CBHII protein mutant as well as preparation method and application thereof

By modifying the linking peptide of CBHII protein, a variety of CBHII protein mutants were constructed, solving the problem of low enzymatic lysis efficiency caused by non-productive adsorption of enzymes and lignin, and achieving the effect of improving cellulose hydrolysis efficiency and reducing enzymatic lysis cost.

CN120192952APending Publication Date: 2025-06-24NANJING FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510250178.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-04
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

In the existing cellulose enzymatic technology, the non-productive adsorption of enzymes and lignin leads to low enzymatic efficiency, which increases the amount and cost of enzymes.

Method used

By modifying the linking peptide of CBHII protein, a variety of CBHII protein mutants were constructed, reducing their adsorption with lignin and improving their hydrolysis efficiency of cellulose.

Benefits of technology

The modified CBHII protein mutant significantly improves the specific enzyme activity and enzymatic lysis efficiency of cellulose, reduces the adsorption of lignin, and thus reduces the cost of enzymatic lysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192952A_ABST
    Figure CN120192952A_ABST
Patent Text Reader

Abstract

The invention discloses a CBHII protein mutant as well as a preparation method and application thereof, and relates to the technical field of preparation and application of enzyme preparations. According to the invention, connecting peptide of CBHII protein is modified to obtain seven mutant proteins. The results of the embodiment show that the cellulose activity is increased by CBHII-L-14, CBHII-LR = N, CBHII-L-17 and CBHII-L-3-2, and the cellulose activity is reduced by CBHII-L + 2. Different mutants also show different cellulose and lignin adsorption capacities. When the lignin-containing filter paper is subjected to synergistic enzymolysis, the enzymolysis efficiencies of CBHII-L-14, CBHII-L-17, CBHII-L-3-2, CBHII-LR = N and CBHII-L10 are respectively 1.49 times, 1.35 times, 1.31 times, 1.16 times and 1.12 times of those of the wild type CBHII.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of the preparation and application of enzyme preparations, and more specifically, relates to a CBHII protein mutant, a preparation method thereof, and an application thereof. Background Art

[0002] In the enzymatic hydrolysis and saccharification of cellulose, the low enzymatic hydrolysis efficiency, resulting in a large amount of enzyme used and high enzymatic hydrolysis cost, is the main factor restricting the biorefining of lignocellulose. At the same time, lignin in lignocellulosic raw materials not only hinders the contact between enzymes and cellulose substrates, but also the non-productive adsorption of enzymes and lignin reduces the effective concentration of enzymes, further weakening the ability of enzymes to hydrolyze cellulose. Reducing the cost of enzymatic hydrolysis by reducing the non-productive adsorption of enzymes and lignin or improving the hydrolysis efficiency of enzymes is the key to realizing the efficient utilization of lignocellulosic raw materials.

[0003] Currently, the work on reducing non-productive adsorption is mainly carried out from two aspects. On the one hand, physical barriers are removed or relevant properties of substrates are modified through pretreatment, such as changing the conditions and methods of pretreatment or chemically modifying the physicochemical structure of residual lignin to reduce the non-productive adsorption of enzymes and lignin. However, no matter which pretreatment method is used, lignin cannot be completely removed, and the remaining lignin is more likely to adsorb cellulase due to stronger hydrophobicity. On the other hand, it has been found that there are obvious differences in the adsorption between different cellulases and lignin, and the structural characteristics of the enzymes themselves determine their adsorption methods and degrees to lignin. By molecular modification of cellulase and directed evolution to reduce its adsorption to lignin, obtaining cellulase with weak lignin adsorption is an effective strategy.

[0004] Most commercial cellulases are derived from Trichoderma reesei. The extracellular proteins secreted by Trichoderma reesei are mainly cellulases, which are a complex enzyme system composed of cellobiohydrolase (CBH: EC 3.2.1.91), endo-β-glucanase (EG: EC 3.2.1.4), and β-glucosidase (EC 3.2.1.21), etc., accounting for more than 80% of the extracellular proteins. Cellobiohydrolase includes cellobiohydrolase I (CBH I) and cellobiohydrolase II (CBH II). Among them, cellobiohydrolase II (CBHII or TrCel6A) is an important exo-type cellulase in the cellulase system, accounting for about 20% of the extracellular proteins. It sequentially releases cellobiose from the non-reducing end of cellulose in an exo-type manner. CBHⅡ has strong enzyme specificity and relatively high activity, and has a significant impact on the hydrolysis performance of the entire cellulase system.

[0005] A single cellulase of fungal origin usually consists of a catalytic domain and a carbohydrate-binding domain, which are connected by a flexible linker peptide. The binding domain is considered to be the key to the adsorption of cellulase on lignin. However, studies have found that removing or modifying the binding domain reduces the adsorption of cellulase on lignin while also reducing the adsorption of cellulase on cellulose. The catalytic domain plays a secondary role in the adsorption process of cellulase and lignin. Some studies have modified the catalytic domain to reduce the adsorption of cellulase and lignin, but the complexity of the domain structure and the large number of uncertain factors make the modification difficult. The linker peptide of fungal cellulase is different from the catalytic domain and the binding domain in that it has a high degree of conservation. The linker peptides of cellulases from different sources have a low degree of similarity, and the co-regulatory effect of the linker peptide on the domain is diverse. A large number of experiments have shown that modifying the length, sequence, and glycosylation molecules of the linker peptide can improve the related properties of cellulase. Existing studies have all focused on the modification of the catalytic domain or binding domain of CBHII, and there is insufficient research on the modification of the linker peptide molecule to regulate the enzymatic properties and functions. Summary of the Invention

[0006] In view of the above problems existing in the prior art, the technical problems to be solved by the present invention are to provide a CBHII mutant. Another technical problem to be solved by the present invention is to provide a method for preparing a CBHII mutant. The technical problem to be solved by the present invention is also to provide the application of the CBHII mutant for regulating the adsorption ability of cellulase to cellulose and lignin.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0008] A CBHII protein mutant, characterized in that a CBHI protein mutant is obtained by only modifying the linker peptide of CBHI, and the name and the corresponding amino acid sequence of the modified linker peptide are shown in Table 2.

[0009] A method for preparing a CBHII protein mutant, characterized in that the linker peptide of the CBHII protein is modified as follows: TSR is truncated from ASSSSSTRAASTTSRV in the linker peptide, SSS is truncated from VSPTTSRSSSAT in the linker peptide, SPTTSRSSSA or SRVSPTTSRSSSAT or ASTTSRVSPTTSRSSSA is truncated from the linker peptide, RS is inserted after the linker peptide ASSSSSTRAASTTSRVSPTTSRSSSAT, or R in the linker peptide TTSRVSPT is replaced with N.

[0010] The steps of the method for preparing a CBHII protein mutant are as follows:

[0011] 1) Extraction of genomic DNA of Trichoderma reesei QM9414 and amplification of the target gene;

[0012] 2) Construction of constitutive promoter expression vector;

[0013] 3) Construction of recombinant plasmid;

[0014] 4) Transformation and screening of Escherichia coli;

[0015] 5) Transformation, screening and expression of Trichoderma reesei.

[0016] The preparation method of CBHII protein mutant uses promoter cdna1; the constitutive promoter expression vector is M13-Pcdna1-Tcbh1.

[0017] The primer sequences (5'-3') used in the preparation method of CBHII protein mutant are shown in Table 1.

[0018] Application of CBHII protein mutant in enzymatic hydrolysis of cellulose.

[0019] The described CBHII protein mutant is selected from CBHⅡ-L-3-1 protein, and / or CBHⅡ-L-3-2 protein, and / or CBHⅡ-L-10 protein, and / or CBHⅡ-L-14 protein, and / or CBHⅡ-L-17 protein, and / or CBHⅡ-L R=N protein.

[0020] Application of CBHII protein mutant in synergistic hydrolysis of cellulose with endoglucanase and β-glucosidase.

[0021] The described protein mutant is selected from CBHⅡ-L-3-2 protein, and / or CBHⅡ-L-10 protein, and / or CBHⅡ-L-14 protein, and / or CBHⅡ-L-17 protein, and / or CBHⅡ-L R=N protein.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] 1) The present invention modifies the linker peptide of the CBHII protein to obtain protein mutants CBHⅡ-L-3-1 with TSR deleted from ASSSSSTRAASTTSRV; CBHⅡ-L-3-2 with SSS deleted from VSPTTSRSSSAT; CBHII-L-10 with SPTTSRSSSA deleted; CBHII-L-14 with SRVSPTTSRSSSAT deleted; CBHII-L-17 with ASTTSRVSPTTSRSSSA deleted; CBHII-L+2 with RS inserted after the linker peptide ASSSSSTRAASTTSRVSPTTSRSSSAT; and CBHⅡ-L with R in the linker peptide TTSRVSP replaced by N. R=N The CBHII protein and its mutants are ligated with the M13-Pcdna1-Tcbh1 vector. After constructing recombinant mutant plasmids, the ligation products are respectively transformed into competent Escherichia coli cells, and the obtained mutant strains are named: QM9414-CBHⅡ, QM9414-CBHⅡ-L-3-1, QM9414-CBHⅡ-L-3-2, QM9414-CBHⅡ-L-10, QM9414-CBHⅡ-L-14, QM9414-CBHⅡ-L-17, QM9414-CBHⅡ-L+2, QM9414-CBHⅡ-L. R=N .

