Saccharomyces cerevisiae for producing rare ginsenoside by utilizing seaweed biomass as well as construction method and application of saccharomyces cerevisiae

Abstract

The invention belongs to the technical field of genetic engineering, and discloses saccharomyces cerevisiae for producing rare ginsenoside by utilizing seaweed biomass as well as a construction method and application of the saccharomyces cerevisiae. The saccharomyces cerevisiae has the following characteristics: overexpression agarase, neoagarobiose hydrolase, hydroxymethyl glutaryl coenzyme A reductase, isopentenyl diphosphate delta isomerase, dammarendiol synthase, protopanoxadiol synthase, cytochrome P450 reductase, protopanaxatriol synthase and glycosyl transferase. According to the invention, seaweed biomass enzymolysis and rare ginsenoside fermentation are combined, so that wild yeast is endowed with the capability of degrading seaweed biomass, which does not exist originally; the overexpression of tHMG1 and IDI1 effectively increases the yield of squalene and downstream terpenoids (rare ginsenoside Rh1). The Saccharomyces cerevisiae can effectively utilize seaweed biomass to obtain squalene and rare ginsenoside Rh1, does not have the characteristics of simplicity, economy and eco-friendliness, can convert cheap biomass into products with high added value, and provides a way for developing marine biological economy.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and particularly relates to a brewer's yeast for producing rare ginsenosides using seaweed biomass, and a construction method and application thereof. Background Art

[0002] In recent years, with the breakthrough development of gene editing technology, research on constructing microbial cell factories based on metabolic engineering strategies to synthesize high-value-added biochemicals has attracted much attention. Ginsenosides, the main active components of ginseng, are a class of tetracyclic triterpenoid saponins with significant pharmacological activity. Their anticancer, antioxidant, and anti-inflammatory properties have been widely demonstrated. Dammarane-type ginsenosides can be divided into two main categories based on their aglycone structure: protopanaxadiol (PPD) and protopanaxatriol (PPT). PPD is formed through glycosylation at the C3-OH and / or C20-OH sites, while PPT is formed through glycosylation at the C6-OH and / or C20-OH sites. However, the content of ginsenosides in natural Panax plants is extremely low, and dammarenediol (DM) glycosides are virtually impossible to isolate from Panax plants. To address these limitations, the construction of microbial cell factories based on metabolic engineering strategies to synthesize rare ginsenosides is considered the most promising solution. Compared to plant extraction, chemical synthesis, and enzymatic methods, synthetic biology is a more environmentally friendly and efficient way to obtain active compounds. Saccharomyces cerevisiae, with its GRAS safety certification, mature genetic manipulation system, and large-scale fermentation advantages, is an ideal biosynthetic platform.

[0003] Current research generally uses glucose as the main carbon source for chassis cells, but this has significant limitations. First, the glucose production model based on starch hydrolysis is unsustainable and involves the competition between arable land resources and food security. In addition, as a Crabtree-positive strain, Saccharomyces cerevisiae is prone to triggering an "overflow effect" during glucose metabolism, leading to the accumulation of ethanol byproducts and imbalance in energy metabolism. Central carbon metabolism has a strict and complex regulatory mechanism, which means that eliminating the Crabtree effect through metabolic engineering is extremely challenging. In this context, the development of new alternative carbon sources provides a new perspective for solving the above problems.

[0004] Marine biomass resources have attracted considerable attention due to their ecological advantages. Marine ecosystems cover 71% of the Earth's surface and hold over 85% of global biomass reserves. Compared to first-generation (starch, wheat) and second-generation (lignocellulose) biomass, third-generation marine biomass (macroalgae) offers the advantage of not competing with humans for food or land. They exhibit rapid growth, high photosynthetic efficiency, require no fertilization, and have low lignin content. Red algae are generally high in carbohydrates (61-67 wt%), primarily composed of agar polysaccharide complexes. Agar is a linear polysaccharide composed of alternating galactose and 3,6-anhydrogalactose linked by β-1,4- and α-1,3-glycosidic bonds. Compared to the unfavorable metabolism of fermentable carbon sources such as glucose, which hinders terpenoid synthesis and requires complex remodeling of central carbon metabolism, galactose as a carbon source effectively maintains mitochondrial integrity, thereby minimizing the rigid flux of ethanol and ensuring the high energy consumption and cofactor balance required for the biosynthesis of the rare ginsenoside Rh1. Marine biomass is a cheap and abundant source, and increasing its utilization would open up a new path for its high-value utilization. However, Saccharomyces cerevisiae lacks the enzyme system to degrade seaweed polysaccharides and cannot directly utilize red algae biomass. Summary of the Invention

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a brewer's yeast for producing rare ginsenosides using seaweed biomass.

[0006] Another object of the present invention is to provide a method for constructing the above-mentioned Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass.

[0007] Another object of the present invention is to provide the use of the above-mentioned Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass.

[0008] The purpose of the present invention is achieved through the following technical solution: a brewer's yeast that produces rare ginsenosides using seaweed biomass has the following characteristics:

[0009] (1) Overexpression of agarase and neoagarobiohydrolase;

[0010] (2) overexpression of hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase;

[0011] (3) Overexpression of dammarenediol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxadiol synthase, and glycosyltransferase.

[0012] The agarase is preferably at least one of an agarase derived from Pseudoalteromonas, an agarase derived from Aquimarina agarilytica, and an agarase derived from Persicobacter; preferably an agarase derived from Aquimarina agarilytica.

[0013] The nucleotide sequence of the gene encoding the agarase from Pseudoalteromonas sp. is preferably as shown in SEQ ID NO.2.

[0014] The nucleotide sequence of the gene encoding the agarase derived from Corynebacterium agarolyticum is preferably as shown in SEQ ID NO.3.

[0015] The nucleotide sequence of the gene encoding the agarase from A. persica is preferably as shown in SEQ ID NO.4.

[0016] The neoagaranbiohydrolase is preferably at least one of a neoagaranbiohydrolase derived from Aquimarina agarilytica and a neoagaranbiohydrolase derived from Cellvibrio; preferably, the neoagaranbiohydrolase is derived from Cellvibrio.

[0017] The nucleotide sequence of the gene encoding the novel agarobiohydrolase derived from Corynebacterium agarolyticum is preferably as shown in SEQ ID NO.5.

[0018] The nucleotide sequence of the gene encoding the novel agarobiohydrolase from Vibrio cellulosa is preferably as shown in SEQ ID NO.6.

[0019] The amino acid sequence of the hydroxymethylglutaryl-CoA reductase is shown in SEQ ID NO.7.

[0020] The nucleotide sequence of the gene encoding hydroxymethylglutaryl-CoA reductase is preferably as shown in SEQ ID NO.8.

[0021] The amino acid sequence of the isopentenyl diphosphate delta isomerase is shown in SEQ ID NO.9.

[0022] The nucleotide sequence of the gene encoding the isopentenyl diphosphate delta isomerase is preferably as shown in SEQ ID NO.10.

[0023] The hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase are preferably integrated at the genomic GAL80 site.

[0024] The dammarene diol synthase preferably has an amino acid sequence as shown in GenBank accession number AB265170.1.

[0025] The nucleotide sequence of the gene encoding dammarene diol synthase is preferably as shown in SEQ ID NO.11.

[0026] The dammarene diol synthase is preferably integrated into the genomic X-3 site.

[0027] The protopanaxadiol synthase preferably has an amino acid sequence as shown in GenBank accession number JN604537.1.

[0028] The nucleotide sequence of the gene encoding the protopanaxadiol synthase is preferably as shown in SEQ ID NO.12.

[0029] The cytochrome P450 reductase preferably has an amino acid sequence as shown in the accession number of GenBank AIC73829.1.

[0030] The nucleotide sequence of the gene encoding cytochrome P450 reductase is preferably as shown in SEQ ID NO.13.

[0031] The protopanaxadiol synthase and the protopanaxadiol synthase are preferably integrated at the genomic XI-3 site.

[0032] The protopanaxatriol synthase preferably has an amino acid sequence as shown in GenBank accession number JX036031.1.

[0033] The nucleotide sequence of the gene encoding the protopanaxatriol synthase is preferably as shown in SEQ ID NO.14.

[0034] The glycosyltransferase is preferably a glycosyltransferase whose amino acid sequence is shown in GenBank accession number A0A0K0PVW1.1.

