Nuclease inactivated dPfAgo mutant as well as preparation method and application thereof
The dPfAgo mutant was obtained by performing site-directed mutations on the PfAgo protein site, and a fluorescence analysis method based on dPfAgo was developed, which solved the complexity and cost problems of the CRISPR/Cas system in nucleic acid detection, and achieved high sensitivity and specific nucleic acid detection.
Patent Information
- Application Number
- CN202510289797.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-12
- Publication Date
- 2025-06-24
AI Technical Summary
The existing CRISPR/Cas systems have dependence on PAM sequences in nucleic acid detection, high cost of long RNA guides, and the need for various Cas enzymes in multiple assays, resulting in increased system complexity and cost.
By performing site-directed mutations of the D558, D628 and E635 sites in the PfAgo protein, a nuclease-inactivated dPfAgo mutant was obtained, and a fluorescence analysis method based on dPfAgo was developed, using the target binding between dPfAgo and labeled gDNA to achieve fluorescence resonance energy transfer-induced fluorescence quenching.
High sensitivity, specificity and simplicity are achieved, reducing dependence on additional reporters, reducing system complexity and cost, and extending the scope of programmable enzyme-mediated molecular diagnosis.
Smart Images

Figure CN120192948A_ABST
Abstract
Description
Technical Field
[0002] The present invention relates to the field of molecular biology detection, and particularly relates to a nuclease-inactivated dPfAgo mutant, a preparation method thereof, and an application thereof. Background Art
[0003] In recent years, CRISPR (Regularly Interspaced Short Palindromic Repeats)-based molecular diagnostics have revolutionized nucleic acid detection by harnessing the target-binding ability of guide RNAs and the trans-cleavage activity of Cas proteins (Li et al., 2024). Zhang et al. developed the Specific High-Sensitivity Enzymatic Reporter UnLOCKing (SHERLOCK) method, which uses the nonspecific RNA degradation activity of Cas 13a to detect Zika virus and dengue virus with high sensitivity and specificity (Gootenberg et al., 2017). This method was further improved in the SHERLOCKv2 system, with reverse transcription isothermal amplification incorporating Cas 13b and Cas 12a for rapid DNA and RNA detection. However, CRISPR-based systems face several limitations, including the requirement for protospacer adjacent motif (PAM) sequences, the high cost of long RNA guides, and the need for various Cas enzymes in multiplex assays (Kaminski et al., 2021). Although current CRISPR / Cas research has achieved PAM-independent nucleic acid detection (Wu et al., 2022; Karlikow et al., 2023), such methods often compromise site specificity, raising concerns about off-target effects, especially for Cas12a, which relies on PAM sequences for accurate recognition and cleavage. (Swarts et al., 2019)
[0004] The Argonaute (Ago) protein has emerged as an alternative to CRISPR-based methods for nucleic acid detection due to its PAM-independent mechanism and the use of guide DNA (gDNA). Ago proteins can be classified into eukaryotic Ago and prokaryotic Ago based on their origin. Eukaryotic Ago plays an important role in the eukaryotic RNA interference pathway (Meister et al., 69 2013). Prokaryotic Ago functions in host defense by cleaving invading nucleic acids in the presence of DNA guides. The Ago protein from Pyrococcus furiosus (PfAgo) is capable of targeting and specifically cleaving target DNA using single-stranded DNA (ssDNA). Different from CRISPR enzymes, PfAgo exhibits stability and gDNA is easy to synthesize. Previous studies have demonstrated the potential of PfAgo in the development of new detection methods, such as the PfAgo-mediated nucleic acid detection (PAND) system (He et al., 2019), which has been used to detect different targets, including SARS-CoV-2, HPV (Wang et al., 2021), influenza virus (Ye et al., 2022), and MRSA. In these methods, PfAgo recognizes and cleaves the target sequence under the guidance of gDNA, generating short 5′-phosphorylated ssDNA fragments through a two-round cleavage process. Then this fragment guides PfAgo to cleave the complementary molecular beacon, which results in fluorescence quenching of the fluorophore and signal generation. Although these methods offer high sensitivity and specificity and allow the detection of multiple targets, they require molecular beacons and multiple rounds of cleavage, increasing the complexity of the system and the analysis cost, thus necessitating the development of simplified PfAgo-based nucleic acid detection methods.
[0005] To address these challenges, nuclease-inactivated mutants of programmable enzymes have been developed for nucleic acid biosensing platforms, such as nuclease-inactivated Cas9 (dCas9) (Marsic et al., 2021), biotin-labeled dCas9 (Ali et al., 2021), and split-HRP-dCas9 (Qiu et al., 2018), which have been used in paper- and solution-based colorimetric assays, reducing the dependence on additional reporters and simplifying signal acquisition. The inventors of the present invention previously developed a gold nanoparticle-enhanced dCas9-mediated fluorescence resonance energy transfer (FRET) system, achieving effective nucleic acid detection through nanoprobe-based target recognition and signal quenching (Yang et al., 2025). Summary of the Invention
[0006] In view of the deficiencies of the prior art and the actual needs, the present invention obtains dPfAgo mutants by site-directed mutagenesis of the catalytic residues D558, D628, and E635. Using FAM-labeled primers and BHQ1-labeled gDNA, a dPfAgo-mediated fluorescence assay method was developed. This system utilizes the precise target binding between dPfAgo and BHQ1-gDNA to induce fluorescence quenching through fluorescence resonance energy transfer, enabling genotyping of gene-edited crops, etc., and achieving high sensitivity, specificity, and simplicity. This invention represents an important step towards advancing programmable enzyme-based diagnostics, highlighting the potential of dPfAgo in molecular sensing applications.
[0007] One aspect of the present invention provides a nuclease-inactivated mutant dPfAgo protein. Compared with the wild-type PfAgo protein, the mutant dPfAgo protein has site-directed mutagenesis at one or more of the sites D628A, D558A, and E635A.
[0008] Furthermore, the sequence of the mutant dPfAgo protein is shown in SEQ ID NO.65-67.
[0009] Another aspect of the present invention provides a method for preparing the above mutant dPfAgo protein, which includes site-directed mutagenesis at one or more of the sites D628A, D558A, and E635A of the PfAgo protein.
[0010] Furthermore, the method of site-directed mutagenesis in the preparation method is carried out by the overlap extension PCR method.