[0024] 2) The present invention purifies the recombinase and determines the enzymatic properties of the recombinant protease of the mutant strains. The results show that the optimal temperature, optimal pH, temperature stability, and pH stability of the mutants have no obvious differences from those of the wild type; the activity of the mutants towards cellulose substrates is significantly different from that of the wild type. When using 80% phosphoric acid-swollen cellulose as the substrate: compared with the CBHII protein, the specific enzyme activities of CBHII-L-14, CBHⅡ-L R=N , and CBHⅡ-L-17 are all significantly increased; there are no obvious differences for the other 4 mutants compared with the CBHII protein. When using microcrystalline cellulose as the substrate: compared with the CBHII protein, the specific enzyme activities of CBHII-L-14 and CBHⅡ-L-17 are both significantly increased; the specific enzyme activities of CBHⅡ-L-3-2, CBHⅡ-L-10, and CBHⅡ-L R=N all increase slightly; there is no obvious difference for CBHⅡ-3-1; while the specific enzyme activity of CBHⅡ-L+2 decreases slightly. When using filter paper as the substrate: compared with the CBHII protein, the specific enzyme activities of CBHII-L-14, CBHⅡ-L-17, CBHⅡ-L-3-2, and CBHⅡ-L R=NThe specific enzyme activities all increased significantly;; There was no obvious difference in CBHⅡ-L-10; The specific enzyme activities of CBHⅡ-L-3-1 and CBHⅡ-L+2 decreased slightly.

[0025] 3) The present invention determined the affinities of CBHII and its mutants for cellulose (microcrystalline cellulose and 80% phosphoric acid-swollen cellulose). Compared with the CBHII protein, the affinity capacities of CBHⅡ-L-3-1, CBHⅡ-L-14, and CBHⅡ-L-17 for the two cellulose substrates all increased significantly; The affinity capacity of CBHⅡ-L-10 for the microcrystalline cellulose substrate decreased; The affinity capacities of CBHⅡ-L-3-2 and CBHⅡ-L+2 for the cellulose substrate were not much different from those of the CBHII protein; CBHⅡ-L R=N The affinity capacity for 80% phosphoric acid-swollen cellulose decreased compared with the CBHII protein, but the affinity capacity for microcrystalline cellulose increased compared with the CBHII protein.

[0026] 4) The present invention determined the affinities of CBHII and its mutants for lignin. Compared with the CBHII protein, the affinity capacities of CBHⅡ-L+2 and CBHⅡ-L-3-1 for lignin both increased significantly; The affinity capacities of CBHⅡ-L-10, CBHⅡ-L-17, CBHⅡ-L-14, CBHⅡ-L-3-2, and CBHⅡ-L R=N for lignin all decreased.

[0027] 5) The present invention determined the catalytic activities of CBHII and its mutants for different substrates. When using microcrystalline cellulose as the substrate, the residual activity of CBHⅡ was 71%. Compared with CBHⅡ, the residual activities of CBHⅡ-L-17 and CBHⅡ-L-14 increased; The residual activities of CBHⅡ-L-3-1, CBHⅡ-L-3-2, CBHⅡ-L-10, and CBHⅡ-L R=N had no significant difference from that of CBHⅡ; The residual activity of CBHⅡ-L+2 decreased. When using filter paper as the substrate, the residual activity of CBHⅡ was 69.7%, while the residual activities of CBHⅡ-L-14, CBHⅡ-L-17, and CBHⅡ-L R=N increased; The residual activities of CBHⅡ-L-3-1, CBHⅡ-L-3-2, and CBHⅡ-L-10 had no significant difference from that of CBHⅡ, and the residual activity of CBHⅡ-L+2 decreased. The reducing sugar yields of CBHII-L-14, CBHⅡ-L-17, CBHⅡ-L-3-2, CBHⅡ-L R=N and CBHⅡ-L-10 increased after synergistic enzymatic hydrolysis of filter paper with EGⅠ and β-cellulose for 48 h; The difference between CBHⅡ-L-3-1 and CBHII was not significant; While CBHⅡ-L+2 was slightly lower than CBHII. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the structural diagram of the expression vector M13-Ptef1-Tcbh1;

[0029] Figure 2 Recombinant plasmid map (M is Marker, 1 is M13-Pcdna1-CBHⅡ-Tcbh1; 2 is M13-Pcdna1-CBHⅡ-L-3-1-Tcbh1; 3 is M13-Pcdna1-CBHⅡ-L-3-2-Tcbh1; 4 is M13-Pcdna1-CBHⅡ-L-10-Tcbh1; 5 is M13-Pcdna1-CBHⅡ-L-14-Tcbh1; 6 is M13-Pcdna1-CBHⅡ-L-17-Tcbh1; 7-9 are M13-Pcdna1-CBHⅡ-L+2-Tcbh1; 10-11 are M13-Pcdna1-CBHⅡ-L R=N -Tcbh1);

[0030] Figure 3 It is the SDS-PAGE result analysis diagram of CBHⅡ and its mutants (M is marker; 1-8 are CBHⅡ, CBHⅡ-L-3-1, CBHⅡ-L-3-2, CBHⅡ-L-14, CBHⅡ-L-17, CBHⅡ-L-10, CBHⅡ-L+2, CBHⅡ-L R=N );

[0031] Figure 4 It is the specific enzyme activity diagram of CBHⅡ and its mutants against three kinds of cellulose substrates;

[0032] Figure 5 It is the continuous enzymatic hydrolysis time curve diagram of CBHⅡ and its mutants on microcrystalline cellulose;

[0033] Figure 6 It is the continuous enzymatic hydrolysis time curve diagram of CBHⅡ and its mutants on the substrate filter paper;

[0034] Figure 7 It is the specific enzyme activity diagram of CBHⅡ and its mutants with microcrystalline cellulose as the substrate after adding lignin;

[0035] Figure 8 It is the specific enzyme activity diagram of CBHⅡ and its mutants with filter paper as the substrate after adding lignin;

[0036] Figure 9 It is the reducing sugar release diagram of CBHⅡ and its mutants in synergistic enzymatic hydrolysis with EGⅠ+β-cellulose for 48 h;

[0037] Figure 10 It is the time curve diagram of CBHⅡ and its mutants in synergistic enzymatic hydrolysis with EGⅠ;

[0038] Figure 11 Figure for the amount of reducing sugar released by the 48-hour reaction of adding lignin to the synergistic action of CBH II and its mutants with EG I for 48 hours;

[0039] Figure 12 Figure for the time curve of the synergistic enzymatic hydrolysis of CBH II and its mutants with EG I after adding lignin. Detailed implementation mode

[0040] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described below in conjunction with specific embodiments. In the following embodiments, if not otherwise specified in detail, the technical means used are all conventional means well known to those skilled in the art.

[0041] In the following embodiments, the main reagents and measurement methods used are as follows:

[0042] 1) Preparation of 80% phosphoric acid swollen cellulose: Weigh 0.2 g of microcrystalline cellulose into a 50 mL centrifuge tube, add 600 μL of distilled water and shake until it becomes a paste; prepare 80% phosphoric acid, add 10 mL of 80% phosphoric acid to the centrifuge tube, shake evenly and let it stand on ice for 1 h; add 10 mL of pre-cooled distilled water, shake evenly, centrifuge at 4 °C and 10000 rpm for 10 min, discard the supernatant, and repeat 4 times; add 20 mL of distilled water to suspend the precipitate, adjust the pH to about 5 with 2 M Na2CO3, centrifuge at 4 °C and 10000 rpm for 10 min, and discard the supernatant; resuspend the precipitate with distilled water to 20 mL, shake evenly, and store at 4 °C; 80% phosphoric acid swollen cellulose is prepared.

[0043] 2) Determination of cellulase activity:

[0044] Activity of 80% phosphoric acid swollen cellulose: Take 400 µL of the above-prepared 80% phosphoric acid swollen cellulose into a 2 mL centrifuge tube (final concentration is 4 mg / mL), add 1 µM of pure enzyme, make up the sodium acetate buffer (pH 5.0) to 1 mL, shake and react at 50 °C and 1000 rpm for 12 h, and measure its enzyme activity. One unit of enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol of reducing sugar (calculated as cellobiose) per minute under the above reaction conditions.