[0035] The nucleotide sequence of the gene encoding the glycosyltransferase is preferably as shown in SEQ ID NO.15.

[0036] The protopanaxatriol synthase and the glycosyltransferase are preferably integrated into the genomic LPP1 site.

[0037] The starting strain of Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass is preferably a Saccharomyces cerevisiae CEN PK series strain; more preferably a Saccharomyces cerevisiae CEN.PK2-1D strain.

[0038] The seaweed biomass is algae polysaccharide, including red algae polysaccharide, green algae polysaccharide, brown algae polysaccharide and blue algae polysaccharide; more preferably, it is red algae polysaccharide.

[0039] The method for constructing Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass comprises the following steps:

[0040] 1) Construction of recombinant vectors expressing agarase and neoagarobiohydrolase;

[0041] 2) Construction of Cas9-sgRNA plasmids: specifically, construction of Cas9-sgRNA plasmids targeting the GAL80 site, Cas9-sgRNA plasmids targeting the X-3 site, Cas9-sgRNA plasmids targeting the XI-3 site, and Cas9-sgRNA plasmids targeting the LPP1 site;

[0042] 3) Constructing donor fragments: specifically, hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase gene donor fragments, dammarenediol synthase gene donor fragments, protopanaxadiol synthase and cytochrome P450 reductase gene donor fragments, and protopanaxadiol synthase and glycosyltransferase gene donor fragments;

[0043] 4) Gene Editing: Transform the Cas9-sgRNA plasmid obtained in step 2) and the donor fragment obtained in step 3) into a starting strain of Saccharomyces cerevisiae, and screen to obtain a recombinant strain overexpressing hydroxymethylglutaryl-CoA reductase, isopentenyl diphosphate delta isomerase, dammarenediol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxadiol synthase, and glycosyltransferase;

[0044] 5) Construction of Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass: The recombinant vector obtained in step 1) is transferred into the recombinant strain obtained in step 4) to obtain Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass.

[0045] The vector frame of the recombinant vector is preferably a p426 Gal plasmid.

[0046] The recombinant vector also contains a secretory peptide gene.

[0047] The secretory peptide gene is derived from the α-mating factor of Saccharomyces cerevisiae, and its nucleotide sequence is preferably as shown in SEQ ID NO.1.

[0048] The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the GAL80 site is as follows: ACGATAGTTGCAGTATGGCG.

[0049] The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the X-3 site is as follows: GACACATTAGTCTCGTATGT.

[0050] The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the XI-3 site is as follows: GTAGAAATCAGACGCACGCT.

[0051] The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the LPP1 site is as follows: ATGAAACTTGAATGTCCGCT.

[0052] The vector framework of the Cas9-sgRNA plasmid is preferably a gene editing vector containing a Cas9 expression gene; more preferably, p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 .

[0053] The p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 It was obtained by inserting the Cas9 protein gene into p426-SNR52p-gRNA.csr-1.Y-SUP4t.

[0054] In the hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase gene donor fragment, hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase are expressed independently; and the structure thereof is preferably terminator-hydroxymethylglutaryl-CoA reductase gene-promoter-isopentenyl diphosphate delta isomerase gene-terminator.

[0055] The terminators are the same or different terminators; preferably different terminators; more preferably T ADH1 terminator and T CYC1 terminator.

[0056] The promoter is a bidirectional promoter, preferably P gal1,10 Promoter.

[0057] The structure of the dammarene diol synthase gene donor fragment is terminator-dammarene diol synthase gene-promoter.

[0058] The terminator is preferably T ADH1 terminator.

[0059] The promoter is preferably P gal1,10 Promoter.

[0060] In the protopanaxadiol synthase and cytochrome P450 reductase gene donor fragments, protopanaxadiol synthase and cytochrome P450 reductase are expressed independently; their structure is preferably promoter-protopanaxadiol synthase gene-terminator-promoter-cytochrome P450 reductase gene-terminator.

[0061] The terminators are the same or different terminators; preferably different terminators; more preferably T ALT1 terminator and T CYC1 terminator.

[0062] The promoters are the same or different terminators; preferably P gal1,10 Promoter and P gal7 Promoter.

[0063] In the protopanaxatriol synthase and glycosyltransferase gene donor fragments, protopanaxatriol synthase and glycosyltransferase are expressed independently; the structure is preferably terminator-protopanaxatriol synthase gene-promoter-glycosyltransferase gene-terminator.

[0064] The terminators are the same or different terminators; preferably different terminators; more preferably T ADH1 terminator and T ALT1 terminator.

[0065] The promoter is a bidirectional promoter, preferably P gal1,10 Promoter.

[0066] The Cas9-sgRNA plasmid described in step 4) and the donor fragment are mixed at a mass ratio of 1:2.

[0067] The gene editing described in step 4) can be a one-time editing or a step-by-step editing.

[0068] The step-by-step editing is editing according to the donor fragments individually or in combination.

[0069] The screening step in step 4) includes culturing transformants using uracil YNB auxotrophic screening plate medium, colony PCR, negative screening using solid YPD plates containing 5-fluoroorotic acid, and colony PCR.

[0070] The use of the above-mentioned brewer's yeast for producing rare ginsenosides using seaweed biomass in the production of squalene and / or rare ginsenosides preferably comprises the following steps: fermenting and culturing the above-mentioned brewer's yeast for producing rare ginsenosides using seaweed biomass in a culture medium containing seaweed biomass to obtain squalene and / or rare ginsenosides.

[0071] The composition of the culture medium is preferably as follows: 10 g / L glucose, 20-40 g / L seaweed biomass, 0.001-0.01 M hydrochloric acid, pH 5.5-6.5; more preferably as follows: 10 g / L glucose, 25 g / L seaweed biomass, 0.005 M hydrochloric acid, pH 6.0.

[0072] The fermentation culture conditions are preferably cultured at 28-32°C for at least 48 hours; more preferably cultured at 30°C for at least 96-144 hours.

[0073] The present invention has the following advantages and effects compared to the prior art:

[0074] (1) The present invention obtains a combination of agarase and neoagarobiohydrolase that is better at decomposing red algae polysaccharides through screening, which can convert red algae polysaccharides into galactose, and then be used for the preparation of triterpenoid compounds.

[0075] (2) The present invention provides an engineered strain of Saccharomyces cerevisiae. By combining the enzymatic hydrolysis of red algae biomass with the fermentation of rare ginsenosides, the engineered strain achieves simultaneous enzymatic hydrolysis and fermentation. This not only imparts the wild-type yeast with the ability to degrade red algae polysaccharides, which it does not originally possess, but also overcomes the feedback inhibition of the enzymatic hydrolysis process, greatly simplifying the steps and reducing production costs. The effect is also significantly better than the physical mixing treatment of in vitro enzymes. In addition, the present invention also discovered that the two enzymes tHMG1 and IDI1 can enhance the yeast chassis MVA pathway and balance IPP / DMAPP, thereby increasing the production of squalene and downstream terpenes (rare ginsenoside Rh1).

[0076] (3) By optimizing the fermentation system (fermentation medium), the present invention further improves the conversion of seaweed polysaccharides into triterpenoid compounds, effectively resolving the current dilemma of relying on terrestrial plants as raw materials for fermentation carbon sources, which leads to competition for food and land with humans. This expands the development of avenues for utilizing abundant and inexpensive marine biomass to produce energy raw materials. Furthermore, the synthesis is not limited by raw material costs and supply sources, making it easier to scale up industrially.

[0077] (4) The metabolic platform constructed by this invention has the potential to expand substrate universality. By modularly replacing hydrolase components, it is compatible with polysaccharide resources such as brown algae and green algae, providing a standardized technical framework for the development of a new generation of biorefining systems. This breakthrough makes it possible for a single strain to simultaneously utilize terrestrial and marine biomass, promoting the upgrade of the traditional "single feedstock - single product" model to a "multiple feedstock - multiple products" paradigm. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 It is a flow chart of the present invention.

[0079] Figure 2 This is a diagram of the structure of the p426-AqAga-agaNash plasmid.

[0080] Figure 3 These are the screening results of engineered strains that degrade red algae polysaccharides; A is a flat-plate hydrolysis photo, and B is the activity test results of agarase and neoagarobiohydrolase.

