample application region. Subsequently, a first antibody directed against the biologically active antigen is added, which binds to the antigen and is thus immobilized on the container wall, forming the capture region. After an optional washing step, a second antibody directed against the first antibody is added, forming the binding region. These regions are fluidly connected but temporally separated. In one embodiment related to the sandwich ELISA according to the invention, the first antibody is first immobilized on the container wall to form the capture region. Subsequently, the biological sample of the individual is added, forming the sample application region. After an optional washing step, a second antibody directed against the biologically active antigen is added, forming the binding region. These regions are fluidly connected but temporally separated.

[0216] In a particularly preferred embodiment, the second antibody is provided in the form of an antibody-enzyme conjugate. This allows the detection of the first antibody and quantification of the enzyme signal when a soluble product is formed in ELISA, or the detection of the first antibody and quantification of the enzyme signal when the enzyme reaction product precipitates at its formation site in immunoblotting.

[0217] In a preferred embodiment of the present invention, the first antibody (preferably obtained from diatoms) is directed against an antigen, and the second antibody (also preferably obtained from diatoms and conjugated to an enzyme (preferably alkaline phosphatase (AP) or horseradish peroxidase (HRP))) is also directed against the first antigen (LFA or sandwich ELISA) or against the first antibody (ELISA or immunoblot). Preferably, the second antibody can bind the first antibody multiply, which can result in signal amplification. Particularly preferably, the second antibody can bind the first antibody between 1 and 10 times, most preferably between 1 and 5 times. Thus, the resulting signal amplification factor is preferably 1 - 10 times, particularly preferably 1 - 5 times. Due to this strong amplification factor, ELISA can determine low concentrations of antigens, or only a small amount of the first antibody and / or the second antibody is required to achieve detection above the detection limit. Due to the low concentration, the corresponding antigen can be detected earlier in the course of the disease, thereby contributing to rapid detection and treatment, for example, the infection chain can be interrupted.

[0218] In an embodiment of the present invention related to LFA, the present invention preferably provides a device having: a container, in particular a housing, and an immunoassay according to the present invention, in particular a lateral flow immunoassay, provided therein.

[0219] The present invention also relates to a device comprising a housing (8), such as a container, in particular a housing, and an immunoassay (as defined herein), in particular a lateral flow immunoassay, provided therein.

[0220] According to a preferred embodiment, the housing of the device is formed substantially, in particular exclusively, from a cellulose material, preferably from paper or cardboard. This makes it possible to dispense with the use of plastics.

[0221] According to a particularly preferred embodiment, the housing of the device is made substantially (in particular, for example, more than 90%) of a bioplastic, preferably made of polylactic acid (PLA), polyhydroxyalkanoates (PHA), or starch-based plastics. The bioplastics herein refer to biodegradable plastics, i.e., plastics that can decompose naturally into environmentally friendly substances, for example, in a composting plant or in nature.

[0222] Preferably, the housing of the device is formed of at least two layers of cellulose material, and the two layers of cellulose material at least partially surround the membrane. Here, the ends of the cellulose material layers can be stacked flush with each other.

[0223] In a preferred embodiment, the membrane is surrounded by a housing in the sense of the present invention, which housing consists mainly of cellulose fibers, preferably of 90% to 100% cellulose fibers. The housing is on the one hand waterproof, preferably at least in terms of transport and service life, and on the other hand made of sustainable, preferably recycled, plant fibers and is biodegradable, for example by microorganisms in the environment or by composting.

[0224] Biodegradable in the sense of the present invention means that at least 90 - 100% of the components, preferably 95 - 100% of the components, most preferably 99 - 100% of the components are biodegradable, for example by microorganisms in the environment and / or preferably by industrial composting according to EN 13432.

[0225] In a preferred embodiment, markings (symbols, characters, geometric shapes) are arranged on the housing of the membrane to facilitate the interpretation of the results of the immunoassay. In addition to the assays according to the present invention, especially in embodiments of kits that also provide instructions, it is easy to use even for non-medical personnel. This means that the present invention can be used as a PoCT.

[0226] For example, the ends of at least two layers of cellulose material that preferably form the housing of the device are embossed and / or punched in the side regions where they contact each other, so that they are firmly connected to each other. For example, the ends of the respective layers are connected together by an embossed seam (9).

[0227] According to a preferred embodiment of the present invention, the sample application area is only partially arranged in the housing. The sample application area can be designed as a pad. The pad can consist of a fluffy, porous or fibrous material suitable for quickly absorbing liquids.

[0228] According to a preferred embodiment of the present invention, the membrane has a fixing area (7) in the distal region (viewed along the flow direction from the application area at the proximal end of the membrane), preferably distal to the capture area, through which the membrane is fixed in the housing of the device.

[0229] In the distal region of the membrane, a break point (10) can be provided on the housing of the device as an example of a separation area, through which the distal end of the housing can be separated, preferably separated from the distal end of the membrane.

[0230] Particularly preferably, the device is provided such that the container (preferably the housing) is designed from a sustainable and waterproof material (preferably paper and / or fiber casting). This allows for the provision of an environmentally friendly immunoassay, especially an environmentally friendly LFA immunoassay. Just pregnancy tests alone produce approximately 900 tons of plastic per year, so it is desirable to provide a housing designed without using plastic but made of paper or fiber casting.

