Novel glutamine transaminase activated protein

Abstract

The present invention relates to a novel glutamine transaminase-activated protease and a polynucleotide encoding the same, a nucleic acid construct or an expression vector comprising the polynucleotide, and a host cell comprising the nucleic acid construct or the expression vector. The invention also relates to a method for producing the recombinant host cell disclosed by the invention, a method for producing the glutamine transaminase activated protease disclosed by the invention, and a method for producing glutamine transaminase by utilizing the glutamine transaminase activated protease disclosed by the invention. The novel glutamine transaminase activated protease can accelerate the activation of glutamine transaminase zymogen into mature enzyme, and has a good application prospect in the fermentation production process of glutamine transaminase.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a novel glutamine transaminase activating protein and polynucleotides encoding the same, as well as related nucleic acid constructs, expression vectors and host cells. The present invention also relates to a method for producing glutamine transaminase activating protease, and a method for producing glutaminyl transaminase using the glutamine transaminase activating protease of the present invention. Background Art

[0002] Glutamine transaminase can catalyze the transfer of the γ-carboxamide group (acyl donor) of glutamine (Gln) residues in the protein peptide chain to the ε-amino group (acyl acceptor) of lysine (Lys) residues, forming an ε-(γ-glutamyl)lysine covalent bond, resulting in cross-linking of protein molecules. Due to its unique properties, it has currently been widely used in the food industry. For example, it can enhance the texture of products in soy products, meat products, and dairy products, and in the fields of food packaging and coating, it can extend the shelf life of food. In addition, there are many application studies in non-food fields such as medicine, biomaterials, and textile and leather processing, and it has a very broad application prospect.

[0003] In the 1950s, glutamine transaminase was first discovered in guinea pig liver. Until the late 1980s, the main production method was to isolate glutamine transaminase from animal tissues or blood. Due to the scarcity of animal tissue sources and the cumbersome extraction methods, the price of glutamine transaminase products was expensive. In addition, the reaction of animal-derived glutamine transaminase requires Ca 2+ catalysis to destroy the stability of food proteins, so these enzymes have not been commercialized or accepted by the public for a long time. In 1989, Ando et al. screened a microorganism Streptoverticillium sp. S-8112 that can produce glutamine transaminase from the soil, which was later classified as Streptomyces. The glutamine transaminase produced by microorganisms is an extracellular enzyme and is directly secreted into the culture medium. Its separation and purification are much easier than those of glutamine transaminase from animal and plant sources. Moreover, the raw materials for microbial fermentation are cheap and the production cycle is short. Based on the advantages of low production cost and high production efficiency, there is a possibility of large-scale industrial production.

[0004] The production of glutamine transaminase by microbial fermentation has many advantages. For example, it does not rely on Ca 2+For catalytic reactions, microorganisms are easy to culture and the production cost is low. So far, transglutaminase has been heterologously expressed in many hosts, such as Corynebacterium glutamicum, Yarrowia lipolytica, Bacillus subtilis, and Pichia pastoris. Since the propeptide region is crucial for the expression of transglutaminase, and heterologous expression hosts lack the transglutaminase activation system, additional addition or in vivo expression of activating protease is required to complete the cleavage of the proenzyme. Currently, few available activating proteins have been reported, and the expression level is low, which limits the application of the process of activating transglutaminase proenzyme to mature enzyme. Summary of the Invention

[0005] Specifically, the present invention solves the above-mentioned technical problems in the prior art through the following technical solutions. The transglutaminase activating protease of the present invention can successfully cleave the transglutaminase proenzyme, thereby effectively promoting the production of transglutaminase:

[0006] 1. A transglutaminase activating protease, which comprises the following amino acid sequence or consists of the following amino acid sequence:

[0007] (1) The amino acid sequence shown in SEQ ID NO:2 or 6, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO:2 or 6;

[0008] (2) The amino acid sequence encoded by SEQ ID NO:1 or 5, or an amino acid sequence encoded by a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO:1 or 5.

[0009] 2. The transglutaminase activating protease according to item 1, which is derived from Streptomyces mobaraensis, preferably derived from Streptomyces mobaraensis CCTCC NO:M 2020197.

[0010] 3. A polynucleotide, which encodes the transglutaminase activating protease according to item 1 or 2.

[0011] 4. A nucleic acid construct, which comprises the polynucleotide according to item 3.

[0012] 5. A recombinant expression vector, which comprises the nucleic acid construct according to item 4.

[0013] 6. A recombinant host cell comprising the nucleic acid construct of item 4 or the recombinant expression vector of item 5, preferably the host cell is a bacterium or a fungus, more preferably the host cell is an Escherichia coli cell.