[0081] Figure 4 Figure 1 is an HPLC test result diagram of hydrochloric acid hydrolysis of red algae polysaccharide culture medium (A) and a photograph of the culture medium status at different fermentation times of the engineered strain Sq-Ag5 in red algae polysaccharide culture medium (B).

[0082] Figure 5 This is the squalene production result obtained by fermenting the engineered strain Sq-Ag5 in a culture medium containing different concentrations of glucose and red algae polysaccharide.

[0083] Figure 6 Schematic diagram of the engineered strain Rh1-Ag overexpressing gene.

[0084] Figure 7 This is the result of fermentation of engineered strains Rh1-Ag and Rh1-con using culture medium containing red algae polysaccharide; among them, A is the growth amount, B is the reducing sugar content, and C is the yield of rare ginsenoside Rh1.

[0085] Figure 8 This is an HPLC chart for detecting the production of rare ginsenoside Rh1. DETAILED DESCRIPTION

[0086] The present invention is further described in detail below through specific examples.

[0087] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0088] The experimental methods in the following examples, where specific conditions are not specified, were generally performed under conventional conditions or the conditions recommended by the manufacturers. The materials and reagents used in these examples were commercially available unless otherwise specified.

[0089] The specific flow chart of the present invention is as follows Figure 1 shown.

[0090] The primers used in the present invention are shown in Tables 1 to 3.

[0091] Table 1 Primers used to construct recombinant vectors expressing agarase and neoagarobiohydrolase

[0092] Primer Sequence (5’-3’) α-factor mutant-1 gaatattccctcaaaaAACAAAATGAGATTTCCATCTATTTTTACTGC α-factor mutant-2 agaggtcaatttTTTTGGTTCACCTTCTTCTCTTTTATCC α-factor mutant-3 aggagaaaaaactataAACAAAATGAGATTTCCATCTATTTTTACTGC α-factor mutant-4 caagtcgcccatTTTTGGTTCACCTTCTTCTCTTTTATCC α-factor mutant-5 gtgttttttcatTTTTGGTTCACCTTCTTCTCTTTTATCCA α-factor mutant-6 gagtaaattcttTTTTGGTTCACCTTCTTCTCTTTTATCCA α-factor mutant-7 gggcattttcatTTTTGGTTCACCTTCTTCTCTTTTATCC AqAga-F-1 ggtgaaccaaaaAAATTGACCTCTACTAATTTATTCAAGTGTTTG AqAga-R-2 ttacatgaggatccTCACTTAGCGGATCTCAATTCAAAT Aga3463-F-1 aggtgaaccaaaaATGAAAAAACACGCACTAGCAG Aga3463-R-2 acatgaggatccTTATTTTGATACTGCAATCTTGACCGT PdAgaC-F-1 ggtgaaccaaaaATGAAAATGCCCTTGACCTATTTATG PdAgaC-R-2 acatgaggatccTTATTGGAGGATGATTTTTTTTGTCTTTTGC agaNash-F-1 gtgaaccaaaaATGGGCGACTTGCCAGAA agaNash-R-2 aaggactcccgtacgTCAGGATGCAACGTTTTGGAAAGTA NH852-F-1 ggtgaaccaaaaAAGAATTTACTCCAATTATTGAGCGTTTT NH852-R-2 aaggactcccgtacgTCATTGCTTAACGAACAAAGTACTC Plasmid backbone fragment 1-1 ctcattttgttTATAGTTTTTTCTCCTTGACGTTAAAGTATAG Plasmid backbone fragment 1-2 ctcattttgttTTTTGAGGGAATATTCAACTGTTTTTTTT Plasmid backbone fragment 2-1 atccgctaagtgaGGATCCTCATGTAATTAGTTATGTCACG Plasmid backbone fragment 2-2 gttgcatcctgaCGTACGGGGAGTCCTTTAATTAACA Plasmid backbone fragment 2-3 gtatcaaaataaGGATCCTCATGTAATTAGTTATGTCACG Plasmid backbone fragment 2-4 gttaagcaatgaCGTACGGGGAGTCCTTTAATTAACA Plasmid backbone fragment 2-5 catcctccaataaGGATCCTCATGTAATTAGTTATGTCACG

[0093] Table 2 Primers used to construct engineered strains overexpressing tHMG1 and IDI1

[0094]

[0095]

[0096] Table 3 Primers used to construct strains overexpressing PgDDS, CYP716A47, PgCPR1, CYP716A53v2, and UGTPg100

[0097]

[0098]

[0099] The culture medium used in the present invention is as follows (sterilization and sterilization of the culture medium can be performed according to conventional procedures):

[0100] The composition of the uracil YNB auxotrophic plate is as follows: 6.7 g / L amino-free yeast nitrogen base, 20 g / L glucose, and depending on the Saccharomyces cerevisiae genotype, 50 mg / L histidine, 50 mg / L tryptophan, and 50 mg / L leucine are added; YNB solid medium can be obtained by adding 1.5% agar powder.

[0101] The composition of YPD liquid culture medium is as follows: yeast powder 10 g / L, peptone 20 g / L, glucose 20 g / L, and the solvent is deionized water.

[0102] Lugol's iodine plate: Add 5 mL of Lugol's iodine solution to the uracil YNB auxotrophic plate and shake well.

[0103] Example 1: Construction of an engineered strain using red algae polysaccharides

[0104] (1) Construction of recombinant vectors expressing agarase and neoagarobiohydrolase

[0105] The gene for secreting the peptide in this example is derived from the α-mating factor (α-factor mutant) of Saccharomyces cerevisiae, whose nucleotide sequence is shown in SEQ ID NO.1. Its main function is to regulate the extracellular expression of downstream proteins. The gene cluster sequence contains a Kozak sequence, which provides an important signal and binding site for ribosome recognition of the start codon, which can significantly enhance the efficiency of translation initiation. The agarase Aga3463 gene comes from the genome of strain Pseudoalteromonas sp.NJ21 (the NCBI sequence number of the gene is KF700697), the agarase AqAga gene comes from the genome of strain Aquimarina agarilyticaZC1 (the NCBI sequence number of the gene is WP_010180283), and the agarase PdAgaC gene comes from the genome of strain Persicobacter sp.CCB-QB2 (the NCBI sequence number of the gene is WP_053404800); the neoagaronobiohydrolase agaNash gene comes from the genome of strain Cellvibrio sp.OA-2007 (the NCBI sequence number of the gene is WP_010182780), and the neoagaronobiohydrolase NH852 gene comes from the genome of strain Aquimarina agarilytica ZC1 (the NCBI sequence number of the gene is AB911560). Three agarases from different sources and two new agarobiohydrolases from different sources were screened and codon optimized, and six plasmids were constructed by permutation and combination.

[0106] The Saccharomyces cerevisiae expression plasmid was constructed using the p426 Gal backbone vector (2μori, pBR322 ori, and F1 ori), in which URA3 is a selection marker, ampicillin (Amp) is a resistance tag, and the strong promoter P GAL7 and promoter P GAL1 The plasmids were constructed using the Gibson assembly method. The specific operations were performed in accordance with the instructions of the Sangon Ready-to-Use Seamless Cloning Kit (Cat. No. B632219-0020). The method is as follows: design specific primers containing homology arms (see Table 1, the lowercase letters in the primers are homology arms), use high-fidelity enzymes The target fragment was amplified by polymerase chain reaction (PCR) using Max DNA polymerase. The PCR reaction system was as follows: 0.5 μL of DNA template (50-200 ng), 0.4 μL of each forward and reverse primer (10 μM), and 10 μL of high-fidelity enzyme reaction buffer, supplemented with ddH₂O to 20 μL. The PCR reaction procedure was as follows: 30 cycles of initial denaturation at 98°C for 3 minutes, 98°C for 10 seconds, 58°C for 5 seconds, and 72°C for 0.5-3 minutes; followed by a final extension at 72°C for 10 minutes. The amplified target fragment was detected by agarose gel electrophoresis and purified using the SanPrep column-based PCR product purification kit (Cat. No. B518141-0100). The gene concentration of all DNA samples was calculated using a K5600C microspectrophotometer. The PCR-linearized plasmid and the target fragment were mixed and added to the Gibson assembly reaction solution. The reaction was ligated at 50°C for 45 minutes. The vector was transformed into Escherichia coli DH5α strain, and positive single clones were screened using the ampicillin resistance of the plasmid. The successful connection was verified by colony PCR and sequenced to obtain the agarase exogenous expression vector.