[0045] Activity of microcrystalline cellulose: Take 400 µL of 1% microcrystalline cellulose into a 2 mL centrifuge tube (final concentration is 4 mg / mL), add 3 µM of pure enzyme, make up the sodium acetate buffer (pH 5.0) to 1 mL, shake and react at 50 °C and 1000 rpm for 12 h, and measure its enzyme activity.

[0046] Filter paper enzyme activity: Cut the filter paper (Whatman No. 1) into strips of 1×3.5, divide it into 8 small portions (30 mg), place them in a centrifuge tube, add 3 µM of pure enzyme, make up the sodium acetate buffer solution (pH 5.0) to 1 mL, react with shaking at 50 °C and 1000 rpm for 12 h, and measure its enzyme activity.

[0047] The primer sequences used are shown in Table 1.

[0048] Table 1 Primer sequences

[0049]

[0050] Example 1 Construction of mutants

[0051] 1. Extraction of Trichoderma reesei QM9414 genome

[0052] Inoculate Trichoderma reesei QM9414 on a PDA plate and culture it at 28 °C for 7 days. After waiting for the spores to germinate, scrape the spores and inoculate them into the liquid shake flask seed medium, and culture them at 28 °C and 200 rpm for 2 days to obtain the seed liquid. Inoculate the seed liquid into the liquid shake flask fermentation medium at an inoculation amount of 4%, and culture it at 28 °C and 200 rpm for 5 days, and collect the mycelium. Use the TransGen plant genomic DNA extraction kit to extract the genome, and the method is shown in the instruction manual.

[0053] 2. Construction of the constitutive promoter expression vector M13-Pcdna1-Tcbh1

[0054] Using the genome of Trichoderma reesei QM9414 as a template, the cdna1 promoter was amplified by PCR with primers cdna1-F1 / cdna1-R1. The primer sequences are shown in Table 1. The plasmid pBI-PTcbh1 containing Xho Ⅰ and Kpn Ⅰ restriction sites (constructed by the inventors of this application in the early stage: Liangkun Long, Lu Sun, Zhen Liu, Qunying Lin, Jing Wang, Shaojun Ding*(2022) Functional characterization of a GH62 family α-L-arabinofuranosidase from Eupenicillium parvum suitable for monosaccharification of corncob arabinoxylan in combination with key enzymes. Enzyme and Microbial Technology. 154, 109965. https: / / doi.org / 10.1016 / j.enzmictec.2021.109965) was digested with double enzymes to remove the cbh1 promoter.

[0055] The double digestion system was as follows: The fragment or plasmid 2μL, 10× Qcut buffer 2μL, Kpn Ⅰ 1μL, Xho Ⅰ 1μL, ddH2O 25μL. Incubate at 37°C for 30 min. After the reaction, the purified product was detected by agarose gel electrophoresis.

[0056] The digested plasmid and the cdna1 promoter were ligated using the Novozymes homologous recombination kit to obtain an expression vector containing the cdna1 promoter, named M13-Pcdna1-Tcbh1. The vector structure diagram is as Figure 1 shown.

[0057] 3. Construction of recombinant plasmid

[0058] In this example, CBHII from Trichoderma reesei was used as the object, and the linker peptide was modified in terms of the length, glycosylation, and charged amino acids of the linker peptide. Six mutants, namely CBHⅡ-L-3-1 (deleting TSR in ASSSSSTRAASTTSRV), CBHⅡ-L-3-2 (deleting SSS in VSPTTSRSSSAT), CBHⅡ-L-10 (deleting SPTTSRSSSA), CBHⅡ-L-14 (deleting SRVSPTTSRSSSAT), CBHⅡ-L-17 (deleting ASTTSRVSPTTSRSSSA), and CBHⅡ-L+2 (inserting SR after the linker peptide ASSSSSTRAASTTSRVSPTTSRSSSAT), and CBHⅡ-LR=N (replacing R in the linker peptide TTSRVSPT with N), were constructed. The sequences of each mutant are shown in Table 2.

[0059] Table 2 Sequences of mutants

[0060]

[0061] Using the wild-type cbhII gene (GenBank: M55080.1) as a template, the upper and lower fragments of the mutant were first amplified by PCR separately, and then the upper and lower fragments were fused by fusion PCR to obtain the complete target gene.

[0062] The PCR amplification system was: Template 1μL, Forward primer(10μM) 1μL, Reverse primer(10μM) 1μL, Fastpfu DNA Polymerase 1μL, dNTPs(2.5mM)4μL, 5×PSBuffer 10μL, ddH2O 32μL.

[0063] The PCR reaction conditions were: 95℃ for 4min; 95℃ for 20s, 55℃ for 20s, 72℃ for 2min, 30 cycles; 75℃ for 5min; 16℃ ∞.

[0064] The specific steps are as follows:

[0065] 1) M13-Pcdna1-CBHⅡ-Tcbh1 recombinant plasmid

[0066] Using the Trichoderma reesei genome as a template, the cbh2 gene (GenBank No. M16190.1) was amplified by PCR using the primers cbh2-F1 / cbh2-R1.

[0067] The cbh2 gene was ligated to the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the M13-Pcdna1-CBHⅡ-Tcbh1 recombinant plasmid.

[0068] 2) M13-Pcdna1-CBHⅡ-L-3-1-Tcbh1 recombinant plasmid

[0069] Using the cbh2 gene as a template, the upper fragment of cbh2-l-3-1 was amplified with the downstream primer cbh2-R2 of cbh2-l-3-1 and the upstream primer cbh2-F1 of cbh2; using the cbh2 gene as a template, the lower fragment of cbh2-l-3-1 was amplified with the upstream primer cbh2-F2 of cbh2-l-3-1 and the downstream primer cbh2-R1 of cbh2; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-l-3-1.

[0070] The cbh2-l-3-1 gene was ligated to the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the M13-Pcdna1-CBHⅡ-Tcbh1 recombinant plasmid.

[0071] 3) M13-Pcdna1-CBHⅡ-L-3-2-Tcbh1 recombinant plasmid

[0072] Using the cbh2 gene as a template, the upper fragment of cbh2-l-3-2 was amplified with the downstream primer cbh2-R3 of cbh2-l-3-2 and the upstream primer cbh2-F1 of cbh2; the lower fragment of cbh2-L-3-2 was amplified with the upstream primer cbh2-F3 of cbh2-l-3-2 and the downstream primer cbh2-R1 of cbh2; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-l-3-2.

[0073] The cbh2-l-3-2 gene was ligated to the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the M13-Pcdna1-CBHⅡ-L-3-2-Tcbh1 recombinant plasmid.

[0074] 4) M13-Pcdna1-CBHⅡ-L-10-Tcbh1 recombinant plasmid

[0075] Using cbh2 as a template, the upper fragment of cbh2-l-10 was amplified with the downstream primer cbh2-R6 of mutant cbh2-l-10 and the upstream primer cbh2-F1 of cbh2; the lower fragment of mutant cbh2-l-10 was amplified with the upstream primer cbh2-6 of cbh2-l-10 and the downstream primer cbh2-R1 of cbh2; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of mutant cbh2-l-10.

[0076] The cbh2-l-10 gene was ligated onto the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the recombinant plasmid M13-Pcdna1-CBHⅡ-L-10-Tcbh1.

[0077] 5) Recombinant plasmid M13-Pcdna1-CBHⅡ-L-14-Tcbh1

[0078] Using cbh2 as a template, the upper fragment of cbh2-l-14 was amplified with the downstream primer cbh2-R7 of cbh2-l-14 and the upstream primer cbh2-F1 of cbh2; the lower fragment of cbh2-l-14 was amplified with the upstream primer cbh2-F7 of cbh2-l-14 and the downstream primer cbh2-R1 of cbh2; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-l-14.

[0079] The cbh2-l-14 gene was ligated onto the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the recombinant plasmid M13-Pcdna1-CBHⅡ-L-14-Tcbh1.

[0080] 6) Recombinant plasmid M13-Pcdna1-CBHⅡ-L-17-Tcbh1

[0081] Using cbh2 as a template, the upper fragment of cbh2-l-17 was amplified with the downstream primer cbh2-R9 of cbh2-l-17 and the upstream primer cbh2-F1 of cbh2; the lower fragment of cbh2-l-17 was amplified with the upstream primer cbh2-F9 of cbh2-l-17 and the downstream primer cbh2-R1 of cbh2; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-l-17.

[0082] The cbh2-l-17 gene was ligated to the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the recombinant plasmid M13-Pcdna1-CBHⅡ-L-17-Tcbh1.

[0083] 7) Recombinant plasmid M13-Pcdna1-CBHⅡ-L+2-Tcbh1

[0084] Using cbh2 as a template, the upper fragment of cbh2-l+2 was amplified with the downstream primer cbh2-R10 of cbh2-l+2 and the upstream primer cbh2-F1 of cbh2; the lower fragment of cbh2-l+2 was amplified with the upstream primer cbh2-F10 of cbh2-l+2 and the downstream primer cbh2-R1 of cbh2; then the upper and lower fragments were amplified by overlapping PCR with the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-l+2.