[0014] 7. A method for producing the recombinant host cell of item 6, comprising:

[0015] (a) integrating the polynucleotide of item 3 into the genome of the host cell; or

[0016] (b) transforming the nucleic acid construct of item 4 or the recombinant expression vector of item 5 into the host cell.

[0017] 8. A method for producing a glutamine transaminase activating protease, comprising:

[0018] (a) culturing the host cell of item 6 under conditions conducive to the production of the glutamine transaminase activating protease; and

[0019] (b) recovering the glutamine transaminase activating protease from the culture of step (a).

[0020] 9. The method according to item 8, wherein step (b) includes purifying the culture of step (a) using affinity chromatography.

[0021] 10. A method for producing glutaminyl transaminase, comprising:

[0022] (a) culturing a host cell capable of producing glutamine transaminase zymogen under conditions conducive to the production of glutamine transaminase zymogen;

[0023] (b) adding the glutamine transaminase activating protease of the present invention to the culture of step (a) to convert glutamine transaminase zymogen into glutaminyl transaminase; and

[0024] (c) optionally recovering the resulting glutaminyl transaminase.

[0025] To make the technical solutions of the present invention clearer, the present invention will be further described below in conjunction with the accompanying drawings and specific embodiments. Description of the Drawings

[0026] Figure 1 It is the SDS-PAGE electrophoresis diagram of the fermentation broth of the genetic engineering strain Emp2 of the present invention, wherein the left lane is the marker (M), the right lane is the Emp2 fermentation broth, and the arrow indicates the glutamine transaminase activating protein of the present invention;

[0027] Figure 2SDS-PAGE electrophoresis pattern of the peak-eluting sample obtained after purifying the fermentation broth of the genetically engineered strain Emp2 of the present invention. The left lane is the marker (M), the middle lane is the Emp2 fermentation broth, and the right lane is the peak-eluting sample after purification. The arrow indicates the transglutaminase activating protein of the present invention;

[0028] Figure 3 It shows that the transglutaminase activity increases with time, indicating that the transglutaminase activating protein of the present invention has significant transglutaminase activating activity;

[0029] Figure 4 SDS-PAGE electrophoresis patterns at different times after treatment with the transglutaminase activating protein of the present invention, which show that the protransglutaminase in the fermentation broth is gradually converted into mature transglutaminase over time, thereby indicating that the transglutaminase activating protein of the present invention has significant transglutaminase activating activity. Detailed Description of the Invention

[0031] 1. Definitions

[0032] Sequence identity: The parameter "sequence identity" describes the relatedness between two nucleotide sequences.

[0033] For the present invention, the degree of sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics 16: 276-277), preferably version 3.0.0 or higher. The optional parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output result marked as "longest identity" by Needle (obtained using the -nobrief option) is used as the percentage identity and is calculated as follows:

[0034] (Same residues × 100) / (Alignment length - Total number of gaps in the alignment)

[0035] For the purposes of the present invention, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. Optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output labeled "highest identity" from Needle (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

[0036] (Identical deoxyribonucleotides × 100) / (Alignment length - Total number of gaps in the alignment)

[0037] Isolated polynucleotide: The term "isolated polynucleotide" as used herein refers to a polynucleotide that has been isolated from its source. In one aspect, the variant is at least 1% pure, preferably at least 5% pure, more preferably at least 10% pure, more preferably at least 20% pure, more preferably at least 40% pure, more preferably at least 60% pure, more preferably at least 80% pure, and most preferably at least 90% pure as determined by agarose gel electrophoresis.

[0038] Nucleic acid construct: As used herein, the term "nucleic acid construct" refers to a single-stranded or double-stranded nucleic acid molecule that has been isolated from a naturally occurring gene, or that has been modified to contain segments of nucleic acid in a manner not otherwise exist in nature, or that is synthetic. When the nucleic acid construct contains the regulatory sequences required for the expression of the coding sequence of the present invention, the term nucleic acid construct is synonymous with the term "expression cassette".

[0039] Regulatory sequence: As used herein, the term "regulatory sequence" is defined to include all components that are necessary for the expression of a polynucleotide in the methods of the present invention. Each regulatory sequence may be native or heterologous to the polynucleotide sequence, or each regulatory sequence may be native or heterologous to each other. These regulatory sequences include, but are not limited to, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. In the least case, the regulatory sequences include a promoter and transcriptional and translational termination signals. The regulatory sequences may be provided with linkers for introducing specific restriction sites that facilitate the ligation of the regulatory sequences to the coding region of the nucleotide sequence encoding the polypeptide.

[0040] Operably linked: The term "operably linked" as used herein refers to a configuration in which a regulatory sequence is placed in an appropriate position relative to the coding sequence of a polynucleotide sequence such that the regulatory sequence directs the expression of the coding sequence of the polypeptide.