[0107] The signal peptide widely used in yeast, namely the α-factor leader protein, is used to guide secretion. Using the genome of Saccharomyces cerevisiae CENPK2-1D (purchased from Shanghai Lianzu Biotechnology Co., Ltd.) as a template, α-factor mutant-1 and α-factor mutant-2 as primers, the α-factor mutant-AqAga fragment was obtained; using the PUC57-AqAga plasmid synthesized by Sangon (the nucleotide sequence of AqAga is shown in SEQ ID NO.3) as a template, AqAga-F-1 and AqAga-R-2 as primers, the AqAga fragment was obtained; using α-factor mutant-3 and α-factor mutant-4 as primers, the α-factormutant-agaNash fragment was obtained; using the PUC57-agaNash plasmid synthesized by Sangon (the nucleotide sequence of agaNash is shown in SEQ ID NO.6) as a template, agaNash-F-1 and agaNash-R-2 as primers to obtain the agaNash fragment; using the p426Gal plasmid as a template, plasmid backbone fragment 1-1 and plasmid backbone fragment 1-2 as primers to obtain backbone fragment A; using the p426Gal plasmid as a template, plasmid backbone fragment 2-1 and plasmid backbone fragment 2-2 as primers to obtain backbone fragment B. The α-factor mutant-AqAga fragment, AqAga fragment, α-factor mutant-agaNash fragment, agaNash fragment, backbone fragment A and backbone fragment B were mixed in a molar ratio of 1:1:1:1:1:1, and the above operation was performed to obtain the following: Figure 2 The p426-AqAga-agaNash plasmid is shown.

[0108] Using the Saccharomyces cerevisiae CEN PK2-1D genome as a template and α-factor mutant-1 and α-factormutant-5 as primers, the α-factor mutant-Aga3463 fragment was obtained; using the PUC57-Aga3463 plasmid synthesized by Sangon (the nucleotide sequence of Aga3463 is shown in SEQ ID NO. 2) as a template and Aga3463-F-1 and Aga3463-R-2 as primers, the Aga3463 fragment was obtained; using α-factor mutant-3 and α-factor mutant-6 as primers, the α-factor mutant-NH852 fragment was obtained; using the PUC57-NH852 plasmid synthesized by Sangon (the nucleotide sequence of NH852 is shown in SEQ ID NO.5) as a template, NH852-F-1 and NH852-R-2 as primers to obtain the NH852 fragment; using the p426Gal plasmid as a template, plasmid backbone fragment II-3 and plasmid backbone fragment II-4 as primers to obtain backbone fragment C. The α-factor mutant-Aga3463 fragment, Aga3463 fragment, α-factor mutant-NH852 fragment, NH852 fragment, backbone fragment A, and backbone fragment C were mixed in a molar ratio of 1:1:1:1:1:1, and the above procedures were followed to obtain the P426-Aga3463-NH852 plasmid.

[0109] The α-factor mutant-AqAga fragment, AqAga fragment, α-factor mutant-NH852 fragment, NH852 fragment, backbone fragment A and backbone fragment B were mixed in a molar ratio of 1:1:1:1:1:1 and the above operation was performed to obtain the P426-AqAga-NH852 plasmid.

[0110] Using the Saccharomyces cerevisiae CEN PK2-1D genome as a template and α-factor mutant-1 and α-factor mutant-7 as primers, the α-factor mutant-PdAgaC fragment was obtained. Using the PUC57-PdAgaC plasmid synthesized by Sangon (the nucleotide sequence of PdAgaC is shown in SEQ ID NO. 4) as a template and PdAgaC-F-1 and PdAgaC-R-2 as primers, the PdAgaC fragment was obtained. Using the p426 Gal plasmid as a template and plasmid backbone fragment II-5 and plasmid backbone fragment II-4 as primers, backbone fragment D was obtained. The α-factor mutant-PdAgaC fragment, PdAgaC fragment, α-factor mutant-NH852 fragment, NH852 fragment, backbone fragment A, and backbone fragment D were mixed in a molar ratio of 1:1:1:1:1:1, and the p426-PdAgaC-NH852 plasmid was obtained according to the above procedures.

[0111] Using the p426 Gal plasmid as a template and plasmid backbone fragment II-3 and plasmid backbone fragment II-2 as primers, backbone fragment E was obtained. The α-factor mutant-Aga3463 fragment, Aga3463 fragment, α-factor mutant-agaNash fragment, agaNash fragment, backbone fragment A, and backbone fragment E were mixed at a molar ratio of 1:1:1:1:1:1, and the above operation was performed to obtain the p426-Aga3463-agaNash plasmid.

[0112] Using the p426 Gal plasmid as a template and plasmid backbone fragment II-5 and plasmid backbone fragment II-2 as primers, backbone fragment F was obtained. The α-factor mutant-PdAgaC fragment, PdAgaC fragment, α-factor mutant-agaNash fragment, agaNash fragment, backbone fragment A, and backbone fragment F were mixed at a molar ratio of 1:1:1:1:1:1, and the above operation was performed to obtain the p426-PdAgaC-agaNash plasmid.

[0113] (2) Construction of an engineered strain Sq-0 overexpressing tHMG1 and IDI1

[0114] Wild-type S. cerevisiae CEN PK2-1D was engineered to integrate tHMG1 (truncated hydroxymethylglutaryl-CoA reductase, amino acid sequence shown in SEQ ID NO. 7) and IDI1 (isopentenyl diphosphate delta isomerase, amino acid sequence shown in SEQ ID NO. 9) into the genomic GAL80 locus, generating the engineered strain S. cerevisiae Sq-0. The specific construction process is as follows:

[0115] A. Selection of genomic GAL80 target and construction of Cas9-sgRNA plasmid

[0116] The wild-type S. cerevisiae CEN PK2-1D genome was queried to locate the GAL80 gene open reading frame (ORF). When using the CRISP-Cas9 system for S. cerevisiae gene editing, the specific 20nt sequence of the sgRNA was screened using the online design tool CHOPCHOP (https: / / chopchop.cbu.uib.no / ). A 20nt sgRNA target sequence (ACGATAGTTGCAGTATGGCG) with high efficiency and no off-target was selected. When constructing the Cas9-sgRNA plasmid, the designed 20nt sequence was used as the homology arm, and primers GAL80-sgRNA-F and GAL80-sgRNA-R were used to target the p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 PCR linearization amplification was performed, and after recovering the 10251bp fragment, 100ng of linearized plasmid was transformed into E. coli DH5α competent cells. To ensure the correct construction of the plasmid, three positive transformants were randomly selected for culture, and the plasmid was extracted and sent to Shanghai Bioengineering Co., Ltd. for sequencing verification, resulting in the Cas9-sgRNA plasmid targeting the GAL80 site. p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 The Cas9 protein gene was inserted into p426-SNR52p-gRNA.csr-1.Y-SUP4t (Cat. No. 68060, Baosai Bio) and the specific operation was as follows: p426-SNR52p-gRNA.csr-1.Y-SUP4t was used as a template, sg-F and sg-R were used as primers to obtain the sgRNA fragment; Addgene's SpCas9 plasmid was used as a template, Cas9-F and Cas-R were used as primers to obtain the Cas9 fragment; the sgRNA fragment and Cas9 fragment F were mixed in a molar ratio of 1:1, and the p426-PTEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 plasmid.

[0117] B. Construction of donor DNA integration fragment

[0118] tHMG1 and IDI1 were introduced into the homology arms of the GAL80 locus through primers, amplified and assembled by PCR, and then purified into high-concentration T using a kit. ADH1 -IDI1-P gal1,10 -tHMG1-T CYC1 Linear donor DNA. The specific operation is as follows: using the genome of Saccharomyces cerevisiae CEN PK2-1D as a template, tHMG1-F and tHMG1-R as primers, the tHMG1 gene fragment (nucleotide sequence shown in SEQ ID NO.8) was obtained; at the same time, IDI1-F and IDI1-R were used as primers to obtain the IDI1 gene fragment (nucleotide sequence shown in SEQ ID NO.10). Using the pGAL1,10-MCS-His-MCS-Flag-URA plasmid (Biyuntian) as a template, P gal1,10 -F and P gal1,10 -R is a primer to obtain the bidirectional promoter P gal1,10 ; GAL80-T ADH1 -F and GAL80-T ADH1 -R is the primer, which yields the terminator T ADH1 ; GAL80-T CYC1 -F and GAL80-T CYC1 -R is the primer, which yields the terminator T CYC1 tHMG1 gene fragment, IDI1 gene fragment, bidirectional promoter P gal1,10 , terminator T ADH1 and terminator T CYC1 Mix them in a molar ratio of 1:1:1:1:1, add Gibson assembly reaction solution, and connect at 50℃ for 45min. Transform the vector into Escherichia coli DH5α strain, screen positive clones using the ampicillin resistance of the plasmid, verify the successful connection by colony PCR and sequence verification, and clone the correct vector using primers GAL80-T ADH1 -F and GAL80-T CYC1 -R was amplified by PCR, and the gene fragment was purified and recovered using the SanPrep column PCR product purification kit to obtain the donor DNA.