[0011] Furthermore, the primer pair used in the method of site-directed mutagenesis for the D628A site is:
[0012] D628A-F TGCGTGCAGGTCGCATTACCAATA SEQ ID NO.13
[0013] D628A-R TGCGACCTGCACGCAGCAGCAGGATTTTTTT SEQ ID NO.14;
[0014] Furthermore, the primer pair used in the method of site-directed mutagenesis for the D558A site is:
[0015] D558A-F TGGCATTGCAGTGGCACCGATG SEQ ID NO.11
[0016] D558A-R GCCACTGCAATGCCAATGATATAATC SEQ ID NO.12.
[0017] Furthermore, the mutant specific primer pair used in the method for site-directed mutagenesis of the E635A site is as follows:
[0018] E635A-F TAATGCAGAAGAAGGCCTGAAATATATCAGCG SEQ ID NO.15
[0019] E635A-R GGCCTTCTTCTGCATTATTGGTAATGCGACCATCACG SEQ ID NO.16.
[0020] Furthermore, the preparation method includes the following steps:
[0021] S1) Recombinant plasmid construction: By the T5 nuclease-mediated vector assembly method, the PfAgo gene fragment is assembled with the pET28a vector to construct a recombinant plasmid containing pET28a and PfAgo; Using the overlap extension PCR technique, the D558, D628 and / or E635 residues of the PfAgo gene are subjected to site-directed mutagenesis using the mutant specific primer pair to obtain a single mutant recombinant plasmid;
[0022] S2) Expression and purification: The recombinant plasmid containing pET28a and PfAgo is transformed into Escherichia coli for culture, the single colony is counted into the culture medium for culture, and IPTG is used to induce protein expression; The supernatant of the lysed bacteria is collected and purified; The mutant dPfAgo protein is obtained.
[0023] Another method of the present invention provides a detection method for genotyping, and the detection method includes the following steps:
[0024] S01) Design of guide DNA (gDNA): The 5' end of the gDNA is phosphorylated and the 3' end is linked with a quenching group, and its sequence is complementary to a specific region of the target edited or wild-type nucleic acid;
[0025] S02) Amplification of the target nucleic acid: The target nucleic acid is subjected to PCR amplification using a primer labeled with a fluorescent donor at the 5' end to obtain a fluorescently labeled amplicon;
[0026] S03) Mix the amplicon obtained in step S2) with the above-mentioned mutant dPfAgo protein and the gDNA obtained in step S1), and observe the fluorescence signal; The gene type is judged by detecting the change of the fluorescence signal;
[0027] When the sequence of the gDNA in S01) is complementary to the target edited nucleic acid, if the amplicon contains the edited DNA, no fluorescence signal is generated; If the amplicon contains wild-type DNA, a fluorescence signal is generated;
[0028] When the sequence of the gDNA in S01) is complementary to the target wild type, if the amplicon contains wild-type DNA, no fluorescence signal is generated; if the amplicon contains edited DNA, a fluorescence signal is generated.
[0029] Further, step S1) also includes the step of screening gDNA.
[0030] Further, the fluorescent donor is selected from FAM, TAMRA, Cy3, Cy5, Alexa Fluor series, Texas Red, SYBRGreen, Ethidium Bromide; the quenching group is selected from BHQ1, Dabcyl, QSY series, Iowa Black series, EclipseQuencher, TAMRA.
[0031] Further, the detection method for genotyping is the detection method for genotyping of gene-edited rice.
[0032] Further, the primer pair with a fluorescent donor labeled at the 5' end in S02) is:
[0033] F1569:6-FAM-TCCAAGAACTTGCCTTTTGCAATT
[0034] R1476:AGCTGACTATGCAAAGAACAACG.
[0035] Further, the gDNA sequence in S01) is selected from
[0036] gDNA-WT-5BHQ-CCTTGGGAACCGGGGC(3'-5')
[0037] gDNA-ET-12BHQ-GAACGGGCCCAGTAGC(3'-5').
[0038] Another aspect of the present invention provides a detection composition for genotyping, which contains the above mutant dPfAgo protein, an amplification primer pair for the target gene to be genotyped, and a guide DNA that can form a complex with the above mutant dPfAgo protein;
[0039] The upstream primer of the amplification primer pair is labeled with a fluorescent donor at the 5' end;
[0040] The 5' end of the guide DNA is phosphorylated and the 3' end is linked to a quenching group, and its sequence is complementary to a partial region of the target gene to be genotyped.
[0041] Further, the detection composition is used for genotyping of gene-edited rice.
[0042] Furthermore, the guide DNA sequence is selected from
[0043] gDNA-WT-5BHQ-CCTTGGGAACCGGGGC(3’-5’)
[0044] gDNA-ET-12BHQ-GAACGGGCCCAGTAGC(3’-5’).
[0045] Furthermore, the amplification primer pair is:
[0046] F1569:6-FAM-TCCAAGAACTTGCCTTTTGCAATT
[0047] R1476:AGCTGACTATGCAAAGAACAACG.
[0048] Beneficial effects
[0049] By site-directed mutagenesis of the key amino acid sites D628, D558, and E635 in PfAgo, a nuclease-inactivated dPfAgo mutant was successfully obtained. Based on these mutants, the present invention developed a novel fluorescence analysis method with single-base specificity, which can be used for genotyping. The dPAFS system can detect edited rice at a concentration as low as 0.1%, and achieves single-nucleotide specificity, capable of precisely distinguishing different genome editing variants. These capabilities are attributed to the binding of high-affinity tDNA to dPfAgo and gDNA. The invented dPAFS system does not require the incorporation of molecular beacons, thus significantly simplifying and reducing the complexity and cost of the PfAgo-mediated nucleic acid assay system. Therefore, the dPAFS platform expands the scope of programmable enzyme-mediated molecular diagnostics and provides a simple, sensitive, and specific method for genotyping genetically edited organisms. Brief description of the drawings
[0050] Figure 1 For the construction and characterization of the dPfAgo mutant. (A) Predicted catalytic residues of PfAgo. The spheres represent metal ions Mn 2+ . (B) Electrophoretogram showing PCR amplification of the pET28a vector (lane 1) and wild-type PfAgo (lane 2). Electrophoretogram of PfAgo mutant amplification: dPfAgo-D558A (lane 3), dPfAgo-D628A (lane 4), dPfAgo-E635A (lane 5). (C) Protein expression maps of dPfAgo-D558A, dPfAgo-D628A, dPfAgo-E635A (from left to right).
[0051] Figure 2Functional verification of dPfAgo mutants. (A) Cleavage activity of dPfAgo protein. "-" represents the negative control without Ago protein. (B) Specific binding activity of dPfAgo protein to tDNA. g1 and g2 refer to gDNA 1 and gDNA 2 respectively, and "-" represents the negative control without gDNA.