[0041] Expression: The term "expression" includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0042] Expression vector: The term "expression vector" as used herein is defined as a linear or circular DNA molecule that contains a polynucleotide encoding a polypeptide of the present invention and is operably linked to additional nucleotides that provide for its expression.

[0043] Host cell: "Host cell" as used herein includes any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector containing a polynucleotide of the present invention.

[0044] 2. The transglutaminase-activated protease of the present invention and its coding (gene) sequence

[0045] In one aspect, the present invention provides a transglutaminase-activated protease comprising the following amino acid sequence or consisting of the following amino acid sequence: (1) the amino acid sequence as shown in SEQ ID NO: 2 or 6, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 2 or 6; (2) the amino acid sequence encoded by SEQ ID NO: 1 or 5, or an amino acid sequence encoded by a nucleotide acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 1 or 5.

[0046] In one embodiment, the transglutaminase activating protease of the present invention comprises the amino acid sequence shown in SEQ ID NO:2 or consists of the amino acid sequence shown in SEQ ID NO:2. In one embodiment, the transglutaminase activating protease of the present invention comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:2, or consists of said amino acid sequence. In one embodiment, the amino acid sequence of the transglutaminase activating protease of the present invention differs from SEQ ID NO:2 by only 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid mutations. In one embodiment, the amino acid mutations are selected from the group consisting of: substitution, addition, deletion or inversion.

[0047] In one embodiment, the transglutaminase activating protease of the present invention further comprises a signal peptide sequence in addition to comprising the amino acid sequence shown in SEQ ID NO:2 or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:2. In one embodiment, the signal peptide sequence comprises SEQ ID NO:4 or an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:4. In one embodiment, the signal peptide sequence is as shown in SEQ ID NO:4.

[0048] In one embodiment, the transglutaminase activating protease of the present invention comprises the amino acid sequence shown in SEQ ID NO: 6 or consists of the amino acid sequence shown in SEQ ID NO: 6. In one embodiment, the transglutaminase activating protease of the present invention comprises an amino acid sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 6, or consists of said amino acid sequence. In one embodiment, the amino acid sequence of the transglutaminase activating protease of the present invention differs from SEQ ID NO: 6 by only 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid mutations. In one embodiment, the amino acid mutations are selected from the group consisting of: substitution, addition, deletion or inversion.

[0049] In one embodiment, the transglutaminase activating protease of the present invention comprises the amino acid sequence encoded by SEQ ID NO: 1 or consists of said amino acid sequence. In one embodiment, the coding sequence of the transglutaminase activating protease of the present invention comprises an amino acid sequence encoded by a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 1, or consists of said amino acid sequence. In one embodiment, the coding sequence of the transglutaminase activating protease of the present invention differs from SEQ ID NO: 1 by only 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide mutations. In one embodiment, the nucleotide mutations are selected from the group consisting of: substitution, addition and deletion.

[0050] In one embodiment, the transglutaminase activating protease of the present invention, in addition to comprising the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO:1, further comprises a signal peptide sequence. In one embodiment, the signal peptide sequence comprises the amino acid sequence encoded by SEQ ID NO:3 or a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO:3. In one embodiment, the signal peptide sequence is encoded by SEQ ID NO:3.

[0051] In one embodiment, the transglutaminase activating protease of the present invention comprises or consists of the amino acid sequence encoded by SEQ ID NO:5. In one embodiment, the transglutaminase activating protease of the present invention comprises or consists of the amino acid sequence encoded by a nucleotide sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO:5. In one embodiment, the coding sequence of the transglutaminase activating protease of the present invention differs from SEQ ID NO:5 by 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotide mutations. In one embodiment, the nucleotide mutations are selected from the group consisting of substitutions, additions and deletions.

[0052] In one embodiment, the coding sequence of the transglutaminase activating protease of the present invention is obtained by analyzing the Streptomyces mobaraensis genome. In one embodiment, the transglutaminase activating protease of the present invention is a neutral metalloprotease. In one embodiment, the name of the coding gene of the transglutaminase activating protease of the present invention is mp2.

[0053] In one embodiment, the transglutaminase activating protease of the present invention has the activity of activating transglutaminase. In one embodiment, the transglutaminase activating protease of the present invention can cleave protransglutaminase to obtain mature transglutaminase.

[0054] In one embodiment, the transglutaminase-activating protease of the present invention is derived from the genus Streptomyces. In one embodiment, the transglutaminase-activating protease of the present invention is derived from Streptomyces mobaraensis. In one embodiment, the transglutaminase-activating protease of the present invention is derived from Streptomyces mobaraensis CCTCC NO: M 2020197. Details of Streptomyces mobaraensis CCTCC NO: M 2020197 can be found in CN 111690570.