[0119] C. Yeast gene editing

[0120] Competent Saccharomyces cerevisiae CEN PK2-1D cells were prepared and edited according to the ZYMO Frozen-EZ Yeast Transformation II Kit instructions. Approximately 500 ng of the Cas9-sgRNA plasmid targeting the GAL80 locus and 1 μg of linear donor DNA were added. The transformation system was directly plated onto uracil YNB auxotrophic selection plates and incubated at 30°C for 4–5 days to form single colonies. Initial screening of yeast transformants was performed using colony PCR: a single colony was picked from the uracil YNB auxotrophic plate and placed in a tube containing PCR mixture. Integration of the target gene into the yeast genome was verified using GAL80 site verification primers F and R. To ensure the use of the uracil URA3 selection tag in subsequent experiments, the tag integrated into the gene was discarded. The specific operation is as follows: the transformants with the correct bands in the above primary screening were inoculated into YPD liquid culture medium, cultured in a shaker at 220 rpm and 30°C for 16 hours, and then spread onto solid YPD plates containing 1 mg / mL 5-fluoroorotic acid for negative screening. The colonies grown on the plates were once again verified by PCR. Verification of the correct strain indicated that the label had been discarded, and the engineered strain S. cerevisiae Sq-0 (genotype: △GAL80::tHMG1+IDI1) was obtained.

[0121] (3) Screening of engineered strains that efficiently degrade red algae polysaccharides

[0122] 1) The six plasmids obtained in step (1) (as shown in Table 4) were introduced into the Saccharomyces cerevisiae Sq-0 strain by the lithium acetate transformation method to obtain six engineered strains, namely, engineered strain Sq-Ag1, engineered strain Sq-Ag2, engineered strain Sq-Ag3, engineered strain Sq-Ag4, engineered strain Sq-Ag5, and engineered strain Sq-Ag6. The specific operation was as follows: a single clone of the Sq-0 strain was picked from the solid plate and placed in YPD liquid medium, cultured at 30°C and 220 rpm for 16 h, and 500 μL of the bacterial solution was centrifuged at 8000 rpm to remove the supernatant. Add 3 μL of 10 mg / mL salmon sperm ssDNA (pre-denatured in boiling water for 5 minutes and immediately placed on ice), 100 μL of conversion buffer (1 mL of conversion buffer contains: 800 μL 50% PEG-3350, 200 μL 2 mol / L LiAc, 7.5 μL β-mercaptoethanol, balance deionized water), and 0.1-1 μg of plasmid. Mix thoroughly, incubate at 37°C in a water bath for 30 minutes, centrifuge at 8000 rpm for 3 minutes, and remove the supernatant. Finally, resuspend the cells in 500 μL of sterile water, spread 80 μL onto uracil YNB auxotrophic plates, and incubate at 30°C for 3-5 days.

[0123] Table 4 Genotypes of 6 agarase-engineered strains

[0124]

[0125] 2) Six strains (i.e., Sq-Ag1, Sq-Ag2, Sq-Ag3, Sq-Ag4, Sq-Ag5, and Sq-Ag6) were selected and inoculated into 5 mL of uracil YNB nutrient-deficient liquid culture medium. Culture was performed at 30°C and 220 rpm for 16 to 24 hours. 2 μL of each bacterial solution was dropped onto a Lugol's iodine plate and cultured for 48 hours. The presence of a transparent hydrolysis zone was observed. The undegraded portion was stained dark by Lugol's iodine. The results were as follows: Figure 3 As shown in A, a large transparent hydrolysis zone was formed around the colonies, indicating that all six strains had the ability to secrete agarase extracellularly.

[0126] 3) Pick a single colony of Saccharomyces cerevisiae from a fresh plate (no more than one month old) and inoculate it onto a 3 mL uracil YNB nutrient-deficient plate. Incubate overnight at 30°C and 220 rpm to ensure that the bacteria enter a stable logarithmic growth phase. At this time, a first-level seed solution is obtained. The activated seed solution of the six engineered strains is transferred to YPDA medium at a 1% inoculation rate. After 96 hours of culture, the fermentation liquid is obtained and the enzyme activity of agarase and neoagaronobiohydrolase is determined. The composition of the YPDA medium is as follows: 10 g / L yeast powder, 20 g / L peptone, 25 g / L red algae polysaccharide (Cat. No.: 214010, BD BactoTM, USA), 10 g / L glucose, and the solvent is deionized water.

[0127] A. Determination of agarase activity

[0128] 200 μL of fermentation broth was placed in a colorimetric tube containing 800 μL of Tris-HCl buffer (pH 8.0) containing 0.3% w / v agar. After shaking at 40°C for 20 minutes, 1 mL of DNS was added to a boiling water bath for color development for 5 minutes. The solution was cooled and diluted to 10 mL with distilled water and shaken. 200 μL of the solution was taken and the absorbance was measured at 540 nm. The inactivated enzyme solution was used as a control. According to the standard curve (Y = 1.391X - 0.07451, R 2 =0.9974) to calculate the reducing sugar content in the fermentation broth. The enzyme activity unit (U) is defined as the amount of enzyme required to convert 1 μg of reducing sugar in 1 minute under the above conditions.

[0129] B. Determination of Neoagabiohydrolase Activity

[0130] In order to detect the new agarobiohydrolase, a galactose detection kit (Abcam) was used. First, the galactose standard in the kit was diluted to 1 nmol / μL: 10 μL of galactose standard with a concentration of 100 nmol / μL was taken and added to 990 μL of galactose detection buffer and mixed thoroughly. 0, 2, 4, 6, 8, and 10 μL of the diluted standard solution were added to a series of wells respectively. The volume was filled to 50 μL per well with galactose detection buffer, and finally 0, 2, 4, 6, 8, and 10 nmol of galactose standard were obtained per well. The horizontal axis is the galactose concentration (nmol) and the vertical axis is the absorbance value (OD 570 nm ) draw the galactose standard curve. Then according to the standard curve (Y = 0.07252X + 0.03044, R 2 =0.9945) to calculate the galactose content in the fermentation broth. To 25 μL of fermentation broth (using inactivated enzyme solution as a control), add 25 μL of 2 mM neoagarobiose, 44 μL of galactose assay buffer, 2 μL of galactose probe, 2 μL of galactose enzyme mix, and 2 μL of HRP for a total reaction volume of 100 μL. Incubate the reaction at 37°C for 40 minutes. Then, obtain the absorbance at a wavelength of 570 nm. Enzyme activity units (U) are defined as the amount of enzyme required to convert 1 μmol of galactose per minute.

[0131] The results of enzyme activity determination were as follows Figure 3 As shown in Figure B, compared with the blank strain and the strain containing the empty vector, the total enzyme activity of the engineered strain Sq-Ag5 reached the highest, and the enzyme activities of agarase AqAga and neoagaronobiose hydrolase agaNash reached 31.79 U / mL and 49.14 mU / mL, respectively. This shows that it can efficiently catalyze the two key steps of agar degradation (agar depolymerization + neoagaronobiose cleavage), providing a good foundation for subsequent fermentation applications. Therefore, this strain was used in subsequent preliminary fermentation experiments.

[0132] Example 2: Fermentation of squalene by engineered strain Sq-Ag5 using red algae polysaccharide as substrate

[0133] Since the pathway for the de novo synthesis of rare ginsenoside Rh1 from glucose involves many genes, a modular analysis method is adopted, which is divided into a squalene synthesis module and a rare ginsenoside Rh1 synthesis module. Squalene (a natural triterpenoid compound) is a key precursor of the rare ginsenoside synthesis pathway and a substance of the yeast endogenous pathway. During the fermentation process, unlike monosaccharides such as glucose and xylose, red algae polysaccharides are viscous. When only agar is used as the sole carbon source in the culture medium, yeast cells cannot grow, and a small amount of glucose needs to be added in the early stage to start microbial growth. This example conducts an orthogonal study on the synthesis of squalene at different low glucose concentrations and red algae polysaccharide concentrations.