[0231] Preferably, the present invention provides a kit with a device and instructions for performing an immunoassay. Particularly preferably, the kit contains other components, such as a cotton swab or other sampling implements, a buffer solution as a motility medium mixture, other solutions, a desiccant for drying, and other aids for performing immunoassays known to those skilled in the art as PoCT or test kits for medically trained personnel.

[0232] Furthermore, the present invention also relates to a kit that includes the device as defined herein and instructions for performing the immunoassay provided in the device.

[0233] Furthermore, the present invention also relates to the use of an immunoassay (as defined herein) for detecting a bioactive protein in a biological sample from an individual.

[0234] The present invention also includes a method for detecting a bioactive protein in a biological sample from an individual, wherein the method comprises the following steps:

[0235] a) Obtaining a biological sample from the individual;

[0236] b) Analyzing the biological sample using the immunoassay according to any one of claims 1 to 14, the immunoassay being suitable for detecting the bioactive protein.

[0237] By providing instructions in combination with the immunoassay, the simple use of the kit as PoCT can be ensured. This provides a variety of technical advantages, including rapid results due to shorter transport times, immediate clinical decision-making, and improved patient management. PoCT minimizes possible pre-analytical errors, improves efficiency in emergency situations, and supports timely therapeutic measures. The decentralized nature of PoCT is beneficial for monitoring chronic and infectious diseases.

[0238] In one embodiment, the use of an immunoassay as a lifestyle product is disclosed, particularly for detecting nutrition-related parameters. This enables the tracking of parameters related to malnutrition or undernutrition rather than medical advice, but enables the identification of potential health risks. This can be used, for example, for independent nutrition monitoring.

[0239] The lifestyle products in the present invention are items or services provided because they conform to a specific lifestyle, values, or personal identity. These products generally go beyond their functional purpose and are chosen by consumers to reflect and enhance their desired lifestyle, interests, and self-expression, where medical advice may not necessarily be derived. In this embodiment, the immunoassay is not a medical product, but an aid for the subject to examine and optimize their lifestyle.

[0240] The present invention also discloses a method for detecting a bioactive antigen in a biological sample (preferably urine, whole blood, saliva, milk or serum), comprising the following steps:

[0241] a) Obtaining a biological sample from an individual;

[0242] b) Analyzing the biological sample using an immunoassay according to any one of claims 1 to 15, the immunoassay being suitable for detecting the bioactive antigen.

[0243] By this method, it is possible to use the immunoassay of the present invention, thereby enabling rapid and accurate analysis of the bioactive antigen. In a particularly preferred embodiment, the biological sample is provided by the individual undergoing the immunoassay. In an alternative embodiment, the sample is obtained by a medically trained professional.

[0244] Preferably, the biological sample is not further processed after collection. Particularly preferably, the biological sample can be directly applied to the immunoassay. This allows for rapid and direct determination of the bioactive protein.

[0245] In one embodiment, the use of the immunoassay as a point-of-care test (PoC) is disclosed, in particular for detecting an antigen that is part of a viral epitope, the virus preferably being a pathogenic virus such as influenza virus, SARS-CoV-2, RSV, adenovirus, Streptococcus A, norovirus, rotavirus, HIV, and / or comprising a recombinant antibody against human chorionic gonadotropin (hCG), preferably, the recombinant antibody is an hCG antibody. It offers several technical advantages, including rapid results due to shorter transport times, immediate clinical decision-making, and improved patient management. PoCT minimizes possible pre-analytical errors, improves efficiency in emergency situations, and supports timely therapeutic measures. The decentralized nature of PoCT is beneficial for monitoring chronic and infectious diseases.

[0246] In a preferred embodiment of the present invention, at least one auxiliary protein is also disclosed for use as an overlaying, masking, and / or supporting protein in the immunoassay, wherein the auxiliary protein is recombinantly obtained from a stably transformed diatom or unicellular plant.

[0247] In addition to antibodies, immunoassays such as ELISA, dot blot, immunoblot, and LFA also require auxiliary proteins that can, on the one hand, stabilize the antibody solution and, on the other hand, block the protein-binding surface. For immunoassays, LFA, and dot blot, the surface is preferably nitrocellulose, and for ELISA, it is preferably polystyrene. In the prior art, animal proteins such as bovine serum or calf serum or skim milk powder or casein are mainly used. In order to be able to provide a vegan immunoassay in the sense of the present invention, preferably in a vegan LFA and / or vegan ELISA, these must be replaced with animal-free alternatives. Synthetically produced alternatives such as Block are known, but these are not suitable for all applications and are very costly and not economically competitive.

[0248] Similar to recombinant antibodies, the provision of auxiliary proteins from stably transformed diatoms or single-celled or higher plants is disclosed herein. For this purpose, similar to antibodies, the sequence of bovine serum albumin (BSA) is codon-optimized and introduced as a gene into Phaeodactylum tricornutum and expressed there.

[0249] After digestion of the diatoms, vegan BSA can be purified, preferably by affinity chromatography, or in a preferred embodiment, the crude extract can be directly used in various immunobiochemical methods without further purification.