[0055] In one embodiment, the transglutaminase-activating protease of the present invention comprises or consists of 504 amino acids (SEQ ID NO: 2). In one embodiment, the transglutaminase-activating protease of the present invention further comprises a 35-amino acid long signal peptide sequence (SEQ ID NO: 4). In one embodiment, the transglutaminase-activating protease of the present invention comprises or consists of 539 amino acids (SEQ ID NO: 6).

[0056] In one embodiment, the coding sequence (gene sequence) of the transglutaminase-activating protease of the present invention comprises or consists of 1515 base pairs (SEQ ID NO: 1). In one embodiment, the transglutaminase-activating protease of the present invention further comprises a 105-nucleotide long signal peptide coding sequence (SEQ ID NO: 3). In one embodiment, the coding sequence (gene sequence) of the transglutaminase-activating protease of the present invention comprises or consists of 1620 nucleotides or base pairs (SEQ ID NO: 5).

[0057] 3. The polynucleotides, nucleic acid constructs, expression vectors and host cells of the present invention

[0058] In one aspect, the present invention provides a polynucleotide that encodes the transglutaminase-activating protease of the present invention.

[0059] In one aspect, the present invention provides a nucleic acid construct that comprises the polynucleotide of the present invention.

[0060] In one embodiment, the polynucleotide of the present invention is operably linked to one or more regulatory sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the regulatory sequence.

[0061] The regulatory sequence can be a promoter sequence, which is a nucleotide sequence recognized by a host cell for expressing a polynucleotide encoding the polypeptide of the present invention. The promoter sequence contains transcriptional regulatory sequences that mediate the expression of the polypeptide. The promoter can be any nucleotide sequence that shows transcriptional activity in the selected host cell, including mutated, truncated, and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.

[0062] The regulatory sequence can also be a suitable transcription terminator sequence, i.e., a sequence recognized by the host cell to terminate transcription. The terminator sequence is operably linked to the 3'-end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the selected host cell can be used in the present invention.

[0063] The regulatory sequence can also be a polyadenylation sequence, which is a sequence operably linked to the 3'-end of the nucleotide sequence and, upon transcription, is recognized by the host cell as a signal to add polyadenyl residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the selected host cell can be used in the present invention.

[0064] The regulatory sequence can also be a signal peptide coding sequence, which encodes a signal peptide linked to the amino terminus of the polypeptide and directs the encoded polypeptide into the cell secretory pathway. The coding sequence at the 5'-end of the nucleotide sequence may inherently contain a signal peptide coding sequence that is naturally linked in the translation reading frame with a fragment of the coding sequence encoding the secreted polypeptide. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. The foreign signal peptide coding sequence may be necessary when the coding sequence does not naturally contain a signal peptide coding sequence. Or, the foreign signal peptide coding sequence can simply replace the native signal peptide coding sequence to enhance the secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of the selected host cell (i.e., secreted into the culture medium) can be used in the present invention.

[0065] The regulatory sequence can also be a propeptide coding sequence, which encodes a propeptide located at the amino terminus of the polypeptide. The resulting polypeptide is called a proenzyme or a propolypeptide (or in some cases a zymogen). The propeptide is usually inactive and can be converted from the propolypeptide to the mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide.

[0066] When both a signal peptide and a propeptide sequence are present at the amino terminus of the polypeptide, the propeptide sequence is placed next to the amino terminus of the polypeptide, and the signal peptide sequence is placed next to the amino terminus of the propeptide sequence.

[0067] It is also desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause gene expression to be switched on or off in response to chemical or physical stimuli, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac and trp operator systems. In yeast, the ADH2 system or GAL1 system can be used. In filamentous fungi, the TAKA α-amylase promoter, Aspergillus niger glucoamylase promoter and Aspergillus oryzae glucoamylase promoter can be used as regulatory sequences. Other examples of regulatory sequences are those which allow gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein gene which is amplified with heavy metal. In these cases, the nucleotide sequence encoding the polypeptide will be operably linked to the regulatory sequence.

[0068] In one aspect, the present invention provides a recombinant expression vector comprising the nucleic acid construct or polynucleotide of the present invention.

[0069] In one embodiment, the recombinant expression vector of the present invention comprises the polynucleotide of the present invention, a promoter and transcriptional and translational termination signals. The various nucleic acid and regulatory sequences described herein can be combined to produce a recombinant expression vector which may include one or more convenient restriction sites to allow the insertion or substitution of the nucleotide sequence encoding the polypeptide at these sites. Alternatively, the polynucleotide sequence of the present invention can be expressed by inserting the nucleotide sequence or nucleic acid construct comprising the sequence into a suitable vector for expression of the coding sequence. In the process of preparing the expression vector, the coding sequence is placed in the vector such that the coding sequence is operably linked to the appropriate expression regulatory sequences.