[0134] Since red algae polysaccharide will solidify under the fermentation conditions of yeast at 30°C, it is first necessary to explore the specific conditions under which red algae polysaccharide is liquefied under the action of low concentration hydrochloric acid. The liquefaction conditions must meet two goals: to ensure the fluidity of the fermentation medium to facilitate the increase of microbial movement; and to ensure that no monosaccharides are hydrolyzed during the liquefaction pretreatment. In 25mL yeast culture medium (composed of 10g / L glucose and 25g / L red algae polysaccharide), a gradient of hydrochloric acid with a final concentration of 0.001 to 0.01M (respectively 0.001M, 0.002M, 0.003M, 0.004M, 0.005M, 0.006M, 0.007M, 0.008M, 0.009M, 0.01M) was used for treatment at 121°C for 20min. The results showed that extremely low acid concentration (0.005M hydrochloric acid) can open the structure of agar and make it flow, and it will not solidify during the yeast shake flask culture; such as Figure 4 As shown in Figure A, after the yeast culture medium was liquefied with 0.005M hydrochloric acid, no new agarose and monosaccharide were decomposed by HPLC. After the pH value of the culture medium was adjusted to 6.0, it could be used for yeast fermentation experiments. In 25mL yeast culture medium (containing 10g / L glucose and 25g / L red algae polysaccharide), hydrochloric acid with a final concentration of 0.005M was added, and the culture medium was sterilized at high pressure at 121°C for 20 minutes. After cooling, the pH was adjusted to 6.0 to serve as the fermentation medium after liquefaction. The engineered strain Sq-Ag5 was added to the liquefied culture medium at an inoculum rate of 1% (v / v), and after inoculation, the culture medium was cultured in a shaker at 30°C and 220rpm. Figure 4 As shown in Figure B, during the initial fermentation phase (0 h), the middle phase (48 h), and the final phase (120 h), the culture medium gradually transitioned from viscous to clear after yeast decomposition. Initially, the culture medium was turbid, containing incompletely decomposed colloidal matter. During the middle phase, the flocculent material significantly decreased, and the culture medium gradually became clear. At the final phase, the culture medium became transparent yellow, with virtually no insoluble matter.

[0135] Orthogonal fermentation experiments were performed using YPDA liquid culture medium containing glucose at concentrations of 0, 2.5, 5, 7.5, and 10 g / L and red algae polysaccharides at concentrations of 10, 15, 20, 25, 30, and 40 g / L. The primary seed solution was inoculated at a 1% v / v inoculum into a 250 mL shake flask containing 25 mL of YPDA liquid culture medium. Fermentation was carried out at 30°C and 220 rpm for 96 h. The squalene content in the fermentation broth was determined using high-performance liquid chromatography (HPLC) to determine the optimal carbon source composition in the culture medium. To determine squalene accumulation, 0.5 mL of the fermentation broth was added to a crushing tube containing 0.5 g of 0.5 mm glass beads and 1 mL of ethyl acetate. The cells were crushed using a Bioprep-24R instrument and then centrifuged at 10,000 g for 1 min. The upper ethyl acetate layer was filtered through a 0.22 μm filter membrane and analyzed by HPLC. Detection was performed using an LC-16 (Shimadzu Corporation, Japan) equipped with an SPD-16 dual-wavelength UV detector and an Agilent Poroshell 120EC-C18 2.1×100 mm column. The eluent was 100% acetonitrile, the flow rate was 0.5 mL / min, the injection volume was 2 μL, and the detection wavelength was 210 nm. Figure 5 As shown, the engineered strain Sq-Ag5 can achieve step-by-step degradation and saccharification of red algae polysaccharides from 0 to 1. When the red algae polysaccharide concentration is ≤25g / L, squalene production increases with the increase of red algae polysaccharide concentration, but high concentrations of red algae polysaccharides (over 25g / L) begin to inhibit the increase of squalene. The possible reason is that high concentrations of red algae polysaccharides may cause the viscosity of the culture medium to be too high, affecting oxygen transfer or bacterial metabolism. 10g / L glucose and 25g / L red algae polysaccharides can achieve the highest squalene production of 667.02mg / L.

[0136] Example 3: Fermentation production of rare ginsenoside Rh1 using red algae polysaccharide as substrate

[0137] (1) A recombinant yeast strain S. cerevisiae Rh1-con that stably accumulates the rare ginsenoside Rh1

[0138] The engineered strain S.cerevisiae Sq-0 was fermented at 30°C and 220rpm for 96 hours using YPDA medium containing 10g / L glucose and 25g / L red algae polysaccharide according to Example 3. The data at the end of the fermentation showed that the wild-type brewing yeast S.cerevisiae CEN PK2-1D only produced 5.89mg / L squalene, while the engineered strain S.cerevisiae Sq-0 produced as much as 362mg / L squalene. In order to synthesize the rare ginsenoside Rh1, the wild-type brewing yeast S.cerevisiae CEN PK2-1D and S.cerevisiae Sq-0 were used as starting strains. By searching literature and databases, the enzymes of the rare ginsenoside Rh1 heterologous pathway were screened and integrated into the corresponding sites of the above two yeast strains. The construction scheme is as follows: Figure 6 As shown (it is particularly noteworthy that the wild-type S. cerevisiae CEN PK2-1D does not integrate the two enzymes tHMG1 and IDI1). Among them, the GenBank accession number of the gene PgDDS (dammarenediol synthase) is: AB265170.1, the GenBank accession number of the gene CYP716A47 (protopanaxadiol synthase) is: JN604537.1, the GenBank accession number of the gene PgCPR1 (cytochrome P450 reductase) is: AIC73829.1, the GenBank accession number of the gene CYP716A53v2 (protopanaxadiol synthase) is: JX036031.1, and the GenBank accession number of the gene UGTPg100 (glycosyltransferase) is: A0A0K0PVW1.1. All of the above genes have been codon-optimized according to the preference of S. cerevisiae.

[0139] Next, the yeast homologous recombination module was constructed. The expression module PgDDS was integrated at the X-3 locus (chromosome coordinates Chr X: 223616...224744), the expression module genes CYP716A47 and PgCPR1 were integrated at the XI-3 locus (chromosome coordinates Chr XI: 93378...94567), and the expression module genes CYP716A53v2 and UGTPg100 were integrated at the LPP1 locus (SGD number: S000002911). The specific integration method in this example used the CRISPR-Cas9 system to edit selected genomic sites in the Saccharomyces cerevisiae genome. The 20nt sequences of the sgRNAs were designed using the website CHOPCHOP (https: / / chopchop.cbu.uib.no / ). The 20nt sequences for the X-3, XI-3, and LPP1 integration sites were: GACACATTAGTCTCGTATGT, GTAGAAATCAGACGCACGCT, and ATGAAACTTGAATGTCCGCT, respectively. When constructing the Cas9-sgRNA plasmid, the designed 20nt sequence was used as the homology arm, and primers X-3-sgRNA-F and X-3-sgRNA-R, XI-3-sgRNA-F and XI-3-sgRNA-R, LPP1-sgRNA-F and LPP1-sgRNA-R were used to generate the p426-P TEF1 -SpCas9-T CYC1 -P SNR52 -sgRNA-T SUP4 PCR linearization was performed, and fragments of the three loci were recovered. 100 ng of the linearized plasmid was then transformed into competent E. coli DH5α cells. To ensure the correct construction of the plasmid, three positive transformants were randomly selected for culture. The plasmids were extracted and sent to Shanghai Bioengineering for sequencing verification. This resulted in a Cas9-sgRNA plasmid containing sgRNA sequences targeting the X-3, XI-3, and LPP1 loci.