[0250] Particularly preferably, the auxiliary protein according to the present invention is preferably a vegan protein expressed from diatoms and selected from the list including BSA, casein, or gelatin. Bovine serum albumin (BSA) is commonly used as a blocker to prevent non-specific binding of antibodies to the test surface and reduce background noise. Casein is another blocker that helps prevent non-specific interactions and improve the signal-to-noise ratio in the assay, and gelatin is a collagen-derived protein that can also be used to block non-specific binding in immunoassays.

[0251] In a preferred embodiment, the purification of the antibody according to the present invention follows methods known to those skilled in the art, i.e., after lysis and centrifugation and / or ultrafiltration, purification is carried out by protein A, protein G, or by the tag sequence used (such as a 6xHis tag). Another advantage of the method according to the present invention is that, compared to higher plants that produce antibodies transiently or stably, diatoms do not contain any fibers that would make the purification of antibodies very difficult. This makes the use of the obtained antibodies technically effective and economically viable. Therefore, the purification largely corresponds to methods used for animal cell cultures (such as CHO cells) and is familiar to those skilled in the art and is described below.

[0252] Preferably, the cells producing the clone (diatoms in this example) are disrupted by so-called gentle disruption, where the product (the antibody in the sense of the present invention) is protected. Gentle methods include, for example, high pressure, voltage, ultrasound, or disruption by collision in a so-called vibratory mill. In a particularly preferred embodiment, the separation is carried out by a combination of a Manton-Gaulin homogenizer and subsequent sonication with a Covaris E220 focused ultrasonicator.

[0253] After digestion, a so-called lysate is obtained, which contains the entire cell content. To obtain a functional antibody, further purification steps are preferably carried out. The insoluble components are separated from the soluble components, for example, by centrifugation or filtration, particularly preferably by a centrifugation sequence. For example, the pigment-containing components are separated by filtration, cooling, chemical precipitation, ion exchange chromatography, or size exchange chromatography. Preferably, the components are separated sequentially and effectively using a sequence of filtration, cooling, chemical precipitation, ion exchange chromatography, or size exchange chromatography.

[0254] The antibody is purified by so-called affinity chromatography. This can be done using typical antibody purification methods (such as Protein A or G) or using so-called affinity tags. In addition, impurities are removed by tangential flow filtration or dead-end filtration and / or dialysis. Finally, the antibody is transferred to a suitable buffer solution.

[0255] To obtain good performance, the produced antibody must have a certain purity. The purity of the produced antibody can be checked by so-called polyacrylamide gel electrophoresis. Figure 10 Examples of two different anti-hCG antibodies according to the present invention are shown here, labeled AK_1788 and AK_1882, which have high purity.

[0256] Gel electrophoresis is a laboratory technique that can be used to separate and analyze molecules such as DNA, RNA, and proteins based on their size and charge. The molecules are placed in a gel matrix and an electric field is applied, which causes the molecules to migrate through the gel. Smaller molecules move faster and migrate farther, resulting in distinct bands or patterns that can be visualized. The technical advantages of gel electrophoresis include the ability to separate complex mixtures of molecules with high resolution. It is versatile and can be adapted to different types of molecules, providing qualitative and semi-quantitative information about their properties.

[0257] Dot blotting is a laboratory technique used in molecular biology and immunology to detect, analyze, and quantify specific biomolecules, such as proteins or nucleic acids (DNA or RNA), in a sample. In dot blotting, a small amount of the target biomolecule is immobilized or "blotted" onto a solid support (usually a membrane). This immobilization can be done by directly applying the sample onto the membrane.

[0258] List of reference numerals

[0259] 1 Immunoassay method / device

[0260] 2 Sample application area

[0261] 3 Capture area

[0262] 4 Binding area

[0263] 5 Control area

[0264] 6 Membrane

[0265] 7 Fixing area

[0266] 8 Housing

[0267] 9 Embossed seam

[0268] 10 Breaking point

[0269] 11 Sequence optimization of nucleic acid sequence

[0270] 12 Insertion of nucleic acid sequence into vector

[0271] 13 Transformation

[0272] 14 Screening method

[0273] 15 Production method of recombinant protein

[0274] 16 Vector

[0275] 17 Cell

[0276] 18 Cell culture

[0277] Design example

[0278] The present invention will be described in more detail below with reference to the following drawings and examples, but the present invention is not limited thereto.

[0279] Not limited thereto. Description of the drawings

[0280] Figure 1 : Top view schematic diagram of an immunoassay method, especially a lateral flow immunoassay method (test strip);

[0281] Figure 2 : Bottom view schematic diagram of an immunoassay method, especially a lateral flow immunoassay method (test strip);

[0282] Figure 3 : Schematic diagram of a device in which an immunoassay method, especially a lateral flow immunoassay method (test strip), is arranged in a housing;

[0283] Figure 4 : Schematic diagram of a device in which the housing is formed by stacking two layers of paper or cardboard together;

[0284] Figure 5: Glycan analysis for determining the glycosylation composition of IgG (antibody) in hamster cell culture;

[0285] Figure 6: Glycan analysis for determining the glycosylation composition of IgG (antibody) in Figure 5 in Expi cells (human cell culture);

[0286] Figure 7: Glycan analysis for determining the glycosylation composition of IgG (antibody) in Figures 5 and 6 in Phaeodactylum tricornutum.