[0070] The recombinant expression vector of the present invention can be any vector (e.g., plasmid or virus) which is capable of facilitating the recombinant DNA procedures and capable of producing the expression of the nucleotide sequence. The choice of the vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0071] The recombinant expression vector of the present invention can be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity and whose replication is independent of chromosomal replication. For example, it can be a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector can contain any means for ensuring self-replication. Alternatively, the vector can be one that integrates into the genome when introduced into a host cell and replicates together with the chromosome into which the vector has integrated. In addition, a single vector or plasmid, or two or more vectors or plasmids that together contain the complete DNA to be introduced into the host cell genome, can be used, or a transposon can be used.

[0072] The recombinant expression vector of the present invention preferably contains one or more selectable markers that allow for the simple selection of cells that have been transformed, transfected, transduced, etc. A selectable marker is a gene whose product provides biocide or virus resistance, resistance to heavy metals, prototrophy to auxotrophs, etc.

[0073] The recombinant expression vector of the present invention preferably contains elements that allow the vector to integrate into the host cell genome or to replicate autonomously in the cell independently of the genome.

[0074] For integration into the host cell genome, the recombinant expression vector of the present invention can rely on the sequence of the polynucleotide encoding the polypeptide or any other vector element for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector can contain additional nucleotide sequences for directing integration into the precise location in the host cell genome chromosome by homologous recombination. To increase the likelihood of integration at the precise location, the integration element should preferably contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, preferably 400 to 10,000 base pairs, and most preferably 800 to 10,000 base pairs, which have a high sequence identity with the corresponding target sequence to enhance the probability of homologous recombination. The integration element can be any sequence that is homologous to the target sequence in the host cell genome. In addition, the integration element can be a non-coding or coding nucleotide sequence. On the other hand, the vector can be integrated into the host cell genome by non-homologous recombination.

[0075] For autonomous replication, the recombinant expression vector of the present invention can further contain an origin of replication that enables the vector to replicate autonomously in the said host cell. The origin of replication can be any plasmid replicator that mediates autonomous replication and functions in the cell. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence capable of causing the in vivo replication of a plasmid or vector.

[0076] A nucleic acid construct comprising more than one copy of the polynucleotide of the present invention can be inserted into a host cell to increase the production of the gene product. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene in the polynucleotide, where cells containing an amplified copy of the selectable marker gene and thus an additional copy of the polynucleotide can be selected by culturing the cells in the presence of a suitable selectable agent.

[0077] Methods for ligating the above elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., 1989, supra).

[0078] In one aspect, the present invention provides a recombinant host cell comprising the nucleic acid construct or recombinant expression vector of the present invention. In one embodiment, the host cell is a prokaryotic cell or a eukaryotic cell. In one embodiment, the host cell is a bacterial cell, a fungal cell or an animal cell. In one embodiment, the host cell is an Escherichia coli cell.

[0079] In one embodiment, the recombinant host cell of the present invention comprises the polynucleotide of the present invention operably linked to one or more regulatory sequences. A construct or vector comprising the polynucleotide of the present invention is introduced into a host cell such that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector as described above. The term "host cell" includes any progeny of a parental cell that differs from the parental cell due to mutations that occur during replication. The choice of host cell will depend to a large extent on the gene encoding the polypeptide and its source.

[0080] In one embodiment, the recombinant host cell of the present invention can be, for example, a eukaryote such as a mammalian, insect, plant or fungal cell.

[0081] 4. Method for producing the recombinant host cell of the present invention

[0082] In one aspect, the present invention provides a method for producing the recombinant host cell of the present invention, which comprises: (a) integrating the polynucleotide of the present invention into the genome of a host cell; or (b) transforming the nucleic acid construct or recombinant expression vector of the present invention into a host cell.

[0083] In one embodiment, the host cell (genetically engineered bacterium) of the present invention was constructed by the following method: inserting SEQ ID NO: 1 or 5 into a plasmid vector (such as pET22b(+)) to obtain a recombinant plasmid (such as pET22b(+) / mp2), and transforming it into an Escherichia coli host cell (such as E. coli BL21(DE3)), thereby obtaining a genetically engineered bacterial strain (such as Emp2) that can express the transglutaminase-activating protease of the present invention.

[0084] In one aspect, the present invention provides a method for producing transglutaminase-activating protease, which comprises: (a) culturing the host cell of the present invention under conditions conducive to the production of transglutaminase-activating protease of the present invention; and (b) recovering the transglutaminase-activating protease from the culture of step (a).