[0052] Figure 3 Schematic diagram of the reaction mechanism of the dPfAgo-mediated fluorescence sensing platform, demonstrating the binding of FAM-labeled primer and BHQ1-modified gDNA to the target DNA, resulting in fluorescence quenching via FRET.
[0053] Figure 4 Screening of specific gDNA for dPfAgo. (A) 13 gDNAs designed for the edited target with a 2-bp deletion. (B) 13 gDNAs designed for the wild-type target. Binding of gDNA-WT to the wild-type target (C) and the edited target (D). Binding of gDNA-ET to the wild-type target (E) and the edited target (F). The binding reactions with different gDNAs were analyzed using TBE-PAGE gels. (G) Quenching values of gDNA candidates for wild-type and edited targets, representing the quenching ratios of wild-type and edited targets. (H) Single-base mismatch determination of gDNA-WT candidates.
[0054] Figure 5 Optimization of dPAFS platform parameters. (A) Schematic diagram of the distance between the FAM donor and BHQ1 acceptor on the target sequence amplified by different primers. The gray area is the base between FAM and BHQ1, and the black area is the complementary sequence of the gDNA sequence on the target sequence. (B) Analysis of the effect of PCR amplification on the signal-to-noise ratio using the dPAFS platform with different FAM-coupled primers. (C) Effect of the number of quenching groups on the signal-to-noise ratio. (D) Effect of gDNA concentration on the signal-to-noise ratio. (E) Effect of dPfAgo concentration on the signal-to-noise ratio.
[0055] Figure 6For the specificity and sensitivity of the dPAFS platform. (A) Specificity of the dPAFS platform using gDNA-WT. Fluorescence signals of PCR amplification of CAO1-WT, CAO 1-3, CAO 1-6, CAO 1-7, and blank control. (B) Specificity of the dPAFS platform using gDNA-ET. (C) Sensitivity of the dPAFS platform for the detection of CAO 1-3 under the guidance of gDNA-ET. (D) Fluorescence signals of PCR amplification of actual wild-type samples, edited samples, and blank control under the guidance of gDNA-WT. (n = 3; *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001, ns: no statistically significant difference, error bars represent mean ± SEM)
[0056] Figure 7 For the specificity of dPAFS in complex background DNA. Detection of (a) a background genomic DNA mixture composed of soybean, corn, and Escherichia coli and (b) 0.1% CAO1-3 in the background sample using the dPAFS platform. Fluorescence signals Detailed implementation manners
[0057] To achieve the above object, the present invention adopts the following technical solutions:
[0058] An application of a dPfAgo-based biosensing platform in the detection of gene-edited crops, named dPAFS, includes the following steps:
[0059] Example 1 Construction of PfAgo mutant (dPfAgo) By site-directed mutagenesis of three residues D558, D628, and D635 in the PfAgo protein, a catalytically inactive PfAgo mutant (dPfAgo) was generated.
[0060] (1) Construction of the dPfAgo mutant vector
[0061] The PfAgo gene fragment and the pET28a vector were amplified using the primer pairs PfAgo-F and PfAgo-R, and pET28a-F and pET28a-R, respectively (Table 1). The recombinant plasmid pET28a-6×his-PfAgo was constructed by the T5 nuclease-mediated vector assembly method. Site-directed mutagenesis of the D558, D628, and E635 residues of the PfAgo gene was performed using the mutant-specific primers D558A-F and D558A-R, D628A-F and D628A-R, and E635A-F and E635A-R by overlap extension PCR to obtain the D558A, D628A, and E635A single mutants (Table 1). The amplification products were treated with DpnI at 65°C for 10 minutes and 37°C for 1 - 1.5 hours to remove the original template (Wu et al, 2018). The treated products were transformed into the Escherichia coli DH5a strain with the recA genotype, and the positive clones were subjected to DNA sequencing.
[0062] Table 1 shows the sequences used in this study
[0063]
[0064] Gel electrophoresis confirmed the successful amplification of the pET28a vector and the PfAgo gene. Bands matching the expected sizes of 5369 bp and 2361 bp were produced in lanes 1 and 2, respectively ( Figure 1 B). Clear bands of approximately 6000 bp, corresponding to the size of the target band (5955 bp), were observed in lanes 3, 4, and 5 by PCR verification of the constructed recombinant plasmids pET 28a-6×His-PfAgo-D558A, pET 28a-6×His-PfAgo-D628A, and pET 28a-6×His-PfAgo-E635A ( Figure 1 B).
[0065] (2) Expression and purification of dPfAgo
[0066] The recombinant plasmid pET28a-6×his-dPfAgo was transformed into Escherichia coli BL21(DE3)pLysS and cultured overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium containing 100 μg / mL kanamycin, and then cultured with horizontal shaking at 37°C until the OD600 reached 0.6 - 0.8. Protein expression was induced with 1 mM IPTG at 18°C for 16 - 18 hours. The bacterial cells were collected and lysed using a high-pressure cell disruptor. The lysed bacterial solution was centrifuged at 4°C and 14,000×g for 30 min using a refrigerated centrifuge. Then, the supernatant was heated at 80°C for 30 minutes to remove heat-labile contaminating proteins. Ni-NTA affinity chromatography was performed, and the eluate was eluted and collected using dPfAgo lysis buffer containing 250 mM imidazole. Subsequently, the sample was concentrated using a Millipore 50 kD ultrafiltration tube and stored in a specific resuspension buffer. The purified protein was rapidly frozen with liquid nitrogen and stored at -80°C to ensure its long-term storage and structural stability.
[0067] SDS-PAGE analysis showed a clear band at 90 kDa for all three target proteins, indicating that the purified proteins were of the expected size ( Figure 1 C).
