Nucleic acid composition, kit and detection method for detecting methylation of cervical cancer related genes
By designing a nucleic acid composition with multiple specific methylation primers and probes, high sensitivity and specific detection of methylation of cervical cancer-related genes is achieved, and the problems of inaccurate detection results and high experimental costs in the prior art are solved, and the accuracy and efficiency of early screening and diagnosis of cervical cancer are achieved.
Patent Information
- Application Number
- CN202510661465.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2045-05-22
AI Technical Summary
The prior art has problems with insufficient sensitivity and specificity in detecting cervical cancer-related gene methylation, and the detection method of single gene single detection site is time-consuming and labor-intensive, has high contamination risk and high experimental cost.
A nucleic acid composition was designed, including multiple methylation primers and probes with high specificity, covering 73 methylated CpG sites, and was tested by a single tube multiple gene methylation detection site to reduce reagent consumption and experimental operation complexity.
The accuracy and high throughput of the test results were achieved, with good sensitivity and specificity, with a clinical sensitivity of 88.57%, a specificity of 93.65%, and a total compliance rate of 92.86%, reducing medical costs, improving the reliability of the test and population acceptance.
Smart Images

Figure CN120193085A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological detection, in particular to a nucleic acid composition, a kit and a detection method for detecting the methylation of cervical cancer-related genes. Background Art
[0002] Cervical cancer is the most common gynecological tumor and ranks second among female malignancies worldwide. The occurrence and development of cervical cancer is a slow and progressive process, usually a continuous development process of cervical intraepithelial neoplasia (CINI→II→III)→carcinoma in situ→early invasive carcinoma→invasive carcinoma. It takes about 10-15 years for CINI to develop into invasive carcinoma, and about 3-4 years for carcinoma in situ to develop into invasive carcinoma. There are no obvious symptoms during carcinoma in situ, and active screening is required to detect it.
[0003] Early screening, timely detection and appropriate treatment are important means for the prevention and treatment of cervical cancer. Abnormal DNA methylation usually occurs in the early stage of cancer and runs through the occurrence and development process of cancer. Once its methylation state is formed, it needs to be continuously stimulated by the external environment for a long time to change. Therefore, the detection of DNA methylation indicators can be used as an important biological indicator for cancer diagnosis, early screening and prognosis.
[0004] Current studies have shown that, like many other cancers, cervical cancer is the result of the long-term action of multiple carcinogenic factors. Its pathological process is a complex process of cumulative multi-gene mutations, involving abnormal methylation of multiple oncogenes and tumor suppressor genes. Most of these abnormal methylations are hypermethylation of tumor suppressor genes, and hypermethylation often leads to transcriptional silencing of tumor suppressor genes. Studies have shown that the AUC of Septin9 methylation for detecting cervical cancer can reach 0.854. A multi-center study in Taiwan Province of China evaluating PAX1 / SOX1 for the clinical detection of high-grade cervical lesions showed that the sensitivities of PAX1 and SOX1 for detecting CIN3 + were 64% and 71% respectively, the specificities were 91% and 77% respectively, and the AUCs were 0.77 and 0.83 respectively.
[0005] Methods for detecting DNA methylation can be roughly divided into two categories: whole-genome methylation analysis and specific-site methylation detection. Whole-genome methylation analysis has a relatively high detection cost and is often used as a high-throughput screening method to discover target genes. Specific-site methylation detection methods include combined bisulfite restriction analysis (COBRA), methylation-specific PCR (MSP), MethyLight, methylation-sensitive high-resolution melting curve analysis, etc. The restriction analysis method can only obtain the methylation status of specific restriction sites. The methylation-specific PCR method is based on ordinary PCR and electrophoresis analysis, which is cumbersome and prone to sample contamination. The methylation-sensitive high-resolution melting curve analysis method has high requirements for instruments and requires a fluorescence quantitative PCR instrument with a high-resolution melting (HRM) module. MethyLight is widely used in the detection of DNA methylation due to its high throughput, high sensitivity, and the absence of post-PCR electrophoresis, hybridization, etc., which reduces contamination and operation errors. Currently, the detection accuracy of single-gene detection based on MethyLight for detecting cervical cancer DNA methylation is not ideal, and the diagnostic effect is limited. Researchers often improve the detection sensitivity by combining multiple genes for joint detection. However, multi-gene joint detection may lead to a decrease in specificity. At the same time, if the single-tube single-gene test method is used for detection, it requires a large amount of reagents, increases the operation of experimental personnel, and the experimental cost is relatively high.
[0006] Therefore, there is an urgent need in the market to develop a stable, reliable, highly sensitive, and specific method for detecting cervical cancer. Summary of the Invention
[0007] To solve the deficiencies of the prior art, the purpose of the present invention is to provide a nucleic acid composition, a kit, and a detection method for detecting the methylation of cervical cancer-related genes. The kit configured with the nucleic acid composition discovered by the present invention has the advantages of accurate detection results for cervical cancer, fast timeliness, high detection throughput, good specificity, and good sensitivity.