[0287] Figure 8 : Schematic diagram of the antibody according to the present invention.

[0288] Figure 9: Duplication of two promoters.

[0289] Figure 10 : Polyacrylamide gel electrophoresis using anti-hCG antibody; GS = size standard, AK_1788 and AK_1882: anti-hCG antibody, stained with Coomassie Brilliant Blue.

[0290] Figure 11 : Graph comparing the binding affinities of two diatom antibodies (forms) with sequence matching in human cell culture (Expi 293F ).

[0291] Figure 12 : ELISA for detecting human β - chorionic gonadotropin (hCG) using an antibody produced by diatoms.

[0292] Figure 13 : Immunoblot (SDS page) using the antibody from diatoms according to the present invention as a secondary antibody labeled with horseradish peroxidase to detect the primary antibody. mIgG: small monoclonal IgG against human interleukin 15 from mice; mIgG_1: affinity - purified polyclonal antibody produced by goats against the light and heavy chains of mouse IgG (goat - α - mouse - IgG - HrRP) (comparative antibody); mIgG_2: antibody according to the present invention from Phaeodactylum tricornutum against the heavy chain of mouse IgG (antibody according to the present invention for immunoassay).

[0293] Figure 14 : ELISA for Her2 receptor, performed using trastuzumab biosimilars from rabbits (trastuzumab A - C) and biosimilars from diatoms - Phaeodactylum tricornutum (hIgG4_D - F).

[0294] Figure 15 : Dot blot using anti - hCG antibodies AK_1788 and AK_1882.

[0295] Figure 8 Shows a schematic representation of the context for providing diatoms for the production of recombinant antibodies for immunoassays according to the invention. All sub-steps shown (either alone or in combination) lead to an improvement / optimization of the heterologous production of proteins, in particular antibodies, especially in the diatom Phaeodactylum tricornutum.

[0296] First, sequence optimization (11) of the nucleic acid sequence is carried out. This can include, for example, codon optimization and / or the use of protease-resistant genetic elements in particular (as described herein), such as the hinge region derived from equine IgG (immunoglobulin G).

[0297] The nucleic acid sequence is then introduced into a vector (16) (or isolated nucleic acid), where individual genetic elements and / or complete expression cassettes are reused. In addition, special inducible promoters are also used, especially the promoter element of the nucleic acid sequence from SEQ ID NO:1.

[0298] By utilizing specific signal sequences (as described herein), the expression of the heterologously produced protein occurs in the endoplasmic reticulum of the cell, thereby protecting the protein from protease degradation and enabling successful glycosylation, thus increasing the yield and maintaining the functionality of the protein.

[0299] In the next step, the vector (or nucleic acid) is transformed (13) into target cells, preferably into photosynthetically active cells, especially cells of unicellular or green plants, preferably into cells of Phaeodactylum tricornutum. The transformation can be carried out by ballistics or electroporation in a suitable medium.

[0300] Subsequently, a screening method (14) is carried out to select cells with an increased expression rate of the nucleic acid sequence. Reporter genes can be used to screen for high-performance producers, i.e., cells with an increased expression rate. In addition, the correlation between the expression of the reporter gene and the expression level of the protein to be produced can be determined. Preferably, multi-well plates are used for both the screening method and the culture monitoring.

[0301] After the screening process, a method for producing a recombinant protein (preferably a recombinant antibody) can be implemented based on the cells with an increased expression rate determined during the screening process.

[0302] The recombinant protein (15) is produced in a medium suitable for the genetic elements used (especially the promoter used). Even the culture conditions (such as the minimum light intensity and aeration rate) are adjusted.

[0303] The use of repeated genetic elements, whether in terms of the nucleic acid sequence or the vector or isolated nucleic acid, results in a significant increase in the expression rate in Phaeodactylum tricornutum. Figure 9A Shows the repetition of two HASP1 mod promoters. Figure 9BShows an example of an embodiment of a vector according to the invention, in which the expression cassette is reused here in the form of a triple cassette for the production of an antibody in the scFv-Fc form. In particular, this reuse of the expression cassette results in a significant increase in yield and in the number or proportion of clones showing a detectable yield, thus minimizing the workload of the overall process. In the embodiment shown, the expression cassette has a promoter element (9.1), a first transcription unit encoding the protein to be recombinantly produced, and a second transcription unit encoding the reporter gene gfp, where the individual genetic elements are, for example, applied to one expression cassette but are also present in other expression cassettes.

[0304] Figure 12 Shows an ELISA according to the invention for the detection of human β - chorionic gonadotropin (hCG) using an antibody produced in diatoms. In Figure 12 this, the ELISA is carried out as follows:

[0305] After conjugating human chorionic gonadotropin (hCG) to the ELISA plate and saturating it with a blocker free of animal products, the first antibody against hCG, which is produced in diatoms and purified by affinity chromatography, is added.

[0306] After the washing step, amplification is carried out using a second diatom-based antibody, and a signal is generated using an antibody conjugated to the enzyme HRP to initiate the detection reaction after adding the substrate.