[0140] The gene editing of PgDDS was carried out by introducing the upstream and downstream homology arms of the X-3 site through primers. After PCR amplification and fusion PCR assembly, the kit was used to purify the high-concentration T ADH1 -PgDDS-P gal1,10 The specific operation is as follows: using the PUC57-PgDDS plasmid synthesized by Sangon (the nucleotide sequence of PgDDS is shown in SEQ ID NO.11) as a template, using PgDDS-F and PgDDS-R as primers, the PgDDS fragment was obtained; using the pGAL1,10-MCS-His-MCS-Flag-URA plasmid as a template, using X-3-T ADH1 -F and X-3-TADH1 -R is the primer, which yields the terminator T ADH1 ; X-3-P gal1,10 -F and X-3-P gal1,10 -R is a primer to obtain the bidirectional promoter X-3-P gal1,10 . The bidirectional promoter X-3-P gal1,10 , PgDDS gene fragment and terminator X-3-T ADH1 Mix in a molar ratio of 1:1:1, add Gibson assembly reaction solution, and connect at 50℃ for 45min. Transform the vector into Escherichia coli DH5α strain, screen positive clones using the ampicillin resistance of the plasmid, verify the successful connection by colony PCR and sequence verification, and clone the correct vector using primers X-3-T ADH1 -F and X-3-P gal1,10 -R was amplified by PCR, and the gene fragment was purified and recovered using the SanPrep column PCR product purification kit to obtain the donor DNA.

[0141] Gene editing of CYP716A47 and PgCPR1 was carried out by introducing primers into the upstream and downstream homology arms of the XI-3 site, amplified by PCR and assembled by fusion PCR, and then purified to a high concentration of P using a kit. gal1,10 -CYP716A47-T ALT1 -P gal7 -PgCPR1-T CYC1 Linear donor DNA. The specific operation is as follows: Using the PUC57-CYP716A47 plasmid synthesized by Sangon (the nucleotide sequence of CYP716A47 is shown in SEQ ID NO.12) as a template, CYP716A47-F and CYP716A47-R as primers, the CYP716A47 fragment is obtained. Using the PUC57-PgCPR1 plasmid synthesized by Sangon (the nucleotide sequence of PgCPR1 is shown in SEQ ID NO.13) as a template, PgCPR1-F and PgCPR1-R as primers, the PgCPR1 fragment is obtained. Using the pGAL1,10-MCS-His-MCS-Flag-URA plasmid as a template, XI-3-P gal1,10 -F and XI-3-P gal1,10 -R is a primer to obtain the bidirectional promoter XI-3-P gal1,10 ; Using the Saccharomyces cerevisiae CEN PK2-1D genome as a template, T ALT1 -F and T ALT1 -R is the primer, which yields ALT1 GAA1 Terminator, abbreviated as terminator T ALT1 ; with P gal7 -F and P gal7-R is a primer to obtain the promoter P gal7 ; XI-3-T CYC1 -F and XI-3-T CYC1 -R is the primer, and the terminator XI-3-T is obtained. CYC1 CYP716A47 gene fragment, bidirectional promoter XI-3-P gal1,10 , PgCPR1 gene fragment, terminator T ALT1 and terminator XI-3-T CYC1 Mix them in a molar ratio of 1:1:1:1:1, add Gibson assembly reaction solution, and connect at 50℃ for 45min. Transform the vector into Escherichia coli DH5α strain, screen positive clones using the ampicillin resistance of the plasmid, verify the successful connection by colony PCR and sequence verification, and clone the correct vector using primers XI-3-P gal1,10 -F and XI-3-T CYC1 -R was amplified by PCR, and the gene fragment was purified and recovered using the SanPrep column PCR product purification kit to obtain the donor DNA.

[0142] The gene editing of CYP716A53v2 and UGTPg100 was carried out by introducing the upstream and downstream homology arms of the LPP1 site through primers. After PCR amplification and fusion PCR assembly, the high-concentration T ADH1 -CYP716A53v2-P gal1,10 -UGTPg100-T ALT1 Linear donor DNA. The specific operation is as follows: using the PUC57-CYP716A53v2 plasmid synthesized by Sangon (the nucleotide sequence of CYP716A53v2 is shown in SEQ ID NO.14) as a template, CYP716A53v2-F and CYP716A53v2-R as primers, the CYP716A53v2 fragment is obtained. Using the PUC57-UGTPg100 plasmid synthesized by Sangon (the nucleotide sequence of UGTPg100 is shown in SEQ ID NO.15) as a template, UGTPg100-F and UGTPg100-R as primers, the UGTPg100 fragment is obtained. Using the pGAL1,10-MCS-His-MCS-Flag-URA plasmid as a template, LPP1-T ADH1 -F and LPP1-T ADH1 -R is the primer, which yields the terminator LPP1-T ADH1 ; LPP1-P gal1,10 -F and LPP1-P gal1,10 -R is a primer to obtain the bidirectional promoter LPP1-P gal1,10; Using the Saccharomyces cerevisiae CEN PK2-1D genome as a template and LPP1-T ALT1 -F and LPP1-T ALT1 -R is the primer, which yields the terminator LPP1-T ALT1 CYP716A53v2 gene fragment, bidirectional promoter LPP1-P gal1,10 , UGTPg100 gene fragment, terminator LPP1-T ADH1 and terminator LPP1-T ALT1 Mix them in a molar ratio of 1:1:1:1:1, add Gibson assembly reaction solution, and connect at 50℃ for 45min. Transform the vector into Escherichia coli DH5α strain, screen positive clones using the ampicillin resistance of the plasmid, verify the successful connection by colony PCR and sequence verification, and clone the correct vector using primers LPP1-T ADH1 -F and LPP1-T ALT1 -R was amplified by PCR, and the gene fragment was purified and recovered using the SanPrep column PCR product purification kit to obtain the donor DNA.

[0143] Competent cells were prepared and edited in wild-type S. cerevisiae CEN PK2-1D and S. cerevisiae Sq-0 according to the ZYMO Frozen-EZ Yeast Transformation II Kit instructions. Approximately 500 ng of Cas9-sgRNA plasmid and 1 μg of linear donor DNA were added. The transformation system was directly plated onto uracil YNB auxotrophic selection plates and incubated at 30°C for 4-5 days to form single colonies. Initial screening of yeast transformants was performed using colony PCR: a single colony was picked from the uracil YNB auxotrophic plate and placed in a tube containing PCR mixture. Integration of the target gene into the yeast genome was verified using the X-3, XI-3, and LPP1 site verification primer pairs. To ensure the use of the uracil URA3 selection tag in subsequent experiments, the gene-integrated tag was discarded. The specific operation is: the transformants with the correct bands in the above primary screening were inoculated into YPD liquid culture medium, cultured in a shaker at 220 rpm and 30°C for 16 hours, spread onto solid YPD plates containing 5-fluoroorotic acid for negative screening, and the colonies grown on the plates were verified by PCR again. At this time, the correct strains were verified, indicating that the labels had been discarded, and the engineered strains S.cerevisiae SC0Rh1 and S.cerevisiae Rh1-con were obtained respectively.

[0144] (2) The recombinant strain synthesized the rare ginsenoside Rh1 using red algae polysaccharide as a substrate

[0145] Plasmid p426-AqAga-agaNash was introduced into engineered strains S. cerevisiae SC0Rh1 and S. cerevisiae Rh1-con using the lithium acetate transformation method described in Example 1 to produce engineered strains S. cerevisiae SC0Rh1-Ag and S. cerevisiae Rh1-Ag. The primary seed solution was transferred to YPDA medium (carbon sources: 25 g / L red algae polysaccharide and 10 g / L glucose) at a 1% volume ratio and cultured at 30°C and 220 rpm for 144 hours. Samples were collected at 0, 12, 24, 48, 72, 96, 120, and 144 hours after inoculation to measure sugar consumption, bacterial growth, and rare ginsenoside Rh1 production. Yeast cells were disrupted according to the method described in Example 2, except that the extractant, ethyl acetate, was replaced with n-butanol. The rare ginsenoside Rh1 was detected using an LC-16 high-performance liquid chromatograph equipped with an SPD-16 dual-wavelength UV detector. The chromatographic column was Neptune 5u C18 (250×4.6mm), the mobile phase was water / acetonitrile, the detection wavelength was 203nm, and the column temperature was 35°C. A gradient elution method was used: 0-6 min, 40-100%; 6-18 min, 100%; 18-25 min, 100-40%; 25-35 min, 40%. The results are shown in Figure 2. Figure 7 As shown in Figure 2, compared with the control strain Rh1-con (which can only rely on a single carbon source, glucose), the Rh1 production of Rh1-Ag was significantly increased in the late fermentation period (72-144h), indicating that the engineered strain can continuously utilize red algae polysaccharides to synthesize the rare ginsenoside Rh1, reaching a maximum yield of 141.78 mg / L at 144h. The specific high-performance liquid chromatogram of the fermentation broth is shown in Figure 2. Figure 8 This indicates that the synergistic utilization of red algae polysaccharides and glucose in the culture medium optimizes carbon flow allocation: glucose preferentially supports bacterial growth and primary metabolism, while red algae polysaccharide degradation products drive secondary metabolism (Rh1 synthesis). In contrast, the rare ginsenoside Rh1 was completely undetectable in the engineered strain S. cerevisiae SC0Rh1-Ag, demonstrating that the enzymes tHMG1 and IDI1 can enhance the yeast chassis MVA pathway and balance IPP / DMAPP, thereby increasing the production of squalene and downstream terpenes (rare ginsenoside Rh1).