[0068] The full sequence of the D628A mutant protein is SEQ ID NO.65:
[0069] SMKAIVVINLVKINKKIIPDKIYVYRLFNDPEEELQKEGYSIYRLAYENVGIVIDPENLIIATTKELEYEGEFIPEGEISFSELRNDYQSKLVLRLLKENGIGEYELSKLLRKFRKPKTFGDYKVIPSVEMSVIKHDEDFYLVIHIIHQIQSMKTLWELVNKDPKELEEFLMTHKENLMLKDIASPLKTVYKPCFEEYTKKPKLDHNQEIVKYWYNYHIERYWNTPEAKLEFYRKFGQVDLKQPAILAKFASKIKKNKNYKIYLLPQLVVPTYNAEQLESDVAKEILEYTKLMPEERKELLENILAEVDSDIIDKSLSEIEVEKIAQELENKIRVRDDKGNSVPISQLNVQKSQLLLWTNYSRKYPVILPYEVPEKFRKIREIPMFIILDSGLLADIQNFATNEFRELVKSMYYSLAKKYNSLAKKARSTNEIGLPFLDFRGKEKVITEDLNSDKGIIEVVEQVSSFMKGKELGLAFIAARNKLSSEKFEEIKRRLFNLNVISQVVNEDTLKNKRDKYDRNRLDLFVRHNLLFQVLSKLGVKYYVLDYRFNYDYIIGIDVAPMKRSEGYIGGSAVMFDSQGYIRKIVPIKIGEQRGESVDMNEFFKEMVDKFKEFNIKLDNKKILLLRAGRITNNEEEGLKYISEMFDIEVVTMDVIKNHPVRAFANMKMYFNLGGAIYLIPHKLKQAKGTPIPIKLAKKRIIKNGKVEKQSITRQDVLDIFILTRLNYGSISADMRLPAPVHYAHKFANAIRNEWKIKEEFLAEGFLYFV
[0070] The full sequence of the D558A mutant protein is: SEQ ID NO.66
[0071] SMKAIVVINLVKINKKIIPDKIYVYRLFNDPEEELQKEGYSIYRLAYENVGIVIDPENLIIATTKELEYEGEFIPEGEISFSELRNDYQSKLVLRLLKENGIGEYELSKLLRKFRKPKTFGDYKVIPSVEMSVIKHDEDFYLVIHIIHQIQSMKTLWELVNKDPKELEEFLMTHKENLMLKDIASPLKTVYKPCFEEYTKKPKLDHNQEIVKYWYNYHIERYWNTPEAKLEFYRKFGQVDLKQPAILAKFASKIKKNKNYKIYLLPQLVVPTYNAEQLESDVAKEILEYTKLMPEERKELLENILAEVDSDIIDKSLSEIEVEKIAQELENKIRVRDDKGNSVPISQLNVQKSQLLLWTNYSRKYPVILPYEVPEKFRKIREIPMFIILDSGLLADIQNFATNEFRELVKSMYYSLAKKYNSLAKKARSTNEIGLPFLDFRGKEKVITEDLNSDKGIIEVVEQVSSFMKGKELGLAFIAARNKLSSEKFEEIKRRLFNLNVISQVVNEDTLKNKRDKYDRNRLDLFVRHNLLFQVLSKLGVKYYVLDYRFNYDYIIGIAVAPMKRSEGYIGGSAVMFDSQGYIRKIVPIKIGEQRGESVDMNEFFKEMVDKFKEFNIKLDNKKILLLRDGRITNNEEEGLKYISEMFDIEVVTMDVIKNHPVRAFANMKMYFNLGGAIYLIPHKLKQAKGTPIPIKLAKKRIIKNGKVEKQSITRQDVLDIFILTRLNYGSISADMRLPAPVHYAHKFANAIRNEWKIKEEFLAEGFLYFV
[0072] Full sequence of E635 mutant protein: SEQ ID NO.67
[0073] SMKAIVVINLVKINKKIIPDKIYVYRLFNDPEEELQKEGYSIYRLAYENVGIVIDPENLIIATTKELEYEGEFIPEGEISFSELRNDYQSKLVLRLLKENGIGEYELSKLLRKFRKPKTFGDYKVIPSVEMSVIKHDEDFYLVIHIIHQIQSMKTLWELVNKDPKELEEFLMTHKENLMLKDIASPLKTVYKPCFEEYTKKPKLDHNQEIVKYWYNYHIERYWNTPEAKLEFYRKFGQVDLKQPAILAKFASKIKKNKNYKIYLLPQLVVPTYNAEQLESDVAKEILEYTKLMPEERKELLENILAEVDSDIIDKSLSEIEVEKIAQELENKIRVRDDKGNSVPISQLNVQKSQLLLWTNYSRKYPVILPYEVPEKFRKIREIPMFIILDSGLLADIQNFATNEFRELVKSMYYSLAKKYNSLAKKARSTNEIGLPFLDFRGKEKVITEDLNSDKGIIEVVEQVSSFMKGKELGLAFIAARNKLSSEKFEEIKRRLFNLNVISQVVNEDTLKNKRDKYDRNRLDLFVRHNLLFQVLSKLGVKYYVLDYRFNYDYIIGIDVAPMKRSEGYIGGSAVMFDSQGYIRKIVPIKIGEQRGESVDMNEFFKEMVDKFKEFNIKLDNKKILLLRDGRITNNAEEGLKYISEMFDIEVVTMDVIKNHPVRAFANMKMYFNLGGAIYLIPHKLKQAKGTPIPIKLAKKRIIKNGKVEKQSITRQDVLDIFILTRLNYGSISADMRLPAPVHYAHKFANAIRNEWKIKEEFLAEGFLYFV
[0074] Example 2 dPfAgo Protease Characterization Analysis
[0075] (1) Preparation of Phosphorylated gDNA
[0076] Phosphorylate the 5'-end of the synthesized gDNA oligonucleotide, using T4 polynucleotide kinase (T4PNK) to transfer the γ-phosphate group from ATP to the 5'-end hydroxyl group of gDNA. The phosphorylation reaction is carried out in a 50 μL system containing 5 μL of 10 mM ssDNA, 5 μL of 10× T4PNK buffer, 5 μL of 10 mM ATP, and 1 μL of T4PNK. Incubate the reactants at 37 °C for 30 minutes, and then denature the enzyme at 65 °C for 15 minutes.
[0077] (2) Determination of the cleavage activity of dPfAgo endonuclease
[0078] Method for preparing and verifying the cleavage system: To evaluate the cleavage activity, prepare a reaction mixture containing 5'-phosphorylated gDNA, FAM-labeled target ssDNA, reaction buffer, and 5 mM Mn 2+ in a PCR tube. Then add PfAgo protein and dPfAgo protein respectively, and carry out reactions at different reaction times (10–60 minutes) at 95 °C. After the reaction is completed, mix the samples with 2× TBE-PAGE loading buffer, incubate at 95 °C for 5 minutes, and analyze using 20% TBE-PAGE denaturing nucleic acid electrophoresis.
[0079] To verify the cleavage activity of the dPfAgo protein, a single-stranded guide DNA (gDNA1) with a 5'-terminal phosphate group and a single-stranded target DNA (tDNA) labeled with a 5'-FAM label were designed and synthesized (Table 1). Using the dPfAgo reaction buffer, in the presence of 0.5 mM Mn 2+ carry out the cleavage reaction of tDNA with wild-type PfAgo and mutant dPfAgo proteins (D558A and D628A).