[0307] In this ELISA, a total of 13 test series were prepared, where two samples were supposed to show strong signals and 11 samples were used as controls to obtain meaningful results. The corresponding method is listed in Table 1, where the order from left to right corresponds to the working steps. The number of steps may vary. In this case, 5 steps were carried out. First, the antigen (in this example hCG) was bound to the plate. Then the free binding sites were filled with a so-called blocking solution. Starting from step 3, the additions were different, as shown in Table 1. These different additions made it possible to characterize the antibody and, among other things, to exclude non-specific binding.

[0308] In this exemplary ELISA, a total of three different antibodies according to the invention were used, which were produced in Phaeodactylum tricornutum:

[0309] On the one hand, two different antibodies according to the invention (AK_1788 and AK_1892) were used, which are directed against the β-subunit of hCG and correspond to human IgG4. On the other hand, a secondary antibody according to the invention obtained from diatoms (AK_2073) was used, which corresponds to a mouse antibody against human IgG4. In this example, a polyclonal antibody (G-α-mIgG-HRP) directed against mouse IgG and conjugated with horseradish peroxidase (HRP) was used for detection.

[0310] Table 1 lists the addition of antibodies bound to the image. Signals were expected only in samples 9 and 13, and all other samples were used for control purposes.

[0311] Table 1: Groups for ELISA using antigens obtained from diatoms. Anti-mIgG-HRP = antibody labeled with HRP against antibody 2073 (AK_2073). AK_1788 and AK_1882 are antibodies against hCG, and AK_2073 is an antibody against antibodies 1788 and 1882.

[0312]

[0313] From Figure 12 It can be seen that only groups 9 and 13 highlighted in Table 1 have strong signals, with intensities of 0.57 and 0.54 respectively. This indicates that the first and second antibodies have high affinities for the antigen and the first antibody respectively. By adding G-α-mIgG-HRP as the detection antibody, it is shown that these antibodies are selective for detecting human β-chorionic gonadotropin (hCG).

[0314] Here, all other control groups did not show values exceeding 0.25. It can be concluded that both the AK_1788 and AK_1892 antibodies selectively bind to the antigen, which is hCG in this example.

[0315] For the so-called control antibody 2073 required in the LFA, placed on the control line, as expected, it can be shown that it can bind to antibodies AK_1788 and AK_1892.

[0316] Therefore, the antibodies shown here are complete and can be used to construct an LFA (a pregnancy test in this example) and are capable of detecting pregnancy as well as staining the control line of the LFA.

[0317] Figure 13 An exemplary use of the antibodies according to the invention in an immunoassay (immunoblot) in a SDS PAGE variant is shown. Here, the diatom antibody according to the invention is used as a secondary antibody labeled with horseradish peroxidase, which is used to detect the primary antibody. In Figure 13Among them, mIgG represents monoclonal IgG against human interleukin 15 from mice, and Pt is the abbreviation of the protein extract from the diatom Phaeodactylum tricornutum (Pt), which is used as a negative control to show that the antibody does not recognize the proteins from the diatom. Both mIgG and Pt were separated by SDS-PAGE, and then the proteins separated in the gel were transferred to the membrane by Western blotting. Subsequently, mIgG was detected with a commercial reference antibody (mIgG_1) and two different concentrations of the antibody according to the present invention.

[0318] The comparative antibody used was mIgG_1, a commercial, polyclonal, affinity-purified antibody (goat-α-mouse-IgG-HrRP), which was produced in goats, targeted against the light and heavy chains of mouse IgG and conjugated with horseradish peroxidase (HRP) (comparative antibody). The antibody according to the present invention, mIgG_2 (Pt-α-mouse IgG-HRP), was used at two concentrations (0.75 μg / mL and 0.15 μg / mL). It was obtained from the diatom Phaeodactylum tricornutum, targeted against the heavy chain of mouse IgG and conjugated with horseradish peroxidase (HRP). BlueStar from Nippon Genetics was used as the length standard (M).

[0319] The antibody goat-α-mouse-IgG-HRP produced in goats can recognize the light and heavy chains of mouse mIgG. Therefore, in addition to a large number of non-specific signals (arrows), two strong specific signals can also be seen. The antibody from the diatom (mIgG_2) only targets the heavy chain (HC, only the upper arrow), so the light chain that produces the lower specific band in the reference antibody is not shown. The antibody from the diatom (mIgG_2) only targets the heavy chain (HC, only the upper arrow), so it does not recognize the lower band. The antibody from the diatom can provide equally clear and more specific signals even in small amounts. Several non-specific bands (*) appeared, especially for the commercial animal antibody (mIgG_1). The top band is still intact IgG (▼), and the denaturing property of SDS-PAGE did not cause IgG to separate into light and heavy chains. Therefore, the antibodies according to the present invention not only show strong signal amplification at lower concentrations but also have higher specificity compared to the target antibody. That's why they represent a more specific alternative to animal antibodies. This increased sensitivity allows the use of smaller amounts of antibody, while the higher specificity allows for more reliable assays and avoids false positive results. It was also shown that the antigen has no affinity for the diatom-specific proteins, as demonstrated by the lack of bands in the protein extract isolated from Phaeodactylum tricornutum (Pt).

[0320] Figure 14Shows the ELISA of animal antibodies against the Herceptin 2 receptor (Her2) and the antibodies according to the invention, using trastuzumab biosimilars from rabbits (trastuzumab A - C) and biosimilars from the diatom Phaeodactylum tricornutum (hIgG4_D - F).