[0008] In the first aspect, the present invention provides a nucleic acid composition for detecting the methylation of cervical cancer-related genes, characterized in that the nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition, or a combination of the first nucleic acid composition and the second nucleic acid composition; the first nucleic acid composition includes: methylation-specific primers and probes for the JAM3 gene, methylation-specific primers and probes for the PAX1 gene, and methylation-specific primers and probes for the ZNF582 gene; the second nucleic acid composition includes: methylation-specific primers and probes for the SOX1 gene, methylation-specific primers and probes for the Septin9 gene, and methylation-specific primers and probes for the PCDHGB7 gene; The methylation-specific primers and probes for the JAM3 gene include: Forward primer: SEQ ID NO:1, Reverse primer: SEQ ID NO:2, Probe: SEQ ID NO:3; The methylation-specific primers and probes for the PAX1 gene include: Forward primer: SEQ ID NO:4, Reverse primer: SEQ ID NO:5, Probe: SEQ ID NO:6; The methylation-specific primers and probes for the ZNF582 gene include: Forward primer: SEQ ID NO:7, Reverse primer: SEQ ID NO:8, Probe: SEQ ID NO:9; The methylation-specific primers and probes for the SOX1 gene include: Forward primer: SEQ ID NO:10, Reverse primer: SEQ ID NO:11, Probe: SEQ ID NO:12; The methylation-specific primers and probes for the Septin9 gene include: Forward primer: SEQ ID NO:13, Reverse primer: SEQ ID NO:14, Probe: SEQ ID NO:15; The methylation-specific primers and probes for the PCDHGB7 gene include: Forward primer: SEQ ID NO:16, Reverse primer: SEQ ID NO:17, Probe: SEQ ID NO:18.
[0009] Optionally, the 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY5.
[0010] Optionally, the 3' end of the probe contains a fluorescent quenching group, and the fluorescent quenching group includes any one of MGB, BHQ1, BHQ2, BHQ3.
[0011] Optionally, it further includes the specific primers and probes for the ACTB internal reference gene, The specific primers and probes for the ACTB internal reference gene include: Forward primer: SEQ ID NO:19, Reverse primer: SEQ ID NO:20, Probe: SEQ ID NO:21.
[0012] In a second aspect, the present invention provides a kit for detecting methylation of cervical cancer-related genes, which kit comprises the nucleic acid composition described in the first aspect, and further comprises a PCR reaction solution, a positive control product and a negative control product.
[0013] Optionally, the positive control product is genomic DNA of a methylated cell line.
[0014] Optionally, the negative control product is genomic DNA of an unmethylated cell line.
[0015] In a third aspect, the present invention provides a method for detecting methylation of cervical cancer-related genes, comprising the following steps: Step 1: Extract DNA from the sample to be detected, and use the DNA after conversion treatment as the template for PCR; Step 2: Perform PCR amplification using the kit described in the second aspect; Step 3: Determine whether methylation has occurred in the sample to be detected according to the fluorescence Ct value of the amplification result.
[0016] Optionally, in step 1, the reagent used for the conversion treatment is bisulfite or metabisulfite.
[0017] Optionally, in step 2, the reaction program for PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 sec, annealing at 60°C for 30 sec, for 45 - 50 cycles.
[0018] The beneficial effects of the present invention are as follows: 1. Advantageous complementarity of target genes: The nucleic acid composition provided by the present invention is the best combination screened through multiple data analyses and multiple clinical experiments, which not only ensures the synergistic effect of the detection effects of different targets, but also excludes the mutual interference between primers and probes of different targets; 2. Many methylation sites covered and high accuracy: Specific methylation primers and probes are designed for multiple methylation detection sites on cervical cancer hypermethylation candidate genes, covering 73 methylated CpG sites, and the methylation situation of a large target gene region can be obtained, ensuring the accuracy of the detection; 3. Single-tube multiplex gene methylation detection: A single-tube multiplex gene methylation detection site joint detection is established, which not only reduces reagent consumption and consumable costs, but also reduces the complexity of experimental operations and improves the accuracy of results; 4. High acceptance: The kit for detecting the methylation of genes related to cervical cancer provided by the present invention recommends the cervical swab as the sample. By detecting the methylation status of genes related to exfoliated cells therein, it can assist in the diagnosis of cervical cancer, achieving non-invasive detection and a high acceptance rate among the population.