[0080] As Figure 2 shown in A, the cleavage efficiency was evaluated through experiments with different reaction times. Lanes 1 to 4 illustrate the gradient-time cleavage of wild-type PfAgo protein, where significant cleavage product bands were observed, indicating robust enzyme activity. In contrast, lanes 5 to 8 show the reaction time results of dPfAgo-D558A, where no detectable cleavage occurred within the first 20 minutes, and only weak cleavage products were observed after 30 minutes, indicating a significant reduction in enzyme function. Similarly, lanes 9 to 12 represent the time cleavage of dAgo-D 628A protein, where no cleavage activity was observed during the initial 30 minutes, and only weak cleavage products appeared after 60 minutes of reaction. Lanes 14 to 17 represent the time cleavage of dAgo-E 635A protein, where no cleavage activity was observed within 60 minutes. These findings confirm that compared with dAgo-D558A, the dPfAgo-D628A and dPfAgo-E 635A mutants exhibit weaker cleavage activity.
[0081] By eliminating the cleavage catalytic activity, dPfAgo provides a controllable and versatile tool for applications that rely on binding specificity rather than cleavage properties. These results enhance the potential of dPfAgo in advanced molecular diagnostics, especially in situations where single-nucleotide specificity is required without false cleavage.
[0082] (3) dPfAgo Endonuclease Binding Activity Assay
[0083] Binding system preparation and verification method: To evaluate the DNA binding activity of the dPfAgo protein, equal components were mixed according to the above cleavage system and incubated at 95 °C for 15 min. After the reaction was completed, the sample was mixed with 10×TBE-PAGE buffer and subjected to 12% TBE-PAGE non-denaturing nucleic acid electrophoresis analysis.
[0084] To evaluate the DNA binding activities of dPfAgo-D558A, dPfAgo-D628A, and dPfAgo-E635A, gDNA1 and gDNA2 were used as guide DNAs that interact with tDNA. The reaction was carried out at 95 °C for 15 minutes on a PCR instrument.
[0085] The experimental results are shown in Figure 2 Panel B. Wild-type PfAgo was used as a control. Lanes 3, 4, and 5 show the cleavage products of PfAgo released after cleavage mediated by gDNA, confirming its expected activity. Lanes 1 and 2 contain only gDNA and tDNA without PfAgo. Due to the base complementary pairing between gDNA and tDNA, during the cooling process at the end of the reaction, gDNA will anneal to tDNA and form a gDNA-tDNA binary complex, generating a band larger than tDNA. This result confirms that gDNA can anneal to tDNA without the mediation of additional proteins, which is a key benchmark for analyzing the binding efficiency of mutants.
[0086] In contrast, lanes 9, 10, and 11 show the binding activity of dPfAgo-D558A. These results show that with the increase in the band signal at the loading well, the gDNA-tDNA band signal significantly decreases ( Figure 2B), It was inferred that these upper bands represent the dPfAgo-gDNA-tDNA ternary complex, indicating that most of the tDNA was effectively bound by dPfAgo-D558A. In addition, compared with the gDNA2 group, the amount of free gDNA-tDNA binary complex in the gDNA1-mediated system was lower, indicating that the binding efficiency of dPfAgo-D558A is affected by the gDNA sequence. Furthermore, a similar binding pattern was observed in the dPfAgo-D628A (lanes 6-8) and dPfAgo-E635A experimental groups (lanes 12-14). However, under the same conditions, the amount of gDNA-tDNA binary complex was less than that observed in dPfAgo-D558A, indicating that dPfAgo-D628A and dPfAgo-E635A showed better binding efficiency compared to dPfAgo-D628A. Therefore, due to the high binding activity and absence of cleavage activity of dPfAgo-D628A and dPfAgo-E635A, either dPfAgo-D628A was used for subsequent experiments.
[0087] The above confirmed that nuclease-deficient dPfAgo mutants can be prepared by mutating D628, D558, and E635.
[0088] Example 3 Establishment of a dPfAgo-mediated nucleic acid analysis method
[0089] (1) Principle and design of the dPAFS platform
[0090] A fluorescence sensing platform (dPAFS) was developed using the dPfAgo-D628A mutant for genotyping ( Figure 2 ). In this strategy, FAM was used as a fluorescent energy donor and labeled at the 5'-end of the primer to amplify genomic DNA. A gDNA specific to the edited sequence was designed, with a phosphate group at its 5'-end and a quenching group BHQ1 at its 3'-end as an energy acceptor. In the presence of edited DNA, the FAM-labeled amplicon was specifically recognized by the gDNA-dPfAgo complex, and a gDNA-dPfAgo-tDNA ternary complex was formed. Inside this complex, the close proximity of the FAM donor and the BHQ1 acceptor promoted efficient FRET. In contrast, in the presence of wild-type DNA, the FRET mechanism remained inactive, resulting in a high fluorescence signal.
[0091] (2) Screening of specific gDNA
[0092] gDNA is a key element in the dPfAgo binding system because it guides the specific recognition of dPfAgo to specific sequences in the target, which in turn activates the nuclease activity (Zhao et al., 2022). Thirteen 16bp gDNA sequences were designed to target the 5'-end FAM-labeled edited type (T-ET) and wild-type (T-WT) sequences ( Figure 4 A-B). To screen for gDNAs with high binding ability, the binding reactions of gDNA-WT and gDNA-ET mediated dPfAgo with FAM-labeled T-WT and T-ET were performed at 95 °C for 15 minutes, and then non-denaturing nucleic acid electrophoresis was carried out using 12% TBE-PAGE. To determine whether the binding of gDNA-mediated dPfAgo to target DNA is double-base specific, gDNA-WT and gDNA-ET with strong binding ability to the corresponding target were selected for cross-binding reactions with the target, and the gel imaging results of non-denaturing nucleic acid electrophoresis by TBE-PAGE can be used to screen for gDNAs with specific binding ability to both targets.
[0093] The CAO1-3 edited type (ET) and wild-type (WT) sequences were used as model targets ( Figure 4 A-B), and the screening process involved systematic binding reactions between various combinations of gDNA and tDNA to highly selectively identify the best gDNA candidates. The best gDNA-WT was defined as strongly binding to the wild-type target fragment while showing minimal interaction with the edited type fragment. Conversely, the best gDNA-ET should exhibit strong binding affinity for the mutant target fragment, and the binding to the wild-type fragment can be negligible.