[0321] The OD value refers to the optical density value. It is a measure of the absorption of light by the sample in the microplate well. The OD value is used to quantify the presence or concentration of a specific molecule (in this case, the antigen) in the test sample. A higher OD value generally indicates a higher concentration of the target molecule in the sample, while a lower value indicates a lower concentration. This measurement is a key component in evaluating the results of an ELISA experiment and determining the strength of the reaction between the antigen and the antibody.

[0322] The OD values in this example indicate that, across all concentration ranges, the antibodies obtained from the diatom - Phaeodactylum tricornutum (hIgG4_D - F) have a higher specific activity against the antigen Herceptin 2 receptor than the animal analogues (trastuzumab A - C). This may be due to the higher purity of the antibodies according to the invention, which is also demonstrated in Figures 5 - 7 (glycosylation pattern), Figure 13 (SDS page immunoblot), etc. The higher the activity, the more sensitive the antigen detection and the lower the detection limit. Due to the low concentration, the corresponding antigen can, for example, be detected at an early stage of the disease, thus contributing to rapid detection and treatment, for example, blocking the infection chain.

[0323] Figure 15 Shows the dot blot assay. In the dot blot assay, one antibody according to the invention (AK_1788, against hCG) is conjugated with colloidal gold, while another antibody according to the invention (AK_1882, against another epitope on hCG) is applied in a circular form to a suitable membrane. Then the membrane and the antibody labeled with colloidal gold are incubated with a solution containing hCG. Thus, the anti - hCG antibodies from the ELISA are tested in a setup corresponding to the LFA model ( Figure 13 ). The membrane - bound antibody and the antibody labeled with colloidal gold bind to hCG in the solution simultaneously. If both antibodies are able to bind hCG, the position of the membrane - bound antibody will change color significantly compared to the surrounding area. Figure 15 Shows the staining of two anti - hCG antibodies. This indicates that the two antibodies bind to the hCG molecule simultaneously, and thus hCG can be detected using a typical LFA setup.

[0324] Example 1: Production of antibodies from diatoms and purification for immunoassays

[0325] Example illustration (the process is outlined in Figure 8) shows the production of antibodies using the method according to the invention. The antibody in IgG form is directed against equine interleukin 31 and yields more than 160 mg of purified eqIgG per liter of cell culture over a 14-day cultivation period.

[0326] In the first step, codon usage was adjusted for *Phaeodactylum tricornutum*. In this example, the starting sequence was derived from a human scFv library and codon-optimized before use in the diatom. The required genetic elements, typically the light chain variable region (V L ) and the heavy chain variable region (V H ), were synthesized by IDT-DNA (Coralville, Iowa) so that they would optimally fit the vector created ( Figure 9B ). Restriction sites that interfered were also removed or modified. Figure 9B Shows a variant of the vector according to the invention for the production of an scFv-Fc form of antibody. Here, the light chain variable region (κ or λ form (V Lκ or V Lλ )) and the heavy chain variable region (V H ) can be used. In this example, the constant regions of both chains are from horse. Constructs containing constant antibody regions from other host organisms (e.g., mouse or human) were also generated. Further variants of the vector according to the invention have been produced and successfully used for the heterologous production of other forms, such as Fab or scFv-Fc. Figure 9B The example shown in

[0327] contains the completed vector construct, which, in addition to the elements to be introduced into *Phaeodactylum tricornutum*, also contains bacterial genetic elements (colE1 origin and gentamicin resistance gene) for cloning in *Escherichia coli*. Three copies of the gene of interest were used in the construct. After biolistic or electroporation transformation in *Phaeodactylum tricornutum*, it was necessary not only to check whether the clones obtained had taken up the antibody gene, but also to quickly identify clones that expressed the introduced antibody gene particularly strongly. The basic screening method according to the invention can correlate the fluorescence caused by gfp (green fluorescent protein) measured in a special microtiter plate reader with the amount of antibody expected to form later. -1 Compared with the productivity of up to 3 mg antibody*L -1 culture described in the prior art, in the system according to the invention, 160 mg of purified antibody can be obtained from 1 L of culture. To achieve this, a new medium composition was used in the reactor column, aeration was carried out using compressed air at more than 3 L*min -2 and illumination was carried out using a light intensity of 100 - 1000 W*m.

[0328] An exemplary medium composition is shown in Table 2:

[0329] Table 2: Medium composition

[0330]

[0331]

[0332] Normally, after 14 to 20 days of fed-batch culture, the diatoms can be harvested and digested.

[0333] Purification follows classical methods, i.e., after lysis and centrifugation and / or ultrafiltration, purification is carried out by Protein A, Protein G or by the tag sequence used (such as the 6xHis tag). This is another advantage of the immunoassay according to the present invention, because compared with higher plants that transiently or stably produce antibodies, diatoms do not contain any fibers, which makes the purification of antibodies very difficult. Therefore, the purification largely corresponds to the method used for animal cell cultures (such as CHO cells), and is well-known to those skilled in the art, as described below.