[0085] The cbh2-l+2 gene was ligated to the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the recombinant plasmid M13-Pcdna1-CBHⅡ-L+2-Tcbh1.

[0086] 8) M13-Pcdna1-CBHⅡ-L R=N -Tcbh1 recombinant plasmid

[0087] Using cbh2 as a template, the target fragment was amplified with the upstream and downstream primers cbh2-F12 and cbh2-R12 of cbh2-l R=N After eliminating the template, the cbh2-l R=N gene fragment was purified.

[0088] The cbh2-l R=N gene was ligated to the digested M13-Pcdna1-Tcbh1 vector by homologous recombination to construct the recombinant plasmid M13-Pcdna1-CBHⅡ-L R=N -Tcbh1.

[0089] Subsequently, the size of the recombinant plasmid was detected by electrophoresis, and the results were as Figure 2 shown. The size of the recombinant plasmid was consistent with the expectation.

[0090] 4. Preparation, transformation and screening of E. coli competent cells

[0091] Mix 10 µL of the constructed recombinant plasmid with 100 µL of Escherichia coli competent cells and place on ice for 30 min; heat shock at 42 °C for 45 s; add 500 µL of L to the mixture and culture at 37 °C and 150 rpm for 1 h; then centrifuge at 6000 rpm for 8 min, remove most of the supernatant, and only retain about 100 µL; resuspend the precipitate and evenly coat it on the LB (Amp) solid medium. After the bacterial liquid on the plate is slightly dry, invert it and culture it overnight in a 37 °C incubator. Observe the single colonies on the plate 12 h after the transformation is completed. Pick several single colonies into 20 µL of sterile water, mix well, and take 10 µL as a template for PCR reaction to screen for positive clones.

[0092] The PCR amplification system is as follows: Plasmid 10 μL, Forward primer (10 μM) 1 μL, Reverse primer (10 μM) 1 μL, dNTP Mixture 1 μL, ddH2O 12 μL.

[0093] The PCR reaction conditions are: 95 °C for 4 min; 95 °C for 20 s, 55 °C for 20 s, 72 °C for 2 min, 30 cycles; 75 °C for 5 min; 16 °C ∞.

[0094] After the reaction is completed, detect the reaction result by agarose gel electrophoresis, select the bacterial liquid with the correct size of the detected fragment for liquid culture, and then extract the plasmid. After the plasmid extraction is completed, perform double digestion with Xho1 / Kpn1 to verify the size, and send the plasmid with the correct digestion result to Shanghai Sangon for sequencing.

[0095] 5. Preparation and transformation of Trichoderma reesei protoplasts

[0096] Inoculate T. reesei QM9414 into the seed flask culture medium and culture at 28 °C for 6 days until green spores grow. Use the method of cotton core filtration to collect fungal spores and take 10 6 to 10 8Spores were spread on a PDA plate containing cellophane and cultured at 28 °C for 20 h. The cellophane with germinated spore hyphae was peeled off and transferred to 20 mL of a lysis solution containing 30 mg / mL pectinase and 4 mg / mL snailase (containing 0.6 M ammonium sulfate solution and 50 mM maleic acid, adjusted to pH 5.0, sterilized by filtration through a sterile membrane filter, and placed in a 50 mL centrifuge tube). Incubate in a water bath shaker at 30 °C and 80 rpm for 3 h. Filter the lysis solution through four layers of lens paper, collect the protoplast suspension in a centrifuge tube, centrifuge at 8000 rpm for 5 min, and collect the protoplasts in a 2 mL centrifuge tube. Add 2 mL of Solution B (containing 0.375 g of CaCl2 and 18.22 g of sorbitol per 100 ml, adjusted to pH 7.5, sterilized by filtration through a sterile membrane filter), gently pipette to mix evenly, centrifuge at 3000 rpm for 4 min, and repeat twice. Resuspend with an appropriate amount of Solution B, and microscopically examine to make the concentration 1×10 7-8 cells / mL, and place on ice for later use.

[0097] Add 10 μg of plasmid to 100 μL of the prepared protoplasts, incubate on ice for 20 min. Add 2 mL of regeneration medium, gently mix, and let stand at room temperature for 2 min. Add 4 mL of regeneration medium and 200 μg / mL of cefotaxime sodium, and incubate at 28 °C for 20 h. Centrifuge at 8000 rpm for 5 min and discard the supernatant. Repeat the previous step until obvious precipitates can be seen. Take 200 μL of the suspension and spread it on a PDA screening plate containing 50 μg / mL of hygromycin B, and culture at 28 °C for 3 - 5 d. Pick a single transformant and transfer it to a PDA screening plate containing 50 μg / mL of hygromycin B. After the screening plate grows, transfer it to a PDA plate without resistance and culture for 4 - 5 d until green spores grow for screening.

[0098] 6. Screening of mutant strains

[0099] Scrape the mycelium of the correct transformant and inoculate it into 50 mL of Mandels seed medium, culture at 28 °C and 200 rpm for 48 h, transfer the bacterial liquid to 50 mL of Mandels fermentation medium, and culture at 28 °C and 200 rpm for 4 - 5 d. After fermentation, collect the crude enzyme solution through centrifugation and suction filtration steps. Screen the transformants with high expression levels, and name the mutant strains obtained after screening as: QM9414 - CBHⅡ, QM9414 - CBHⅡ - L - 3 - 1, QM9414 - CBHⅡ - L - 3 - 2, QM9414 - CBHⅡ - L - 10, QM9414 - CBHⅡ - L - 14, QM9414 - CBHⅡ - L - 17, QM9414 - CBHⅡ - L+2, QM9414 - CBHⅡ - L R=N .

[0100] Example 2

[0101] 1. Purification of Recombinase

[0102] The recombinant protein was purified by Ni-NTA affinity column respectively. The specific steps are as follows:

[0103] Filter the crude enzyme solution by vacuum filtration; pass all the crude enzyme solution through the nickel column; wash the nickel column with 4 times the volume of the gel with Wash buffer to remove the impurity proteins; add 0.5 mL of Elution buffer each time and collect the effluent in separate tubes; collect the purified enzyme solution, put it into a dialysis bag, and dialyze it in PBS with a pH of 7.5 at 4 °C for 24 h (change the dialysis solution every 8 h), take out the enzyme solution after 24 h and store it at 0 °C. The purified protein was detected by SDS-PAGE for the purification results of CBHⅡ and its mutants.

[0104] The results are as Figure 3 shown. All proteins were purified well in the SDS-PAGE protein map. Due to glycosylation, the size of the target band was larger than the theoretical value.

[0105] 2. Enzymatic Properties of CBHⅡ and Its Mutants

[0106] The kinetic constants were determined using 80% phosphoric acid-swollen cellulose as the substrate. 80% phosphoric acid-swollen cellulose with concentrations of 0.4, 1.2, 1.6, 2, 2.4, 3, 4, 5, and 6 mg / mL were prepared respectively. At the optimal temperature and pH, the specific enzyme activity of the enzyme against different concentrations of substrates was measured respectively, and the inactivated enzyme was used as a blank control. The values of V max and K m were calculated using GraphPad Prism 7.0 software according to the method of nonlinear regression.

[0107] The results are shown in Table 3. The V max of CBHⅡ was 100.23 U / mg, and the K m value was 0.98 mg / mL. Among the mutants, the V R=N of CBHⅡ-L-14, CBHⅡ-L-17, and CBHⅡ-L max were 161.40 U / mg, 123.00 U / mg, and 123.85 U / mg respectively, which were increased by 61%, 23%, and 28% compared with the wild type; the maximum reaction rates of CBHⅡ-L-3-1, CBHⅡ-L-3-2, CBHⅡ-L-10, and CBHⅡ-L+2 were not significantly different from those of the wild type. The results showed that a small amount of amino acid deletion and addition to the linker peptide had little effect on the maximum reaction rate, but when the linker peptide was deleted to 14 amino acids, the maximum reaction rate increased significantly.

[0108] Table 3 Kinetic constants of CBHⅠ and its mutants

[0109]

[0110] Example 3

[0111] 1. Determination of specific enzyme activity using 1% - 80% phosphoric acid swollen cellulose as substrate

[0112] The activity detection system for 80% phosphoric acid swollen cellulose is as follows: 400 μL of 80% phosphoric acid swollen cellulose, 1 μM of enzyme, and made up to 1 mL with pH 5.5 50 mM sodium acetate buffer solution.