[0019] By designing primers and probes with high specificity and configuring them into a kit that is convenient to use and has reliable detection results, and then combining with a scientific and reasonable multiplex PCR reaction system, the present invention has the characteristics of simplicity, high throughput, sensitivity, and good specificity. When using the kit of the present invention for cervical cancer screening, taking CIN2 as the clinical diagnosis threshold, the clinical sensitivity is 88.57%, the specificity is 93.65%, and the total coincidence rate reaches 92.86%, achieving accurate early screening and diagnosis of cervical cancer, so as to indirectly conduct timely and effective diagnosis and treatment of cervical cancer, that is, reducing medical costs, saving social resources, and improving the quality of life of the population. Brief Description of the Drawings
[0020] Figure 1 is the amplification curve of the positive sample of JAM3 gene methylation of the present invention; Figure 2 is the amplification curve of the positive sample of PAX1 gene methylation of the present invention; Figure 3 is the amplification curve of the positive sample of ZNF582 gene methylation of the present invention; Figure 4 is the amplification curve of the positive sample of SOX1 gene methylation of the present invention; Figure 5 is the amplification curve of the positive sample of Septin9 gene methylation of the present invention; Figure 6 is the amplification curve of the positive sample of PCDHGB7 gene methylation of the present invention; Figure 7 is the amplification curve of the negative sample of the present invention; Figure 8 is the amplification curve without amplification of both the target gene and the internal reference gene of the present invention. Detailed Embodiments
[0021] The following is a specific introduction to the present invention in combination with specific embodiments.
[0022] A method for detecting the methylation of genes related to cervical cancer includes the following steps: Step 1: Extract the DNA of the sample to be detected, and the DNA after transformation treatment is used as the genomic DNA sample for PCR; the reagent used for transformation treatment is bisulfite or metabisulfite. Designing based on the sequence after treatment with bisulfite can ensure the quality control of the sample by housekeeping genes; Step 2: Use a kit for detecting the methylation of genes related to cervical cancer to perform PCR amplification on the genomic DNA sample. The kit includes: Primer-probe mixture 1, Primer-probe mixture 2, PCR reaction solution, negative control product, and positive control product; Primer-probe mixture 1 includes: Methylation-specific primers and probes for the JAM3 gene (the sequences are shown in SEQ ID NO: 1-3 respectively), Methylation-specific primers and probes for the PAX1 gene (the sequences are shown in SEQ ID NO: 4-6 respectively), Methylation-specific primers and probes for the ZNF582 gene (the sequences are shown in SEQ ID NO: 7-9 respectively), Specific primers and probes for the ACTB internal reference gene (the sequences are shown in SEQ ID NO: 19-21 respectively); Primer-probe mixture 2 includes: Methylation-specific primers and probes for the SOX1 gene (the sequences are shown in SEQ ID NO: 10-12 respectively), Methylation-specific primers for the Septin9 gene (the sequences are shown in SEQ ID NO: 13-15 respectively), Methylation-specific primers and probes for the PCDHGB7 gene (the sequences are shown in SEQ ID NO: 16-18 respectively), Specific primers and probes for the ACTB internal reference gene (the sequences are shown in SEQ ID NO: 19-21 respectively); The PCR reaction solution includes: PCR reaction buffer, dNTP, nuclease-free water, Taq enzyme; Step 3: Determine whether the sample to be tested is methylated according to the fluorescence Ct values of the amplification results of the target genes JAM3, PAX1, ZNF582, SOX1, Septin9, PCDHGB7 and the internal reference gene ACTB.
[0023] As a preference, the reaction program for PCR amplification is: denaturation at 95°C for 5 min; 45 cycles, 95°C for 15 sec, 60°C for 30 sec. It should be noted that: the amplification program of PCR is not limited, and any program that can amplify the genomic DNA sample is applicable to the present invention;
[0024] As a preference, the 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY5.
[0025] As a preference, the 3' end of the probe contains a fluorescent quenching group, and the fluorescent quenching group includes any one of MGB, BHQ1, BHQ2, BHQ3.
[0026] As a preference, the positive control product is the genomic DNA of the Hela cell line, and the negative control product is the genomic DNA of the 293T cell line.