[0094] As Figure 4 shown in C-D, several gDNA-WT candidates showed strong binding to the wild-type target but weak binding to the edited type target. Similarly, Figure 4 E-F revealed that some gDNA-ET candidates showed strong binding to the edited type target but minimal affinity for the wild-type target. This phenomenon is mainly attributed to the non-specific binding of gDNA-dPfAgo to the target during the electrophoresis analysis at room temperature.
[0095] To solve this problem, real-time fluorescence quantitative experiments were carried out at 95 °C to screen for specific gDNAs. The sequences of gDNA candidates, including gDNA-WT-1, gDNA-WT-3, gDNA-WT-4, gDNA-WT-5, gDNA-ET-6, gDNA-ET-11, and gDNA-ET-12, as well as their corresponding wild-type and edited type targets, are listed in Table 2. The Δ quenching value was calculated by subtracting the fluorescence signal under the guidance of gDNA from the blank signal, asFigure 4 As shown in Figure G, the results showed that gDNA-WT-5 exhibited a higher quenching value for the wild-type target but the minimum quenching for the edited target. In contrast, gDNA-ET-12 achieved the maximum Δ quenching value ratio (edited target / wild-type target). Based on these results, gDNA-WT-5 and gDNA-ET-12 were selected as the best guide sequences for genotyping genome-edited crops.
[0096] Table 2 shows the candidate gDNA sequences and their corresponding targets
[0097] Oligonucleotides Sequences gDNA-WT-1 BHQ-GGGAACCGGGGCCCAG(3’-5’)SEQ ID NO.24 T-WT-1 FAM-CCCTTGGCCCCGGGTCATCGACATGG SEQ ID NO.25 T-ET-1 FAM-CCCTTGCCCGGGTCATCGACATGGAA SEQ ID NO.26 gDNA-WT-3 BHQ-TTGGGAACCGGGGCCC(3’-5’)SEQ ID NO.27 T-WT-3 FAM-AACCCTTGGCCCCGGGTCATCGACAT SEQ ID NO.28 T-ET-3 FAM-AACCCTTGCCCGGGTCATCGACATGG SEQ ID NO.29 gDNA-WT-4 BHQ-CTTGGGAACCGGGGCC(3’-5’)SEQ ID NO.30 T-WT-4 FAM-GAACCCTTGGCCCCGGGTCATCGACA SEQ ID NO.31 T-ET-4 FAM-GAACCCTTGCCCGGGTCATCGACATG SEQ ID NO.32 gDNA-WT-5 BHQ-CCTTGGGAACCGGGGC(3’-5’)SEQ ID NO.33 T-WT-5 FAM-GGAACCCTTGGCCCCGGGTCATCGAC SEQ ID NO.34 T-ET-5 FAM-GGAACCCTTG CCCGGGTCATCGACAT SEQ ID NO.35 gDNA-ET-6 BHQ-CCTTGGGAACGGGCCC(3’-5’)SEQ ID NO.36 T-ET-6 FAM-GGAACCCTTGCCCGGGTCATCGACAT SEQ ID NO.37 T-WT-6 FAM-GGAACCCTTGGCCCCGGGTCATCGAC SEQ ID NO.38 gDNA-ET-11 BHQ-GGAACGGGCCCAGTAG(3’-5’)SEQ ID NO.39 T-ET-11 FAM-CCTTGCCCGGGTCATCGACATGGAAC SEQ ID NO.40 T-WT-11 FAM-CCTTGGCCCCGGGTCATCGACATGGA SEQ ID NO.41 gDNA-ET-12 BHQ-GAACGGGCCCAGTAGC(3’-5’)SEQ ID NO.42 T-ET-12 FAM-CTTGCCCGGGTCATCGACATGGAACA SEQ ID NO.43 T-WT-12 FAM-CTTGGCCCCGGGTCATCGACATGGAA SEQ ID NO.44
[0098] To analyze the specificity of gDNA-dPfAgo, single-base mismatch assays were performed under the guidance of g-WT-1, g-WT-3, g-WT-4, and g-WT-5. The sequences of the gDNAs, their corresponding wild-type targets, and three types of single-base mismatch targets (where A, G, and T replace the wild-type C site) are listed in Table 3. As Figure 4 shown in Figure H, the results showed that, except for g-WT-1, the fluorescence quenching values of g-WT-3, g-WT-4, and g-WT-5 were significantly lower when paired with mismatched A, T, and G compared to when paired with C. Among them, g-WT-5 exhibited a strong quenching value for the wild-type target, which was 5 to 20 times higher than the quenching values observed with the three single-base mismatch sequences. These findings highlight the high specificity of the dPAFS platform, enabling precise discrimination between wild-type and edited sequences at the resolution of a single base. The excellent target recognition ability can be attributed to the intrinsic binding properties of dPfAgo-D628A, which is capable of precise sequence discrimination without enzymatic cleavage.
[0099] Table 3 shows the candidate gDNA sequences, their corresponding targets, and single-base mismatch targets
[0100] Oligonucleotides Sequences gDNA-WT-1 BHQ-GGGAACCGGGGCCCAG(3’-5’)SEQ ID NO.45 FAM-CCCTTGGCCCCGGGTCATCGACATGG SEQ ID NO.46 FAM-CCCTTGGACCCGGGTCATCGACATGG SEQ ID NO.47 FAM-CCCTTGGGCCCGGGTCATCGACATGG SEQ ID NO.48 FAM-CCCTTGGTCCCGGGTCATCGACATGG SEQ ID NO.49 gDNA-WT-3 BHQ-TTGGGAACCGGGGCCC(3’-5’)SEQ ID NO.50 FAM-AACCCTTGGCCCCGGGTCATCGACAT SEQ ID NO.51 FAM-AACCCTTGGACCCGGGTCATCGACAT SEQ ID NO.52 FAM-AACCCTTGGTCCCGGGTCATCGACAT SEQ ID NO.53 FAM-AACCCTTGGGCCCGGGTCATCGACAT SEQ ID NO.54 gDNA-WT-4 BHQ-CTTGGGAACCGGGGCC(3’-5’)SEQ ID NO.55 FAM-GAACCCTTGGCCCCGGGTCATCGACA SEQ ID NO.56 FAM-GAACCCTTGGACCCGGGTCATCGACA SEQ ID NO.57 FAM-GAACCCTTGGTCCCGGGTCATCGACA SEQ ID NO.58 FAM-GAACCCTTGGGCCCGGGTCATCGACA SEQ ID NO.59 gDNA-WT-5 BHQ-CCTTGGGAACCGGGGC(3’-5’)SEQ ID NO.60 FAM-GGAACCCTTGGCCCCGGGTCATCGAC SEQ ID NO.61 FAM-GGAACCCTTGGACCCGGGTCATCGAC SEQ ID NO.62 FAM-GGAACCCTTGGTCCCGGGTCATCGAC SEQ ID NO.63 FAM-GGAACCCTTGGGCCCGGGTCATCGAC SEQ ID NO.64
[0101] (3) Fluorescence quenching performance of dPAFS
[0102] 3.1 Gene editing materials
[0103] In this laboratory, the CAO1 gene in Oryza sativa L. japonica was edited using the CRISPR / Cas9 system, and genome-edited rice seeds were prepared. Three homozygous lines of CAO1 editing, named CAO1-3, CAO1-6, and CAO1-7, were identified by sanger sequencing and used as model samples. The molecular characteristics of the edited and wild-type rice are shown in Table 1: CAO1-3 contains a 2bp deletion, CAO1-6 rice contains a 12bp deletion, CAO1-7 rice contains only a single nucleotide insertion, and Oryza sativa L. japonica was used as the wild-type control (Zhang et al, 2021).