[0113] React at 65 °C for 1 h, and immediately react at 99 °C for 10 min to inactivate the enzyme after the reaction. After the reaction, centrifuge at 10000 rpm for 10 min, take 200 μL of the supernatant into a clean EP tube, add 200 μL of DNS solution, boil at 99 °C for 5 min, and immediately place it in ice water for cooling. Determine the content of reducing sugar by the absorbance value at OD 540 . One unit of enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol of reducing sugar per hour under the above reaction conditions. The calculation formula for enzyme activity is as follows:

[0114] .

[0115] .

[0116] X is the content of reducing sugar calculated according to the reducing sugar calibration curve (g / mL); the standard curve of reducing sugar is y = 0.0028x + 0.0082, where y is the reading at OD 540 ; n is the dilution factor of the enzyme solution; V is the final volume of the enzyme reaction system (mL); M is the molar mass of cellobiose (342.3 g / mol); C is the addition amount of the enzyme solution (mL); T is the enzyme reaction time (h).

[0117] The results are shown in Table 4. The specific enzyme activity of CBHⅡ is 83.42 U / mg, and the specific enzyme activities of CBHⅡ-L-14, CBHⅡ-L R=N and CBHⅡ-L-17 are 136.01 U / mg, 105.56 U / mg, and 101.77 U / mg, which are 1.63 times, 1.22 times, and 1.27 times that of the wild type; the specific enzyme activities of the other five mutants are not significantly different from that of the wild type when using 80% phosphoric acid swollen cellulose as the substrate.

[0118] Table 4 Specific enzyme activities of CBHⅠ and its mutants towards 80% phosphoric acid swollen cellulose

[0119]

[0120] 2. Determination of specific enzyme activity using microcrystalline cellulose (Avicel) as the substrate

[0121] Take 400 µL of 1% microcrystalline cellulose in a 2 mL centrifuge tube (final concentration 4 mg / mL), add 3 µM of pure enzyme, and make up to 1 mL with pH 5 50 mM sodium acetate buffer. React with shaking at 50 °C and 1000 rpm for 12 h, and determine its specific enzyme activity.

[0122] The results are shown in Table 5. The specific enzyme activity of CBHⅡ is 0.302 U / mg, and those of CBHⅡ-L-14 and CBHⅡ-L-17 are 0.445 U / mg and 0.402 U / mg, which are 1.47 and 1.33 times that of the wild type; the specific enzyme activities of CBHⅡ-L-3-2, CBHⅡ-L-10, and CBHⅡ-LR=N are slightly increased compared to the wild type, being 1.26, 1.18, and 1.11 times that of the wild type respectively; the change in the specific enzyme activity of CBHⅡ-L-3-1 is not significant compared to the wild type; the specific enzyme activity of CBHⅡ-L+2 is only 0.81 times that of the wild type.

[0123] Table 5 Specific enzyme activities of CBHⅠ and its mutants towards microcrystalline cellulose

[0124]

[0125] 3. Determination of specific enzyme activity using filter paper (FP) as the substrate

[0126] Cut the filter paper (Whatman No. 1) into 1×3.5 strips, divide them into 8 equal small parts (30 mg), place them in a centrifuge tube, add 3 µM of pure enzyme, and make up to 1 mL with pH 5 50 mM sodium acetate buffer. React with shaking at 50 °C and 1000 rpm for 12 h, and determine its specific enzyme activity.

[0127] The results are shown in Table 6. The specific enzyme activity of CBHⅡ is 0.793 U / mg, and those of CBHⅡ-L-14 and CBHⅡ-L-17 are 1.053 U / mg and 1.052 U / mg, both being 1.33 times that of the wild type; the specific enzyme activities of CBHⅡ-L-3-2 and CBHⅡ-L R=N are 1.21 and 1.12 times that of the wild type respectively; the change in the specific enzyme activity of CBHⅡ-L-10 is not significant compared to the wild type; the specific enzyme activities of CBHⅡ-L-3-1 and CBHⅡ-L+2 are decreased to a certain extent compared to the wild type, being 0.91 and 0.79 times that of the wild type respectively.

[0128] Table 6 Specific enzyme activities of CBHII and its mutants towards filter paper

[0129]

[0130] 4. Comparison of specific enzyme activities of three substrates

[0131] The results are as Figure 4 shown. The ranking of specific enzyme activities of 80% phosphoric acid-swollen cellulose is: CBHII-L-14 > CBHⅡ-L R=N > CBHⅡ-L-17 > CBHⅡ-L-3-2 > CBHⅡ-3-1 = CBHⅡ = CBHⅡ-L-10 > CBHⅡ-L+2; The ranking of specific enzyme activities of Avicel is: CBHII-L-14 > CBHⅡ-L-17 > CBHⅡ-L-3-2 > CBHⅡ-L-10 > CBHⅡ-L R=N > CBHⅡ-3-1 = CBHⅡ > CBHⅡ-L+2; The ranking of specific enzyme activities of FP is: CBHII-L-14 = CBHⅡ-L-17 > CBHⅡ-L-3-2 > CBHⅡ-L R=N > CBHⅡ-L-10 = CBHⅡ > CBHⅡ-3-1 > CBHⅡ-L+2. When 80% phosphoric acid-swollen cellulose, microcrystalline cellulose and filter paper are used as substrates, the specific enzyme activities of the four mutants CBHII-L-14, CBHⅡ-LR=N, CBHⅡ-L-17, and CBHⅡ-L-3-2 in the three substrates are all higher than those of the wild type. Among them, the specific enzyme activity of CBHⅡ-L-14 is the highest, which is 1.63, 1.47, and 1.33 times that of the wild type respectively; The specific enzyme activity of CBHⅡ-L-10 has almost no difference from that of CBHII when using 80% phosphoric acid-swollen cellulose as the substrate, but is slightly higher than that of the wild type when using filter paper as the substrate, and the specific enzyme activity is 1.18 times that of the wild type when using microcrystalline cellulose as the substrate; The specific enzyme activity of CBHⅡ-3-1 is slightly higher than that of the wild type when using 80% phosphoric acid-swollen cellulose and microcrystalline cellulose as substrates, but slightly lower than that of the wild type when using filter paper as the substrate; The specific enzyme activity of CBHⅡ-L+2 has little difference from that of the wild type under 80% phosphoric acid-swollen cellulose, but the specific enzyme activities are 0.79 and 0.81 times that of the wild type when using microcrystalline cellulose and filter paper as substrates respectively.

[0132] Example 4

[0133] 1. Determination of enzymatic hydrolysis efficiency using microcrystalline cellulose (Avicel) as the substrate

[0134] Take 400 μL of 1% microcrystalline cellulose in a 2 mL centrifuge tube, with a final concentration of 4 mg / mL, 3 μM of pure enzyme, and make up to 1 mL with 50 mM sodium acetate buffer at pH 5. React with shaking at 50 °C and 1000 rpm for 12 h, 24 h, 48 h, and 72 h respectively (tetracycline with a final concentration of 80 μg / mL is added to the system). After inactivating the reaction by heating at 99 °C for 10 min, centrifuge and take the supernatant to detect the amount of reducing sugar.

[0135] The results are asFigure 5 As shown, the enzymatic hydrolysis rate is very fast in the first 8 h. Among them, the initial rates of CBHⅡ-L-14, CBHⅡ-L-17, and CBHⅡ-L-3-2 are significantly higher than that of the wild type. The enzymatic hydrolysis rate slows down from 8 h to 12 h, but the rate of CBHⅡ-L+2 and CBHⅡ-L R=N is more significantly slower than the other six enzymes. The rate from 12 h to 24 h has a certain increase compared with that from 8 h to 12 h, and the enzymatic activities of the two mutants CBHⅡ-L-14 and CBHⅡ-L-17 are significantly higher than the other six enzymes during this period. From 24 h to 48 h, except for the three mutants CBHⅡ-L-14, CBHⅡ-L-3-2, and CBHⅡ-L R=N most enzymes produce very little reducing sugar during this period. As the reaction time continues to extend, the enzymatic hydrolysis rate from 48 h to 72 h starts to increase again. During the whole enzymatic hydrolysis process, the amounts of reducing sugar produced by CBHⅡ-L-14, CBHⅡ-L-17, CBHⅡ-L R=N , CBHⅡ-L-3-2, and CBHⅡ-L-10 are significantly more than that of the wild type, while the trend of CBHⅡ-3-1 is almost the same as that of the wild type during this enzymatic hydrolysis process; the enzymatic hydrolysis rate of CBHⅡ-L+2 is lower than that of the wild type from the beginning, and the final reducing sugar yield is also significantly less than that of the wild type.

[0136] 2. Determination of enzymatic hydrolysis efficiency using filter paper (FP) as the substrate

[0137] Cut the filter paper (Whatman No. 1) into strips of 1×3.5, add 3 μM of pure enzyme, make up to 1 mL with 50 mM sodium acetate buffer at pH 5. Shake and react at 50 °C and 1000 rpm for 12 h, 24 h, 48 h, and 72 h respectively (tetracycline with a final concentration of 80 μg / mL is added to the system). After inactivating the reaction by heating at 99 °C for 10 min, centrifuge and take the supernatant to detect the amount of reducing sugar.