[0334] The cells producing the clone (diatoms in this example) are disrupted by so-called gentle disruption, in which the product (the antibody in the sense of the present invention) is protected. Gentle methods include, for example, high pressure, voltage, ultrasound or disruption by collision in a so-called vibration mill; in this case, a Manton-Gaulin homogenizer is used in combination and subsequent sonication in a sonicator. After digestion, a so-called lysate is obtained, which contains the entire cell content. In order to obtain a functional antibody, a purification step is required. The insoluble components are separated from the soluble components, for example, by centrifugation or filtration, in this case, a centrifugation sequence. The pigment-containing components are separated by a sequence of filtration, cooling, chemical precipitation, ion exchange chromatography or size exchange chromatography.

[0335] The antibody is purified by affinity chromatography. This can be carried out using typical antibody purification methods (such as Protein A or G) or using a so-called affinity tag. In addition, impurities are removed by tangential flow filtration or dead-end filtration and / or dialysis. Finally, the antibody is transferred to a suitable buffer solution.

[0336] In order to obtain good performance, the produced antibody must have a certain purity. In this example, the purity of the produced antibody is checked by so-called polyacrylamide gel electrophoresis. Figure 10 Examples of two different anti-hCG antibodies according to the present invention are shown, designated here as A-hCG-1 and A-hCG-12, which have high purity.

[0337] Example 2: Provide a pregnancy test

[0338] Lateral flow pregnancy tests use antibodies produced intracellularly from diatoms - Phaeodactylum tricornutum. These antibodies are produced at a concentration of approximately 160 - 360 mg per liter of culture. These antibodies specifically target human chorionic gonadotropin (hCG), which consists of an α subunit of 92 amino acids and a β subunit of 145 amino acids. The test includes a first antibody, a capture antibody, a second antibody, a detection antibody, and another antibody, namely a control antibody.

[0339] The detection antibodies are characterized in that they are labeled with colloidal gold nanoparticles. The first immobilized antibody located in the capture zone acts as the capture antibody. The second antibody located in the binding zone and referred to as the detection antibody also targets the antigen, preferably an antigenic epitope different from that of the detection antibody. This second antibody is conjugated to the labeling particles (in this case, colloidal gold nanoparticles).

[0340] In a preferred embodiment of the immunoassay, the first antibody and / or the second antibody, especially the mobile second antibody, is labeled with a dye and / or an optically active nanoparticle, especially a gold nanoparticle.

[0341] Another antibody, preferably located and immobilized in the control zone, targets the detection antibody.

[0342] The purified antibodies, including the first antibody, the second antibody, and subsequent antibodies, are bound to a plant-derived covering protein (BSA expressed by diatoms) and applied to a nitrocellulose membrane. This configuration creates a lateral flow immunoassay that has a sample application zone, a binding zone, and a capture zone integrated on the membrane. The sample application zone and the capture zone are fluidly connected to each other on the membrane through a flow path, where the binding zone is located in the flow path. This design facilitates the conduct of the test and the interpretation of the results.

[0343] The membrane in the present invention is surrounded by a housing that consists mainly (at least 90%) of cellulose fibers, which is waterproof on the one hand (at least in terms of transportation and service life), and on the other hand is made of sustainable, preferably recycled, and biodegradable (e.g., by composting) plant fibers.

[0344] To facilitate use as a PoCT, markings (symbols, characters, geometric shapes) are attached to the housing on the membrane, so that the results of the immunoassay can be easily interpreted. In addition to the assay according to the present invention, especially in embodiments of the kit that also provide instructions, the ease of use by non-medical personnel is also ensured.

Claims

1. An immunoassay for detecting bioactive antigens, especially hormones, proteins or drug substances, in an individual biological sample, having: - A sample application area for applying the individual biological sample, wherein, The biological sample is preferably urine, whole blood, saliva, milk or serum; - a capture region, wherein the capture region has an immobilized first antibody against a bioactive antigen, in particular against a hormone, protein, peptide or drug substance; - a binding region, wherein the binding region has a second antibody against a bioactive antigen, in particular against a hormone, protein, peptide or drug substance; It is characterized in that the first antibody and / or the second antibody is a recombinant antibody obtained from diatoms or unicellular plants, wherein the purity of the recombinant antibody is at least 90%, preferably at least 95%.

2. The immunoassay according to claim 1, wherein, The recombinant antibody is obtained in a diatom or unicellular plant culture at a concentration of 20 - 1000 mg / L, preferably 30 - 800 mg / L, or at least 30 - 160 mg / L.

3. The immunoassay according to any one of claims 1 or 2, wherein, The glycosylation of the first antibody and / or the second antibody has an altered glycosylation pattern compared to the corresponding natural antibody. Preferably, the glycosylation has a more homogeneous pattern, and the homogeneity factor is in the range of 1 to 3. Particularly preferably, the glycosylation has a homogeneous, mannose-rich N-glycan pattern, and the homogeneity factor is preferably in the range of 1 to 3.

4. The immunoassay according to any one of claims 1 to 3, wherein, The recombinant antibody is a chimeric antibody that comprises at least one first sequence selected from at least one first organism and at least one second sequence selected from at least one second organism.

5. The immunoassay according to any one of claims 1 to 4, wherein, The immunoassay has at least one other antibody and / or accessory protein, wherein preferably, the other antibody and / or accessory protein is obtained from diatoms and / or unicellular plants and / or green plants, and is particularly preferably vegan.