[0104] 3.2 Extracting sample DNA
[0105] Wild-type and CAO1-edited rice mutant seeds were used as actual sample materials (Table 1). Genomic DNA was extracted according to the instructions of the NuCleanPlant Genomic DNA kit (CWBIO, Beijing, China). Subsequently, the concentration of the extracted DNA was measured using a NanoDrop2000UV spectrophotometer (Thermo Scientific, MA, USA).
[0106] 3.3 Primer design and DNA amplification
[0107] To study the optimal fluorescence quenching distance, several FAM-labeled forward primers were designed, and the distances from the FAM label of these primers to the BHQ1 at the 3' end of the gDNA were different ( Figure 4 A), and the primer sequences are detailed in Table 1.
[0108] PCR amplification experiments were carried out in a 20μL reaction mixture containing 2.0μL 10×PCR buffer, 2.0μL 10mM dNTPs, 1.0μL template DNA, and 1.0μL 10μM forward and reverse primers with a volume ratio of 1:1. The PCR program was set to 98℃ for 60 seconds, followed by 35 cycles of 98℃ for 10 seconds, 57℃ for 15 seconds, and 72℃ for 10 seconds, and finally extended at 72℃ for 5 minutes.
[0109] 3.4 Fluorescence signal detection
[0110] The PCR products were introduced into the dPfAgo detection system containing 40pmol dPfAgo and 40pmol 5′-P, 3′-BHQ1 gDNA. Fluorescence detection was carried out at 95℃ for 15 minutes on a Roche LightCycler 480II qPCR instrument, and the FAM fluorescence signal was recorded at 1-minute intervals.
[0111] 3.5 Optimization of Reaction Conditions
[0112] By analyzing two key factors affecting fluorescence resonance energy transfer: the distance between the donor and the acceptor and the number of quenching groups, the fluorescence quenching efficiency of the dPAFS platform was systematically evaluated, and the optimal detection conditions were determined to improve the performance of the system.
[0113] The distance between the FAM donor and the BHQ1 acceptor was varied by designing primers with different lengths from the FAM site to the BHQ1 tag. As Figure 4 shown in A, amplicons were generated by PCR amplification of the wild-type target using the designed different primers, resulting in 16, 20, 24, 28, 32 base distance differences between FAM and BHQ1 (corresponding to primer pairs F1561 / R1476, F1565 / R1476, F1569 / R1476, F1573 / R1476, and F1577 / R1476, respectively, see Table 1), and the resulting fluorescence signals were measured using the dPAFS platform. As Figure 4 shown in A, when the primer sequence was adjacent to the gDNA sequence, the distance between FAM and BHQ1 was 24 bases at this time. When the distance was less than 24 bases, the signal-to-noise ratio increased with the decrease in distance. This decrease was attributed to the interference of hybridization between the primer and the gDNA, which might hinder the effective FRET interaction. On the contrary, when the distance exceeded 24 bases, the signal-to-noise ratio began to increase ( Figure 4 B), indicating a high dependence of the quenching efficiency of the dPAFS system on the spatial interval between the donor and the acceptor. Based on these results, the primer pair F1569 / R1476 that generates a 24-base distance between FAM and BHQ1 was selected as the optimal design for achieving maximum fluorescence quenching.
[0114] To evaluate the effect of the number of BHQ1 groups on the quenching performance, the effects of gDNAs constructed with 1, 2, or 3 quenching groups were measured. As Figure 4 shown in C, the results showed that a single quenching group provided the best fluorescence quenching efficiency. The increased BHQ1 groups did not further improve the quenching performance, indicating that a single quencher was sufficient for optimal FRET interaction.
[0115] To improve the detection system, the concentrations of gDNA and dPfAgo were systematically optimized. Six different concentrations of gDNA from 10 to 60 pmol were detected, and 40 pmol was determined to be the optimal concentration. Similarly, the dPfAgo concentration was set from 5 to 50 pmol for detection, and 40 pmol was determined to be the optimal concentration ( Figure 4 E). These conditions ensured maximum signal quenching and detection sensitivity.
[0116] 3.6 Specificity and sensitivity of dPAFS
[0117] The specificity of the developed dPAFS platform was evaluated using different CAO1-edited rice variants as model targets. Using the genome-edited variant sequences, each at a concentration of 1×10 -5 ng / μL, as the initial template for PCR amplification, and subsequently, the amplified products were analyzed using the dPAFS platform. As Figure 5 shown in A, under the guidance of gDNA-WT-5, the fluorescence signals from the edited mutants (including CAO 1-3, CAO 1-6, and CAO 1-7) were comparable to the blank signal. However, at the same template concentration, a statistically significant fluorescence quenching of wild-type rice was observed. In addition, significant fluorescence quenching was also observed for wild-type and CAO1-7 containing a single nucleotide insertion, highlighting the single-base specificity of the proposed method. Under the guidance of gDNA-ET-12, Figure 5 B shows a significant statistical difference (p<0.0001) between the fluorescence signals of the edited and wild-type samples, while no significant difference was observed between the wild-type and blank signals. To further verify the specificity of the proposed method, 0.1% of CAO1-3 genomic DNA was tested in various background samples containing genomic DNA from soybean, corn, and Escherichia coli, and no false-positive results were detected ( Figure 6 ). The results demonstrated the significant specificity of the dPAFS platform for genotyping genome-edited rice and its potential for analyzing high-level background genomic DNA targets.