[0138] The results are as Figure 6 shown. The enzymatic hydrolysis rate in the first 8 h is significantly higher than that on the microcrystalline cellulose substrate. Among them, the initial rates of CBHⅡ-L-14, CBHⅡ-L-17, and CBHⅡ-L-3-2 are significantly higher than that of the wild type. The enzymatic hydrolysis rate slows down from 8 h to 12 h, and the rate from 12 h to 24 h has a certain increase compared with that from 8 h to 12 h. The enzymatic activities of the four mutants CBHⅡ-L-14, CBHⅡ-L-17, CBHⅡ-L-3-2, and CBHⅡ-L R=N are significantly higher than that of the wild type during this period. The rate slows down during the period from 24 h to 48 h, but the enzymatic activities of CBHⅡ-L-14, CBHⅡ-L-17, CBHⅡ-L-3-2, and CBHⅡ-L R=NCompared with the wild type, the trends of the four mutants are consistent with those in the previous time period. As the reaction time continues to extend, the enzymatic hydrolysis rate from 48 h to 72 h increases to a certain extent compared with that from 24 h to 48 h. During the whole enzymatic hydrolysis process, the amount of reducing sugar produced by CBHⅡ-L-14, CBHⅡ-L-17, CBHⅡ-L-3-2 and CBHⅡ-L R=N is significantly more than that of the wild type, while the enzymatic hydrolysis rate of CBHⅡ-3-1 and CBHⅡ-L+2 is lower than that of the wild type from the very beginning, and the final yield of reducing sugar is also significantly less than that of the wild type.

[0139] Example 5

[0140] 1. Adsorption of CBHII and its mutants on 80% phosphoric acid swollen cellulose

[0141] Using 4 mg / mL 80% phosphoric acid swollen cellulose as the substrate to explore the adsorption of enzyme variants and wild type. React at 4 °C and 150 rpm / min for 0, 15 min, 30 min, 45 min, 60 min to explore the time of adsorption stabilization period. It is determined that the adsorption stabilization period is 30 min.

[0142] Take 0 - 40 µmoL of each of the eight mutants, add 2 mg (final concentration of 4 mg / mL) of 80% phosphoric acid swollen cellulose, supplement the system to 500 mL with pH 5 50 mM sodium acetate buffer, react at 4 °C and 150 rpm / min for 1 h, then centrifuge and take the supernatant, A 280 Measure the free protein concentration in the supernatant, and use the equation to determine B Max (µMol / g) and K d (µM) values. The formula is as follows:

[0143] .

[0144] Y—Amount of bound enzyme; X—Amount of free enzyme; B Max —Maximum binding capacity; K d —Adsorption dissociation constant.

[0145] The results are shown in Table 7. By comparing the binding ability of the enzyme to the cellulose substrate (B Max ) and the affinity of the enzyme to the cellulose substrate (K d ), the conclusion is drawn that: CBHⅡ-L-3-1 has the best affinity for the cellulose substrate, but its binding ability is the weakest; compared with the wild type, after reducing 3 amino acids, the affinity of CBHⅡ-L-3-2 for the cellulose substrate changes little, but its binding ability decreases slightly; CBHⅡ-L-10 and CBHⅡ-L R=NAll showed about 20% higher binding ability to cellulose substrates than the wild type, but the affinity for cellulose substrates decreased by 15% and 19% respectively; the affinity for cellulose substrates of CBHⅡ-L-14 and CBHⅡ-L-17 was 27% and 28% higher than that of the wild type respectively, and it was found that the binding ability of these two enzymes to cellulose substrates decreased by about 20% compared with the wild type; the affinity of CBHⅡ-L+2 for cellulose substrates decreased slightly compared with the wild type, and the binding ability to cellulose substrates also decreased by 13%.

[0146] Table 7 Affinity of CBHII and its mutants for 80% phosphoric acid-swollen cellulose

[0147]

[0148] 2. Adsorption of CBHII and its mutants on microcrystalline cellulose

[0149] The adsorption system and conditions were the same as above, and the substrate was changed to 4 mg / mL microcrystalline cellulose.

[0150] The results are shown in Table 8. By comparing the binding ability of the enzyme to cellulose substrates (B Max ) and the affinity of the enzyme for cellulose substrates (K d ), the conclusion was drawn that the adsorption of CBHⅡ-L-3-1 on microcrystalline cellulose substrates was similar to that on 80% phosphoric acid-swollen cellulose substrates, with the best affinity for cellulose substrates and the weakest binding ability to cellulose substrates among the eight enzymes; the binding ability of CBHⅡ-L-10 to cellulose substrates was twice that of the wild type, and the affinity for cellulose substrates was slightly weaker than that of the wild type; CBHⅡ-L-3-2 and CBHⅡ-L+2 showed similar affinity for cellulose substrates to the wild type, and the binding ability to cellulose substrates was 62% and 50% higher than that of the wild type respectively; the affinity of CBHⅡ-L-14 for cellulose substrates increased significantly compared with the wild type, and the binding ability to cellulose substrates also decreased much compared with the wild type; similarly, the affinity for cellulose substrates of CBHⅡ-L-17 and CBHⅡ-L R=N was also higher than that of the wild type, and the binding ability of these two enzymes to cellulose substrates also increased to a certain extent compared with the wild type.

[0151] Table 8 Affinity of CBHII and its mutants for microcrystalline cellulose

[0152]

[0153] 3. Adsorption of CBHII and its mutants on corncob enzymatic lignin

[0154] The adsorption system and conditions were the same as above, and the substrate was changed to 4 mg / mL corncob enzymatic lignin.

[0155] The results are shown in Table 9. By comparing the binding ability of the enzyme to the cellulose substrate (B Max ) and the affinity of the enzyme for the cellulose substrate (K d ), the conclusion is drawn that CBHⅡ-L+2 has the strongest affinity for the lignin substrate, the affinity of CBHⅡ-L-3-1 for the lignin substrate is slightly higher than that of the wild type, and the affinities of CBHⅡ-L-3-2, CBHⅡ-L-10, CBHⅡ-L-14, CBHⅡ-L-17 and CBHⅡ-LR=N mutants for the lignin substrate are all lower than that of the wild type. Among them, CBHⅡ-L-10 has the weakest affinity for the lignin substrate. CBHⅡ-L-3-1 has the greatest increase in the binding ability to the lignin substrate compared to the wild type, and the binding abilities of CBHⅡ-L-3-2, CBHⅡ-L+2 and CBHⅡ-L R=N to the lignin substrate are slightly higher than those of the wild type. The binding abilities of CBHⅡ-L-10, CBHⅡ-L-14 and CBHⅡ-L-17 to the lignin substrate are all decreased compared to the wild type. Among them, CBHⅡ-L-17 has the most obvious decrease, only 75% of the wild type.

[0156] Table 9 Affinity of CBHII and its mutants for lignin

[0157]

[0158] Example 6

[0159] 1. Effect of lignin on the activity and enzymatic hydrolysis efficiency of CBHII and its mutants

[0160] Referring to the specific activity detection method of Example 4, 4 mg of corncob enzymatically hydrolyzed lignin was added to the specific activity determination systems of microcrystalline cellulose and filter paper as two substrates, and the other conditions remained unchanged. The reaction without lignin was used as a control, and the inactivated enzyme was used as a blank to explore the effect of lignin addition on the activities of the eight mutants.

[0161] Referring to the enzymatic hydrolysis efficiency detection method of Example 4, by the method of continuously measuring the enzymatic hydrolysis time curve on microcrystalline cellulose and filter paper, 4 mg of corncob enzymatically hydrolyzed lignin was added to the specific activity determination systems of microcrystalline cellulose and filter paper as two substrates, and the other conditions remained unchanged. The reaction without lignin was used as a control, and the inactivated enzyme was used as a blank to explore the effect of lignin addition on the enzymatic hydrolysis efficiency of the eight mutants.

[0162] ① Microcrystalline cellulose

[0163] The results are shown in Table 10. After adding lignin, a part of the enzymes are adsorbed ineffectively by lignin, resulting in a certain decrease in the enzyme activities of eight enzymes towards microcrystalline cellulose. The specific enzyme activity of CBHⅡ in the microcrystalline cellulose substrate is 0.302 U / mg, and after adding lignin, the specific enzyme activity becomes 0.215 U / mg, which is 71% of that without lignin. After adding lignin to the enzymatic hydrolysis system, CBHⅡ-L-17 and CBHⅡ-L-14 can maintain relatively high activities, being 89% and 85% of that without lignin respectively, and their tolerance to lignin is significantly higher than that of wild-type CBHII. While CBHⅡ-L+2 is 53% of that without lignin, indicating that its lignin tolerance is significantly lower than that of wild-type CBHII.