6. The immunoassay according to any one of claims 1 to 5, wherein, The amino acid sequence of the first antibody and / or the second antibody is a) comprising a vertebrate, preferably mammalian, particularly preferably human antibody; or b) comprising an amino acid sequence having at least 80%, preferably at least 85%, particularly preferably at least 90%, most preferably at least 95%, especially at least 97% sequence identity with a homologous sequence region of a vertebrate and / or mammalian and / or human antibody or consisting thereof.

7. The immunoassay according to any one of claims 1 to 6, wherein, The nucleic acid sequence encoding the first antibody and / or the second antibody is codon-optimized for the host organism from which the first antibody and / or the second antibody is obtained.

8. The immunoassay according to any one of claims 1 to 7, wherein, The amino acid sequence of the recombinant antibody in the hinge region is modified such that it has increased stability against diatom-, plant- or microalgae-specific proteases compared to the natural antibody, and preferably the stability factor is 1.1 to 5.

9. The immunoassay according to claims 1 to 8, wherein, The recombinant antibody is expressed by stably transformed diatoms or unicellular plants, preferably expressed by stably transformed diatoms for several generations, preferably at least 60 generations, more preferably at least 80 generations, most preferably at least 100 generations.

10. The immunoassay according to any one of claims 1 to 9, wherein, The recombinant antibody is expressed intracellularly, preferably expressed in stably transformed diatoms.

11. The immunoassay according to any one of claims 1 to 10, wherein, The first antibody and / or the second antibody is an antibody against human chorionic gonadotropin (hCG).

12. The immunoassay according to any one of claims 1 to 11, wherein, The bioactive antigen is part of a viral epitope, preferably the virus is a pathogenic virus, such as influenza virus, SARS-CoV-2, RSV, adenovirus, Streptococcus A (Strep A), norovirus, rotavirus, HIV.

13. The immunoassay according to any one of claims 1 to 12, wherein, The bioactive antigen is a tumor-associated sequence, preferably a sequence portion of the HLA complex and / or tumor epitope and / or a tumor marker, such as IFN-γ, IL-8, PSA, CEA, AFP, DCP, CA 125, HER2 / neu.

14. The immunoassay according to any one of claims 1 to 13, wherein, The bioactive antigen is a recognition protein, preferably an enzyme tag, particularly preferably a characteristic sequence selected from the group consisting of His6 tag, Strep tag, c-Myk tag, Flag tag, and GST tag.

15. The immunoassay according to any one of claims 1 to 14, wherein, The bioactive antigen is a sequence related to nutritional parameters, such as transcobalamin II, ferritin, homocysteine, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), or calcitriol.

16. The immunoassay according to any one of claims 1 to 15, wherein, The diatom is Phaeodactylum tricornutum.

17. The immunoassay according to any one of claims 1 to 16, wherein, The immunoassay is a lateral flow immunoassay that provides at least one sample application area, a binding area, and a fluid-connected capture area on a membrane.

18. The immunoassay according to any one of claims 1 to 17, wherein, The immunoassay is performed as an enzyme-linked immunosorbent assay (ELISA) immunoassay, wherein at least a. A sample application area for applying a biological sample is provided, and the sample application area b. Is defined by a capture area that is designed as a container boundary and / or a part of the container boundary, preferably a microtiter plate, and c. A binding area that is spatially arranged in the sample application area.

19. The immunoassay according to claim 18, wherein, The second antibody is provided in the form of an antibody-enzyme conjugate.

20. A device having: - a container, in particular a housing, and - an immunoassay according to any one of claims 1 to 17 arranged therein, in particular a lateral flow immunoassay.

21. The device according to claim 20, wherein, The container, preferably a housing, is made of a sustainable and waterproof material, preferably made of paper and / or fiber castings.

22. A kit having: - a device according to any one of claims 20 to 21; and - instructions for performing the immunoassay.

23. Use of the immunoassay according to any one of claims 1 to 22 as a lifestyle product, in particular for detecting a nutrition-related parameter according to claim 15.

24. Use of the immunoassay according to any one of claims 1 to 22 as a point-of-care (PoC) diagnosis, in particular for detecting a bioactive antigen according to claims 11 and / or 12.

25. A method for detecting a bioactive protein in a biological sample, preferably urine, whole blood, saliva, milk or serum, comprising the following steps: a. Obtain a biological sample from an individual; b. Analyze the biological sample using the immunoassay according to any one of claims 1 to 19, which is suitable for detecting the bioactive protein.

26. An auxiliary protein which acts as a covering, masking and / or supporting protein in the immunoassay according to any one of claims 1 to 20, characterized in that The auxiliary protein is recombinantly obtained from a stably transformed diatom or unicellular plant.

27. The auxiliary protein according to claim 26, wherein, The auxiliary protein is particularly preferably selected from the list comprising BSA, casein, and gelatin.

Citation Information

Patent Citations

  • Secretion of recombinant polypeptides in the extracellular medium of diatoms

    EP2444495A1

  • Production of secreted therapeutic antibodies in phaeodactylum tricornutum microalgae

    EP2660323A1

  • Expression and secretion of recombinant, completely assembled protein complexes using microalgae

    EP2671950A1

  • Method for producing antibodies in plant cells

    US6080560A

  • Method for determination of antigen and antibody against the antigen, and determination reagent for use in the method

    CN101512339A