[0118] To evaluate the sensitivity of the dPAFS system, under the guidance of gDNA-ET-12, the PCR amplified products of CAO1-3 were tested in a series of concentration ranges by diluting the genomic DNA of CAO1-3 with purified wild-type rice genomic DNA to achieve 100%, 50%, 5%, 0.5%, and 0.1%. As Figure 5 shown in C, the fluorescence signal gradually increased as the concentration of the gene-edited type decreased because the BHQ1 receptor coupled to the FAM donor decreased, thus reducing the incidence of FRET. The dPAFS platform reliably detected gene-edited rice as low as 0.1%, demonstrating that the sensitivity is sufficient to meet regulatory thresholds, such as the 0.9% labeling requirement for biotech crops in the European Union. These findings highlight the strong specificity and sensitivity of the dPAFS platform in identifying genome-edited crops.
[0119] 3.7 Detection of actual samples
[0120] To evaluate the utility of the developed dPAFS platform, actual rice seed samples were analyzed. Genomic DNA was extracted from CAO1-3 edited and wild-type rice seeds, and PCR amplification was performed. The resulting products were detected using the dPAFS platform under the guidance of gDNA-WT-5. As Figure 5 shown in D, the fluorescence signals of the edited samples were statistically significantly higher than those of wild-type rice (P < 0.0001). These results demonstrated the reliability and potential of the dPAFS platform for detecting genomically edited organisms.
Claims
1. A nuclease-inactive mutant dPfAgo protein, characterized in that: Relative to the wild-type PfAgo protein, the mutant dPfAgo protein was subjected to site-directed mutagenesis at one or more of the following sites: D628A, D558A, and E635A; Preferably, the sequence of the mutant dPfAgo protein is shown in SEQ ID NO.65-67.
2. The method for preparing the mutant dPfAgo protein according to claim 1, characterized in that: The preparation method comprises performing site-directed mutagenesis on one or more of the D628A, D558A, and E635A sites of the PfAgo protein; Preferably, the site-directed mutagenesis method in the preparation method is performed using an overlap extension PCR method.
3. The preparation method according to claim 2, characterized in that: The primer pairs used in the method for site-directed mutagenesis of the D628A site are: D628A-F TGCGTGCAGGTCGCATTACCAATA SEQ ID NO.13 D628A-R TGCGACCTGCACGCAGCAGCAGGATTTTTT SEQ ID NO.14; The primer pairs used in the method for site-directed mutagenesis of the D558A site are: D558A-F TGGCATTGCAGTGGCACCGATG SEQ ID NO.11 D558A-R GCCACTGCAATGCCAATGATATAATC SEQ ID NO.12; The mutation-specific primer pair used in the method for site-directed mutagenesis of the E635A site was: E635A-F TAATGCAGAAGAAGGCCTGAAATATATCAGCG SEQ ID NO.15 E635A-R GGCCTTCTTCTGCATTATTGGTAATGCGACCATCACG SEQ ID NO.
16.
4. The preparation method according to claim 2, characterized in that: The preparation method comprises the following steps: S1) Construction of recombinant plasmid: The PfAgo gene fragment was assembled with the pET28a vector by T5 nuclease-mediated vector assembly method to construct a recombinant plasmid containing pET28a and PfAgo; the D558, D628 and / or E635 residues of the PfAgo gene were site-directed mutagenesis using mutation-specific primers using overlap extension PCR technology to obtain a single mutant recombinant plasmid; S2) Expression and purification: The recombinant plasmid containing pET28a and PfAgo was transformed into Escherichia coli for culture, single colonies were counted into the culture concentrate, and protein expression was induced by IPTG; the supernatant of lysed bacteria was collected and purified; the mutant dPfAgo protein was obtained.
5. A method for detecting genotyping, characterized in that: The detection method comprises the following steps: S01) Designing guide DNA (gDNA): the 5' end of the gDNA is phosphorylated and the 3' end is connected to a quenching group, and the sequence of the gDNA is complementary to a specific region of the target edited or wild-type nucleic acid; S02) amplifying the target nucleic acid: using a primer labeled with a fluorescent donor at the 5' end to perform PCR amplification on the target nucleic acid to obtain a fluorescently labeled amplicon; S03) mixing the amplicon of step S2) with the mutant dPfAgo protein of claim 1 and the gDNA obtained in step S1), and observing the fluorescence signal; determining the gene type by detecting the change of the fluorescence signal; When the sequence of the gDNA in S01) is complementary to the target edited nucleic acid, if the edited DNA exists in the amplicon, no fluorescent signal is generated; if the wild-type DNA exists in the amplicon, a fluorescent signal is generated; When the sequence of the gDNA in S01) is complementary to the target wild type, if the amplicon contains wild type DNA, no fluorescent signal is generated; if the amplicon contains edited DNA, a fluorescent signal is generated.
6. The detection method according to claim 5, characterized in that S1) also includes the step of screening gDNA; screening the gDNA with the largest quenching value ratio binding to the wild-type or edited fragment in the amplicon of S2).
7. The detection method according to claim 5, wherein the fluorescent donor is selected from FAM, TAMRA, Cy3, Cy5, Alexa Fluor series, Texas Red, SYBR Green, Ethidium Bromide; and the quenching group is selected from BHQ1, Dabcyl, QSY series, IowaBlack series, Eclipse Quencher, TAMRA.
8. The detection method according to claim 5, wherein the genotyping detection method is a genotyping detection method for gene-edited rice; The primer pair with the 5' end labeled fluorescent donor in S02) is: F1569:6-FAM-TCCAAGAACTTGCCTTTTTGCAATT R1476:AGCTGACTATGCAAAGAACAACG; S01) wherein the gDNA sequence is selected from: gDNA-WT-5BHQ-CCTTGGGAACCGGGGC(3'-5') gDNA-ET-12BHQ-GAACGGGCCCAGTAGC(3'-5').
9. A detection composition for genotyping, characterized in that: The composition comprises the mutant dPfAgo protein of claim 1, a primer pair for amplification of a target gene to be genotyped, and a guide DNA capable of forming a complex with the mutant dPfAgo protein of claim 1; The 5' end of the upstream primer of the amplification primer pair is labeled with a fluorescent donor; The guide DNA is phosphorylated at its 5' end and connected to a quencher at its 3' end, and its sequence is complementary to a partial region of the target gene to be genotyped.
10. The detection composition according to claim 9, characterized in that It is used for genotyping of gene-edited rice; The guide DNA sequence is selected from: gDNA-WT-5BHQ-CCTTGGGAACCGGGGC(3'-5') gDNA-ET-12BHQ-GAACGGGCCCAGTAGC(3'-5'); The amplification primer pairs are: F1569:6-FAM-TCCAAGAACTTGCCTTTTTGCAATT R1476:AGCTGACTATGCAAAGAACAACG.