[0164] Table 10 Specific Enzyme Activities of CBHII and Its Mutants towards Microcrystalline Cellulose after Adding Lignin

[0165]

[0166] To further verify the effect of the change in the linker peptide on the enzymatic hydrolysis efficiency, the eight enzymes were respectively subjected to enzymatic hydrolysis on microcrystalline cellulose with added lignin for 72 hours, and the reducing sugar release was measured.

[0167] The results are as Figure 7 shown. The enzymatic hydrolysis efficiencies of CBHII and the mutants are all inhibited by lignin. Among them, CBHⅡ-L-3-1, CBHⅡ-L-3-2 and CBHⅡ-L+2 are more severely affected by lignin, and the amount of reducing sugar is significantly less than that without lignin, and the degree of inhibition by lignin on them is more severe than that on wild-type CBHII; while the degree of inhibition of lignin on CBHⅡ-L-10, CBHⅡ-L-14, CBHⅡ-L-17 and CBHⅡ-LR=N is lower than that on wild-type CBHII, and their tolerance to lignin is higher than that of wild-type CBHII.

[0168] ② Filter paper

[0169] The results are shown in Table 11. The specific enzyme activity of CBHⅡ in the microcrystalline cellulose substrate is 0.793 U / mg, but after adding lignin, the specific enzyme activity becomes 0.553 U / mg, which is 70% of that without lignin. After adding lignin to the enzymatic hydrolysis system, CBHⅡ-L-14 and CBHⅡ-L-17 maintain relatively high activities, being 85% and 82% of that without lignin respectively, and their tolerance to lignin is significantly higher than that of wild-type CBHII. While CBHⅡ-L+2 is only 61% of that without lignin, indicating that its lignin tolerance is significantly lower than that of wild-type CBHII.

[0170] Table 11 Specific Enzyme Activities of CBHII and Its Mutants towards Filter Paper after Adding Lignin

[0171]

[0172] To further verify the effect of the change in the linker peptide on the enzymatic hydrolysis efficiency, eight enzymes were respectively used for enzymatic hydrolysis of filter paper added with lignin for 72 hours, and the amount of reducing sugar released was measured.

[0173] The results are as Figure 8 shown. The enzymatic hydrolysis efficiencies of CBHII and the mutants were both inhibited by lignin. However, CBHⅡ-L-3-2 and CBHⅡ-L+2 were more severely affected by lignin, and the amount of reducing sugar was significantly reduced compared with that without lignin, and the degree of inhibition by lignin was more severe than that of the wild-type CBHII. The degree of inhibition of lignin on CBHⅡ-L-3-1, CBHⅡ-L-10, CBHⅡ-L-14, CBHⅡ-L-17, and CBHⅡ-LR=N was lower than that of the wild-type CBHII, and the tolerance to lignin was higher than that of the wild-type CBHII.

[0174] Example 7

[0175] 1. CBHⅡ and mutants in synergistic enzymatic hydrolysis with EGⅠ / β-cellulose

[0176] The synergistic reaction system of CBHⅡ and EGⅠ / β-cellulose was as follows: 30 mg of filter paper, 0.025 U of β-glucosidase, 50 μg of CBHⅡ, 25 μg of EGⅠ, 80 μg / mL of tetracycline, and 50 mM sodium acetate buffer (pH 5.0) were made up to 1 mL. The reaction was carried out at 50 °C and 1000 rpm for 24 h and 48 h, and the reaction was terminated by inactivating at 99 °C for 10 min. After centrifuging at 10000 rpm for 10 min, the supernatant was taken, and the amount of reducing sugar in the centrifuged supernatant was detected respectively. After centrifuging at 8000 g for 10 min, the supernatant was taken, and the total reducing sugar content was determined by the Somogyi-Nelson method as above. At the same time, partial enzymatic hydrolysis products TCL were analyzed. The synergistic enzymatic hydrolysis curve was plotted with time as the abscissa and the amount of reducing sugar as the ordinate. To determine the kinetics of the synergistic enzymatic hydrolysis process, according to the above reaction system and product determination method, the synergistic enzymatic hydrolysis was carried out for 4 h, 8 h, 12 h, 24 h, 48 h, and 72 h respectively, and the synergistic enzymatic hydrolysis curve was plotted with time as the abscissa and the amount of reducing sugar released as the ordinate.

[0177] The results are as Figure 9As shown, after 48 h of co-enzymatic hydrolysis, the amount of reducing sugar produced by EGⅠ and β-cellulose alone was only 436 mg / mL, and the amount of reducing sugar produced by CBHⅡ and β-cellulose in co-hydrolyzing filter paper was 514 mg / mL. However, after co-enzymatic hydrolysis, the amount of reducing sugar produced could reach 2271 mg / mL, showing an obvious synergistic effect. After co-enzymatic hydrolysis, the amounts of reducing sugar produced by CBHII-L-14, CBHII-L-17, CBHⅡ-L-3-2, CBHII-LR-N, CBHⅡ-L-10, and CBHⅡ-3-1 were all higher than that of the wild type, being 1.30 times, 1.25 times, 1.17 times, 1.13 times, 1.12 times, and 1.06 times that of CBHⅡ, respectively; while the amount of reducing sugar produced by CBHⅡ-L+2 after co-enzymatic hydrolysis was slightly less than that of the wild type, being 0.93 times that of CBHⅡ.

[0178] 2. Co-enzymatic Hydrolysis Time Curves of CBHⅡ and Mutants with EGⅠ / β-cellulose

[0179] The results are as Figure 10 shown. In the first 4 h of the reaction process, the co-enzymatic hydrolysis rates of the eight enzymes were all very fast. There were slight differences in the rates of different mutants from 4 h to 12 h. However, during the enzymatic hydrolysis process from 4 h to the end of the 72 h reaction, CBHII-L-14 produced the most reducing sugar, and the amounts of reducing sugar produced by CBHⅡ-L-17, CBHⅡ-L-3-2, CBHⅡ-L R=N and CBHⅡ-L-10 were also more than that of the wild type CBHⅡ; the co-enzymatic hydrolysis curve of CBHⅡ-L-3-1 was similar to that of the wild type CBHⅡ, and the amounts of reducing sugar produced were also similar; while the amount of reducing sugar produced by CBHⅡ-L+2 was somewhat reduced compared to the wild type CBHⅡ.

[0180] Example 8

[0181] 1. Effect of Lignin on Co-enzymatic Hydrolysis of CBHⅡ and Mutants with EGⅠ / β-cellulose

[0182] The results are as Figure 11As shown, taking the amount of reducing sugar produced without adding lignin during synergy as a comparison, CBHⅡ can produce 2727 mg / mL of reducing sugar after 48 h of synergistic enzymatic hydrolysis. However, after adding 4 mg of lignin to the reaction system, the reducing sugar yield after 48 h of reaction is only 1068 mg / mL, which is reduced to 39% of that without adding lignin. After adding lignin during the synergistic reaction of the eight enzymes, the reducing sugar yield has decreased significantly. The reducing sugar yield of CBHⅡ-L-14 has decreased the least, being 45% of that without adding lignin; while the reducing sugar yield of CBHⅡ-L+2 has decreased the most, being 38% of that without adding lignin. Generally speaking, the reduction ranges of the reducing sugar yields of CBHⅡ-L-14, CBHⅡ-L-17, CBHⅡ-L-3-2, CBHⅡ-LR=N, and CBHⅡ-L-10 are lower than that of wild-type CBHII, indicating that their tolerance to lignin is higher than that of wild-type CBHII. When there is lignin, the amounts of reducing sugar produced are 1.49 times, 1.35 times, 1.31 times, 1.16 times, and 1.12 times that of wild-type CBHII, respectively.

[0183] 2. Time curve of CBHⅡ and mutants synergistically enzymatically hydrolyzing filter paper added with lignin with EGⅠ

[0184] The results are as Figure 12 shown. The synergistic enzymatic hydrolysis rates of the eight enzymes are very fast in the first 4 h of the reaction process. Among them, the reducing sugar yields of CBHII-L-14 and CBHⅡ-L-17 in the first 4 h are significantly more than that of the wild-type, while the reducing sugar yields of CBHⅡ-3-1 and CBHⅡ-L+2 in the first 4 h are similar; the growth rates of the enzymatic hydrolysis yields of the eight enzymes start to slow down from 4 h to 8 h, the reaction process becomes gentle from 12 h to 24 h, and except for CBHII-L-14, the reducing sugar yields of the other seven mutants hardly increase from 24 h to 48 h. The trend from 48 h to 72 h is the same as that in the previous 24 h and becomes gentle.