[0146] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A brewer's yeast for producing rare ginsenosides using seaweed biomass, characterized in that It has the following characteristics: (1) Overexpression of agarase and neoagarobiohydrolase; (2) overexpression of hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase; (3) Overexpression of dammarenediol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxadiol synthase, and glycosyltransferase.

2. The method for producing rare ginsenosides from seaweed biomass according to claim 1, wherein the method comprises: The agarase is at least one of an agarase derived from Pseudoalteromonas, an agarase derived from Aquimarina agarilytica, and an agarase derived from Persicobacter; The neoagaranbiohydrolase is at least one of a neoagaranbiohydrolase derived from Aquimarina agarilytica and a neoagaranbiohydrolase derived from Cellvibrio; The amino acid sequence of the hydroxymethylglutaryl-CoA reductase is shown in SEQ ID NO.7; The amino acid sequence of the isopentenyl diphosphate delta isomerase is shown in SEQ ID NO.9; The dammarene diol synthase is a dammarene diol synthase with an amino acid sequence as shown in GenBank accession number AB265170.1; The protopanaxadiol synthase is the protopanaxadiol synthase with an amino acid sequence as shown in the accession number of GenBank JN604537.1; The cytochrome P450 reductase is a cytochrome P450 reductase with an amino acid sequence as shown in GenBank accession number AIC73829.1; The protopanaxatriol synthase is a protopanaxatriol synthase with an amino acid sequence as shown in GenBank accession number JX036031.1; The glycosyltransferase is a glycosyltransferase whose amino acid sequence is shown in GenBank accession number A0A0K0PVW1.

1.

3. The brewer's yeast for producing rare ginsenosides using seaweed biomass according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the agarase from Pseudoalteromonas is shown in SEQ ID NO.2; The nucleotide sequence of the gene encoding the agarase derived from Corynebacterium agarolyticum is shown in SEQ ID NO.3; The nucleotide sequence of the gene encoding the agarase from A. persica is shown in SEQ ID NO.4; The nucleotide sequence of the gene encoding the novel agarobiohydrolase from Corynebacterium agarolyticum is shown in SEQ ID NO.5; The nucleotide sequence of the gene encoding the novel agarobiohydrolase from Vibrio cellulosa is shown in SEQ ID NO.6; The nucleotide sequence of the gene encoding hydroxymethylglutaryl-CoA reductase is shown in SEQ ID NO.8; The nucleotide sequence of the gene encoding the isopentenyl diphosphate delta isomerase is shown in SEQ ID NO.10; The nucleotide sequence of the gene encoding dammarene diol synthase is shown in SEQ ID NO.11; The nucleotide sequence of the gene encoding the protopanaxadiol synthase is shown in SEQ ID NO.12; The nucleotide sequence of the gene encoding cytochrome P450 reductase is shown in SEQ ID NO.13; The nucleotide sequence of the gene encoding the protopanaxatriol synthase is shown in SEQ ID NO.14; The nucleotide sequence of the gene encoding the glycosyltransferase is shown in SEQ ID NO.

15.

4. The brewer's yeast for producing rare ginsenosides using seaweed biomass according to claim 1, characterized in that: The hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase are integrated into the genomic GAL80 site; The dammarene diol synthase is integrated into the genome X-3 site; The protopanaxadiol synthase and the protopanaxadiol synthase are integrated at the genomic XI-3 site; The protopanaxatriol synthase and the glycosyltransferase are integrated into the genomic LPP1 site.

5. The brewer's yeast for producing rare ginsenosides using seaweed biomass according to claim 1, characterized in that: The starting strain of Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass is the CEN PK series strain of Saccharomyces cerevisiae; The seaweed biomass is algae polysaccharide.

6. The method for constructing Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass according to any one of claims 1 to 5, characterized in that The steps include: 1) Construction of recombinant vectors expressing agarase and neoagarobiohydrolase; 2) Construction of Cas9-sgRNA plasmids: specifically, construction of Cas9-sgRNA plasmids targeting the GAL80 site, Cas9-sgRNA plasmids targeting the X-3 site, Cas9-sgRNA plasmids targeting the XI-3 site, and Cas9-sgRNA plasmids targeting the LPP1 site; 3) Constructing donor fragments: specifically, hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase gene donor fragments, dammarenediol synthase gene donor fragments, protopanaxadiol synthase and cytochrome P450 reductase gene donor fragments, and protopanaxadiol synthase and glycosyltransferase gene donor fragments; 4) Gene Editing: Transform the Cas9-sgRNA plasmid obtained in step 2) and the donor fragment obtained in step 3) into a starting strain of Saccharomyces cerevisiae, and screen to obtain a recombinant strain overexpressing hydroxymethylglutaryl-CoA reductase, isopentenyl diphosphate delta isomerase, dammarenediol synthase, protopanaxadiol synthase, cytochrome P450 reductase, protopanaxadiol synthase, and glycosyltransferase; 5) Construction of Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass: The recombinant vector obtained in step 1) is transferred into the recombinant strain obtained in step 4) to obtain Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass.

7. The construction method according to claim 6, characterized in that: The vector framework of the recombinant vector is p426 Gal plasmid; The recombinant vector also contains a secretory peptide gene; The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the GAL80 site is as follows: ACGATAGTTGCAGTATGGCG; The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the X-3 site is as follows: GACACATTAGTCTCGTATGT; The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the XI-3 site is as follows: GTAGAAATCAGACGCACGCT; The nucleotide sequence of the sgRNA of the Cas9-sgRNA plasmid targeting the LPP1 site is as follows: ATGAAACTTGAATGTCCGCT; The structure of the hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase gene donor fragment is terminator-hydroxymethylglutaryl-CoA reductase gene-promoter-isopentenyl diphosphate delta isomerase gene-terminator; The structure of the protopanaxadiol synthase and cytochrome P450 reductase gene donor fragments is promoter-protopanaxadiol synthase gene-terminator-promoter-cytochrome P450 reductase gene-terminator; The structure of the protopanaxatriol synthase and glycosyltransferase gene donor fragments is terminator-protopanaxatriol synthase gene-promoter-glycosyltransferase gene-terminator.

8. The construction method according to claim 7, wherein: The secretory peptide gene is derived from the α-mating factor of Saccharomyces cerevisiae; The terminator in the hydroxymethylglutaryl-CoA reductase and isopentenyl diphosphate delta isomerase gene donor fragment is T ADH1 terminator and T CYC1 terminator; promoter is P gal1,10 promoter; The terminator in the dammarenediol synthase gene donor fragment is T ADH1 terminator, promoter is P gal1,10 promoter; The terminator in the protopanaxadiol synthase and cytochrome P450 reductase gene donor fragments is T ALT1 terminator and T CYC1 terminator; promoter is P gal1,10 Promoter and P gal7 promoter; The terminator of the protopanaxantriol synthase and glycosyltransferase gene donor fragments is T ADH1 terminator and T ALT1 terminator; promoter is P gal1,10 promoter.

9. Use of the Saccharomyces cerevisiae for producing rare ginsenosides using seaweed biomass according to any one of claims 1 to 5 in the production of squalene and / or rare ginsenosides.

10. The use according to claim 9, characterized in that The method comprises the following steps: fermenting the brewer's yeast for producing rare ginsenosides by utilizing seaweed biomass according to any one of claims 1 to 5 in a culture medium containing seaweed biomass to obtain squalene and / or rare ginsenosides.

Images