[0085] In one embodiment, step (a) comprises: inoculating a genetically engineered bacterium host cell (such as Emp2) into a first liquid medium (such as LB), culturing it for a period of time (such as 12 hours) under culture conditions suitable for the host (such as 37 °C, 180 - 230 rpm), then transferring it to a second liquid medium (such as TB) at an inoculation amount of a certain (such as 1% - 3%) amount, and culturing it for a period of time (such as 3 hours) under culture conditions suitable for the host (such as 37 °C, 180 - 230 rpm). After that, when the OD of the bacterial cells 600 is 0.6 - 1.5, adding IPTG at a certain concentration (such as a final concentration of 20 - 100 μM) for induction, and adjusting the culture conditions (such as changing the culture conditions to 20 - 30 °C, 180 - 230 rpm and culturing for 15 - 25 hours) to continue the culture.

[0086] In one embodiment, step (b) comprises: purifying the culture of step (a) using affinity chromatography. In one embodiment, step (b) comprises: subjecting the above fermentation broth to high-speed centrifugation and collecting the supernatant, and then filtering (such as filtering with a 0.22 μm aqueous filter membrane) to remove impurities. Attaching a histidine tag (such as 6His-tag) to the N-terminus of the transglutaminase-activating protease of the present invention, and purifying the recombinant transglutaminase-activating protease produced by the present invention using nickel affinity chromatography, thereby obtaining a purified transglutaminase-activating protease.

[0087] 5. Method for producing glutaminyl transpeptidase

[0088] In one aspect, the present invention provides a method for producing transglutaminase, which comprises: (a) culturing a host cell capable of producing zymogen of transglutaminase under conditions conducive to the production of zymogen of transglutaminase; (b) adding the transglutaminase activating protease of the present invention to the culture of step (a) to convert the zymogen of transglutaminase into transglutaminase; and (c) optionally recovering the resulting transglutaminase.

[0089] In one embodiment, step (a) comprises: fermenting Streptomyces mobaraensis CCTCC NO: M 2020197 in a fermentation medium for 16 hours according to the culture method disclosed in CN 111690570 to obtain a fermentation broth. In one embodiment, step (b) comprises: adding the transglutaminase activating protease of the present invention at a certain concentration (for example, a final concentration of 0.5 - 2 μM, preferably 1 μM) to the fermentation broth obtained in step (a). In one embodiment, in step (b), it can be observed that the zymogen of transglutaminase in the fermentation broth of Streptomyces mobaraensis is gradually converted into mature transglutaminase, thereby demonstrating that the transglutaminase activating protease of the present invention has the activity of transglutaminase. In one embodiment, in step (b), it can be observed that the transglutaminase activating protease of the present invention can successfully cleave the zymogen of transglutaminase and obtain mature transglutaminase.

[0090] 6. Technical advantages and beneficial effects of the present invention

[0091] Compared with the prior art, the present invention has at least the following technical advantages and beneficial effects:

[0092] (1) The present invention obtains a novel sequence of transglutaminase activating protease;

[0093] (2) The present invention obtains a genetically engineered bacterium heterologously expressing the novel transglutaminase activating protease. By optimizing the expression conditions, a functional active activating protease can be obtained, which can efficiently catalyze the conversion of zymogen of transglutaminase into mature enzyme, is conducive to the fermentation production of transglutaminase, increases the yield, and reduces the cost;

[0094] (3) The present invention obtains a method for purifying the novel transglutaminase activating protease, and an activating protease with a single band and high purity can be obtained, making the later application more convenient.

[0095] The sequence of the present invention

[0096] A coding sequence (SEQ ID NO: 1) of the transglutaminase activating protease of the present invention is shown as follows:

[0097]

[0098] A signal peptide coding sequence (SEQ ID NO: 3) of the novel glutamine transaminase activating protease of the present invention is shown as follows:

[0099] TTGAGACTCACCGCCACCCCCCGCACCACGGCCCTGCGCGCCGCCGCCCTCGTCGCCTCCGCGGCGATGGTCGTCGTCGGCGTGCAGACGGGCAGCGCGAGCGCC

[0100]

[0101] One amino acid sequence (SEQ ID NO: 2) of the novel transglutaminase-activating protease of the present invention is shown as follows:

[0102] SGDRDSGGLPLTLSATQRTAAIQEAQSGASATAAKIGLGGKEKLVVRDVVKDADGTVHTRYERTYDGLPVLGGDLIVHEGKGAKGGREVTKATDAAIAVPSTSPSLAPAEAKKSALSAAADQKTAKAAGQAPRKVVWAAQGKPVLAYETVVTGVQKDGTPSELHVITDAASGKKLYQYEAIETGTGTSTYSGTVPLTTTKSGSQYQLIDGARGGHKTYDLNQGQSGTGSLYTNSTDTWGGGRQTAGVDAHYGAAVTWDFYKNTFGRNGIRNDGKGAYSRVHYGNNYVNAFWSDSCFCMTYGDGEGNKNPLTALDVAAHEMSHGVTAATAKLVYSGESGGLNEATSDIFGTATEFYANNKTDVGDYLIGEKINIFGNGKPLRYMDKPSKDGKSKDSWYSGIGGVDVHYSSGPANHFFYLLSEGSGKKTINGVNYDSPTADGSKVTGIGRDKAQKIWYKALTTQFTSNTNYAKARTGTLNAAASLYGNNSAEYKAVAAAWSAINVK

[0103] One signal peptide sequence (SEQ ID NO: 4) of the novel transglutaminase-activating protease of the present invention is shown as follows:

[0104] LRLTATPRTTALRAAALVASAAMVVVGVQTGSASA

[0105] One amino acid sequence (SEQ ID NO: 6) of the novel transglutaminase-activating protease of the present invention is shown as follows, wherein the first 35 amino acids are the signal peptide (in bold):

[0106] Detailed implementation manners

[0107] The present invention will be further described below in conjunction with specific embodiments, but these specific embodiments should not be construed as limiting the protection scope of the present invention. Those skilled in the art can make various changes or modifications to these specific embodiments without departing from the technical solution scope of the present invention, and the modified implementation schemes still fall within the protection scope of the present invention.

[0108] The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

[0109] The formulations of the culture media or buffer solutions involved in the following examples are as follows:

[0110] LB liquid medium (g·L -1 ): Tryptone 10, yeast extract 5, sodium chloride 10.

[0111] LB solid medium (g·L -1 ): Tryptone 10, yeast extract 5, sodium chloride 10, agar powder 20.

[0112] TB medium (g·L -1 ): Tryptone 12, yeast extract 24, glycerol 5, potassium dihydrogen phosphate 2.31, dipotassium hydrogen phosphate 12.54.

[0113] Buffer A: 50 mM PB buffer, 150 mM NaCl, pH 7.4.

[0114] Buffer B: 50 mM PB buffer, 150 mM NaCl, 500 mM imidazole, pH 7.4.

[0115] Example 1. Novel transglutaminase-activated protease gene sequence

[0116] After culturing Streptomyces mobaraensis CCTCC NO: M 2020197 for 24 hours, the cells were collected and the genomic DNA was extracted. The extracted genomic DNA was subjected to whole-genome sequencing, and mined using the online tool NCBI (https: / / www.ncbi.nlm.nih.gov / ), to obtain the novel transglutaminase-activated protease gene sequence, as shown in SEQ ID NO: 1 or 5.

[0117] Example 2. Construction of genetically engineered strain Emp2

[0118] Specific primers for amplifying mp2 were designed. The upstream primer mpF: CATG CCATGG ATTTGAGACTCACCGCCACCCCCCGC, and the downstream primer mpR: CCG CTCGAGCTTGACGTTGATGGCGGACCAGGCCG, with the underlined part being the restriction enzyme cleavage site. Using the genome of Streptomyces mobaraensis CCTCC NO: M 2020197 as a template, PCR amplification was performed with the primer pair mpF / mpR. The amplification conditions were: 98°C for 3 minutes; 98°C for 10 seconds, 60°C for 30 seconds, 72°C for 2 minutes, for a total of 30 cycles; and 72°C for 10 minutes. The amplified product and the plasmid pET22b(+) were digested with the restriction enzymes Nco I and Xho I for 1 hour respectively. After digestion, they were recovered and purified using a nucleic acid purification kit, and then ligated with Takara Solution I ligase at 16°C for 8 hours to obtain the recombinant plasmid pET22b(+) / mp2. It was then transferred into E. coli BL21(DE3), and spread on a solid LB plate containing ampicillin at a final concentration of 50 μM. After culturing for 12 hours, transformants were picked, which were the recombinant strain Emp2.

[0119] Example 3. High-level expression of mp2 in Escherichia coli

[0120] Pick a single colony of the genetically engineered strain Emp2 and inoculate it into an LB liquid medium containing ampicillin at a final concentration of 50 μM. Culture at 37°C and 180 - 230 rpm for 12 hours, then transfer it to a TB liquid medium containing 50 μM ampicillin at an inoculation amount of 1% - 3% and culture at 37°C and 180 - 230 rpm for 3 hours. When the OD 600 of the bacteria is 0.6 - 1.5, add IPTG at a final concentration of 20 μM - 100 μM, and change the culture conditions to 20 - 30°C and 180 - 230 rpm and continue to culture for 15 - 25 hours. Perform SDS-PAGE analysis on the protein in the obtained fermentation broth. As Figure 1 shown, there is a protein band of mp2 in the fermentation broth of the recombinant strain Emp2.