[0185] From the entire enzymatic hydrolysis time curve, it can be seen that the reducing sugar yield is CBHII-L-14 > CBHⅡ-L-17 > CBHⅡ-L-3-2 > CBHⅡ-L R=N > CBHⅡ-L-10 > CBHⅡ-3-1 > CBHⅡ > CBHⅡ-L+2. Comparing the time curve graph further shows that except for the mutant CBHⅡ-L+2, the enzymatic hydrolysis abilities of the other six mutants in the presence of lignin are higher than that of wild-type CBHⅡ.

[0186] The above is only illustrative of the present invention and not restrictive. Those of ordinary skill in the art understand that many modifications, variations, or equivalents can be made without departing from the spirit and scope defined by the appended claims, but all will fall within the protection scope of the present invention.

Claims

1. A CBHII protein mutant, characterized in that: Only the connecting peptide of CBHI was modified to obtain CBHI protein mutants, whose names and corresponding amino acid sequences of the modified connecting peptides are as follows: CBHⅡ-L-3-1:ASSSSSTRAASTTSRVSPTSSSATPPPGSTTTRVPPVG, CBHⅡ-L-3-2: ASSSSSTRAASTTSRVSPTTSRATPPPGSTTTRVPPVG, CBHⅡ-L-10:ASSSSSTRAASTTSRVTPPPGSTTTRVPPVG, CBHⅡ-L-14:ASSSSSTRAASTTPPPGSTTTRVPPVG, CBHⅡ-L-17:ASSSSSTRATPPPGSTTTRVPPVG, CBHⅡ-L+2:ASSSSSTRAASTTSRVSPTTSRSSSATRSPPPGSTTTRVPPVG, CBHⅡ-L R=N :ASSSSSTRAASTTSNVSPTTSRSSSATPPPGSTTTRVPPVG。 2. The method for preparing the CBHII protein mutant according to claim 1, characterized in that: The connecting peptide of CBHII protein was modified by: truncating TSR in ASSSSSTRAASTTSRV in the connecting peptide, truncating SSS in VSPTTSRSSSAT in the connecting peptide, truncating SPTTSRSSSA or SRVSPTTSRSSSAT or ASTTSRVSPTTSRSSSA in the connecting peptide, or inserting RS after the connecting peptide ASSSSSTRAASTTSRVSPTTSRSSSAT, or replacing R in the connecting peptide TTSRVSPT with N.

3. The method for preparing a CBHII protein mutant according to claim 2, characterized in that: Here are the steps: 1) Extraction of Trichoderma reesei QM9414 genomic DNA and amplification of target genes; 2) Construction of constitutive promoter expression vector; 3) Construction of recombinant plasmid; 4) E. coli transformation and screening; 5) Transformation, screening and expression of Trichoderma reesei.

4. The method for preparing a CBHII protein mutant according to claim 3, characterized in that: The promoter used is promoter cdna1; the constitutive promoter expression vector is M13-Pcdna1-Tcbh1.

5. The method for preparing a CBHII protein mutant according to claim 3, characterized in that: The primer sequences (5'-3') used are as follows: cbh2-F1: atcaatccaacaacttctctcATGATTGTCGGCATTCTCAC, CBH2-R1: CTTTCGCACGGAGCTctcgagTTAGTGGTGGTGATGATGATGCAGGAACGATGGGTTTGCGTT; cbh2-F2: TCGAGTATCCCCCACATCGAGCTCCGCGACGCCTCCACCTGGTT, CBH2-R2: AGGCGTCGCGGAGCTCGATGTGGGGGATACTCGAGAA; cbh2-F3: CCACAACATCCCGGGCGACGCCTCCCACCTGGTTCT, CBH2-R3: TAGAACCAGGTGGAGGCGTCGCCCGGGATGTTGTTGGGGGATA, cbh2-F6: acgacttctcgagtaacgcctccacctggttctact, CBH2-R6: AGTAGAACCAGGTGGAGGCGTTACTCGAGAAGTCGT; cbh2-F7: acgcgcgccgcgtcgacgacgcctccacctggttctactacta, CBH2-R7: TAGTAGTAGAACCAGGTGGAGGCGTCGTCGACGCGGCGCGCGT; cbh2-F9: TCAAGCTCGTCCACGCGCGCCACGCCTCCACCTGGTTCTACTACTA, cbh2-R9: TAGTAGAACCAGGTGGAGGCGTGGCGCGCGTGGACGAGCTTGA; cbh2-F10: tcgagctccgcgacgcgatctcctccacctggttctactactacc, CBH2-R10: tagaaccaggtggaggagatcgcgtcgcggagctcgaccgggat; cbh2-F12: gccgcgtcgacgacttctaaCgtatcccccacaac, CBH2-R12: gttgtgggggatacGttagaagtcgtcgacgcggc; cdna1-F1: CACTAAAGGGAACAAAAGCTGGGTACCCAGACAATGATGGTAGCAGC, Cdna1-R1: TCAGGCTTTCGCACGGAGCTCTCGAGGAGAGAAGTTGTTGGATTGAT.

6. The method for preparing a CBHII protein mutant according to claim 3, characterized in that: The amplification of each mutant gene is as follows: Using cbh2 gene as template, using the downstream primer cbh2-R2 of cbh2-1-3-1 and the upstream primer cbh2-F1 of cbh2 to amplify the upper fragment of cbh2-1-3-1; using cbh2 gene as template, using the upstream primer cbh2-F2 of cbh2-1-3-1 and the downstream primer cbh2-R1 of cbh2 to amplify the lower fragment of cbh2-1-3-1; then using the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2, the upper and lower fragments were overlapped by PCR amplification to obtain the full fragment of cbh2-1-3-1; Using cbh2 gene as template, using the downstream primer cbh2-R3 of cbh2-l-3-2 and the upstream primer cbh2-F1 of cbh2 to amplify the upper fragment of cbh2-l-3-2; using the upstream primer cbh2-F3 of cbh2-l-3-2 and the downstream primer cbh2-R1 of cbh2 to amplify the lower fragment of cbh2-L-3-2; then using the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2, the upper and lower fragments were overlapped by PCR amplification to obtain the full fragment of cbh2-l-3-2; Using cbh2 as a template, the upper fragment of cbh2-l-10 was amplified using the downstream primer cbh2-R6 of the mutant cbh2-l-10 and the upstream primer cbh2-F1 of cbh2; the lower fragment of the mutant cbh2-l-10 was amplified using the upstream primer cbh2-6 of cbh2-l-10 and the downstream primer cbh2-R1 of cbh2; and the upper and lower fragments were overlapped by PCR amplification using the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of the mutant cbh2-l-10; Using cbh2 as a template, the upper fragment of cbh2-l-14 was amplified using the downstream primer cbh2-R7 of cbh2-l-14 and the upstream primer cbh2-F1 of cbh2; the lower fragment of cbh2-l-14 was amplified using the upstream primer cbh2-F7 of cbh2-l-14 and the downstream primer cbh2-R1 of cbh2; and the upper and lower fragments were overlapped by PCR amplification using the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-l-14; Using cbh2 as a template, the upper fragment of cbh2-l-17 was amplified using the downstream primer cbh2-R9 of cbh2-l-17 and the upstream primer cbh2-F1 of cbh2; the lower fragment of cbh2-l-17 was amplified using the upstream primer cbh2-F9 of cbh2-l-17 and the downstream primer cbh2-R1 of cbh2; and the upper and lower fragments were overlapped by PCR amplification using the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-l-17; Using cbh2 as a template, the upper fragment of cbh2-1+2 was amplified using the downstream primer cbh2-R10 of cbh2-1+2 and the upstream primer cbh2-F1 of cbh2; the lower fragment of cbh2-1+2 was amplified using the upstream primer cbh2-F10 of cbh2-1+2 and the downstream primer cbh2-R1 of cbh2; and the upper and lower fragments were overlapped by PCR amplification using the upstream and downstream primers cbh2-F1 / cbh2-R1 of cbh2 to obtain the full fragment of cbh2-1+2; Using cbh2 as template, cbh2-l R=N The target fragment was amplified by using upper and lower primers cbh2-F12 and cbh2-R12, and the template was eliminated and purified to obtain cbh2-1 R=N Gene fragment.

7. Use of the CBHII protein mutant according to claim 1 in enzymatic hydrolysis of cellulose.

8. The use according to claim 7, characterized in that: The CBHII protein mutant is selected from CBHII-L-3-1 protein, and / or CBHII-L-3-2 protein, and / or CBHII-L-10 protein, and / or CBHII-L-14 protein, and / or CBHII-L-17 protein, and / or CBHII-L R=N protein.

9. Use of the CBHII protein mutant according to claim 1 in synergistic hydrolysis of cellulose with endo-cellulase and β-glucosidase.

10. The use according to claim 9, characterized in that: The protein mutant is selected from CBHⅡ-L-3-2 protein, and / or CBHⅡ-L-10 protein, and / or CBHⅡ-L-14 protein, and / or CBHⅡ-L-17 protein, and / or CBHⅡ-L R=N protein.