[0121] Example 4. Purification of mp2 protein in the fermentation broth

[0122] The fermentation medium obtained in Example 3 was centrifuged at high speed and the supernatant was collected, and then filtered through a 0.22 μm aqueous filter membrane to remove impurities. Attach a 6His-tag histidine tag to the N-terminus of the transglutaminase-activating protease of the present invention, and purify the recombinant protein by nickel affinity chromatography. Rinse the pre-packed purification column HisTrap HP column (GE healthcare) with buffer A for 5 column volumes. After loading the sample, continue to rinse the column with buffer A until it is balanced, and then perform linear elution according to buffer B, and collect the eluted samples. As Figure 2 shown, a single band of mp2 was obtained.

[0123] Example 5. Activation of transglutaminase using mp2

[0124] According to the cultivation method and the method for detecting the enzyme activity of transglutaminase in CN 111690570, after Streptomyces mobaraensis CCTCC NO: M 2020197 was fermented in a fermentation medium for 16 hours, the fermentation broth was obtained. mp2 with a final concentration of 1 μM was added to the centrifuged supernatant. After mixing evenly, it was placed at 37 °C and allowed to stand for 5 hours. Samples were taken every 1 hour to analyze the enzyme activity of transglutaminase in the fermentation supernatant and perform SDS-PAGE electrophoresis on it. As Figure 3 shown, after adding mp2, the activity of transglutaminase in the fermentation supernatant increased with time. As Figure 4 shown, SDS-PAGE electrophoresis showed that the amount of protransglutaminase in the fermentation broth gradually decreased, while at the same time the amount of mature transglutaminase gradually increased ( Figure 4 ), thus determining that mp2 has the function of activating transglutaminase, that is, it can effectively cleave protransglutaminase to obtain mature transglutaminase. In this way, the production of transglutaminase can be further optimized. For example, by adding mp2 to the fermentation of Streptomyces mobaraensis and then discharging the fermenter in advance, the fermentation time can be shortened, energy consumption can be saved, and production costs can be reduced, thereby greatly increasing the yield and production efficiency of transglutaminase.

[0125] The above are only the preferred embodiments of the present invention and do not impose any form of limitation on the present invention. Although the specific implementation manners of the present invention have been described above, those skilled in the art should understand that this is only an example. The protection scope of the present invention is defined by the appended claims. Without departing from the technical solution scope of the present invention, those skilled in the art can make various changes or modifications to the above-disclosed technical content, and these changes and modifications all fall within the protection scope of the present invention.

Claims

1. A glutamine transaminase activating protease, which comprises the following amino acid sequence or consists of the following amino acid sequence: (1) The amino acid sequence shown in SEQ ID NO: 2 or 6, or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 2 or 6; (2) The amino acid sequence encoded by SEQ ID NO: 1 or 5, or an amino acid sequence encoded by a nucleotide acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 1 or 5.

2. The glutamine transaminase activating protease according to claim 1, which is derived from Streptomyces mobaraensis, preferably derived from Streptomyces mobaraensis CCTCC NO: M 2020197.

3. A polynucleotide, which encodes the glutamine transaminase activating protease according to claim 1 or 2.

4. A nucleic acid construct, which comprises the polynucleotide according to claim 3.

5. A recombinant expression vector, which comprises the nucleic acid construct according to claim 4.

6. A recombinant host cell, which comprises the nucleic acid construct according to claim 4 or the recombinant expression vector according to claim 5, preferably the host cell is a bacterium or a fungus, more preferably the host cell is an Escherichia coli cell.

7. A method for producing the recombinant host cell according to claim 6, which comprises: (a) Integrating the polynucleotide according to claim 3 into the genome of the host cell; or (b) Transforming the nucleic acid construct according to claim 4 or the recombinant expression vector according to claim 5 into the host cell.

8. A method for producing a glutamine transaminase activating protease, which comprises: (a) Culturing the host cell according to claim 6 under conditions conducive to the production of the glutamine transaminase activating protease; and (b) Recovering the glutamine transaminase activating protease from the culture in step (a).

9. The method according to claim 8, wherein step (b) includes purifying the culture in step (a) using affinity chromatography.

10. A method for producing glutamyl transaminase, which comprises: (a) Culturing a host cell capable of producing glutamine transaminase zymogen under conditions conducive to the production of glutamine transaminase zymogen; (b) Adding the glutamine transaminase activating protease of the present invention to the culture in step (a) to convert the glutamine transaminase zymogen into glutamine transaminase; and (c) Optionally recovering the resulting glutamine transaminase.

Images