[0027] As an embodiment, the final concentrations of the components of primer-probe mixture 1 are as follows: 0.4 - 0.6 μM JAM3 forward primer, 0.4 - 0.6 μM JAM3 reverse primer, 0.2 - 0.3 μM JAM3 detection probe, 0.4 - 0.6 μM PAX1 forward primer, 0.4 - 0.6 μM PAX1 reverse primer, 0.2 - 0.3 μM PAX1 detection probe, 0.4 - 0.6 μM ZNF582 forward primer, 0.4 - 0.6 μM ZNF582 reverse primer, 0.2 - 0.3 μM ZNF582 detection probe. The final concentrations of the components of primer-probe mixture 2 are as follows: 0.4 - 0.6 μM SOX1 forward primer, 0.4 - 0.6 μM SOX1 reverse primer, 0.2 - 0.3 μM SOX1 detection probe, 0.4 - 0.6 μM Septin9 forward primer, 0.4 - 0.6 μM Septin9 reverse primer, 0.2 - 0.3 μM Septin9 detection probe, 0.4 - 0.6 μM PCDHGB7 forward primer, 0.4 - 0.6 μM PCDHGB7 reverse primer, 0.2 - 0.3 μM PCDHGB7 detection probe. The final concentrations of the components of the PCR reaction solution are as follows: 1X PCR buffer, 0.2 - 0.5 mM dNTP, nuclease-free water, 0.05 - 0.2 U / μl Taq enzyme. It should be noted that: the reagent formulations of the primer-probe mixture and the reaction solution are not limited. What is provided here is only a preferred embodiment, and other reaction solution formulations that can cooperate with the amplification of sample DNA are also applicable to the present invention.
[0028] It should be emphasized here that: the detection method of the present invention is not limited, and any detection method that uses the nucleic acid composition of the present invention is within the protection scope of the present invention.
[0029] To more clearly show the technical solution of the present invention, the present invention will be further elaborated below in conjunction with specific embodiments.
[0030] Example 1: Screening of nucleic acid composition
[0031] To verify the detection effect of the primer-probe composition for cervical cancer gene methylation detection, the primer-probes of 6 targets (specific sequences refer to Example 2) were used to detect 20 clinically positive (P1 - 20) and 10 clinically negative (N1 - 10) cervical exfoliated cell samples respectively. The specific results are shown in Table 1, where "1" represents a positive detection and "0" represents a negative detection.
[0032] Table 1 Results of single experiment
[0033] According to the results in Table 1, the statistical analysis results are shown in Table 2. From the results in Table 2, it can be obtained that the detection sensitivity of the single primer-probe combination provided by the present invention is between 65.0% and 75.0%, and the specificity is between 90.0% and 100.0%. By combining each target, the detection effect can be improved. Among them, the three-gene combinations PAX1 + JAM3 + ZNF582 and Septin9 + SOX1 + PCDHGB7 have better effects, with a detection sensitivity of 95.0% and a specificity of 90%.
[0034] Table 2 Statistical Results of Single Experiment
[0035] Based on the single-tube detection analysis of single genes at single detection sites for cervical cancer, this detection method is time-consuming and laborious, and has a relatively high risk of contamination. While detecting multiple genes in the same tube can greatly reduce the consumption of reagents and consumables, reduce the risk of experimental contamination, and at the same time reduce labor costs. Using the DNA samples of 20 clinically positive (P1 - 20) and 10 clinically negative (N1 - 10) cervical exfoliated cell samples as templates, the detection effect of single-tube multiplex PCR was tested. It was found that the interference between the multiplex PCR primers combined into one tube based on JAM3, PAX1, and ZNF582 and the primers combined into one tube based on SOX1, Septin9, and PCDHGB7 was the least. The detection results of this optimal combination are shown in Table 3, indicating that the detection sensitivity of single-tube multiplex PCR decreased to a certain extent compared with that of single PCR, but was greatly improved compared with the sensitivity of single primer-probe. Therefore, the primer-probe combinations JAM3, PAX1, ZNF582 and the primer-probe combinations SOX1, Septin9, PCDHGB7 were preferably selected for further research.
[0036] Table 3 Statistical Results of Multiplex PCR Experiment
[0037] Example 2: Preparation of Kit I. The first nucleic acid composition includes: 0.8 μM JAM3 forward primer, 0.8 μM JAM3 reverse primer, 0.6 μM JAM3 detection probe, 0.8 μM PAX1 forward primer, 0.8 μM PAX1 reverse primer, 0.6 μM PAX1 detection probe, 0.8 μM ZNF582 forward primer, 0.8 μM ZNF582 reverse primer, 0.6 μM ZNF582 detection probe, 0.6 μM ACTB forward primer, 0.6 μM ACTB reverse primer, 0.4 μM ACTB detection probe; The methylation-specific primers and probes for the JAM3 gene include: Forward primer (5’-3’): TGTGTCGGTTTAGAGTATCGTTGTATTC (SEQ ID NO:1), Reverse primer (5’-3’): ACCTACCAAAACCCTACGACCCG (SEQ ID NO:2), Detection probe (5’-3’): ACGACCGCCGAACCCAACCGAACCG (SEQ ID NO:3), with a fluorescent group FAM modified at the 5’ end and a fluorescent quenching group BHQ1 labeled at the 3’ end; The methylation-specific primers and probes for the PAX1 gene include: Forward primer (5’-3’): TAGTCGCGGGTTGGAGACGC (SEQ ID NO:4), Reverse primer (5’-3’): ACGACGACGACAAACCCTAAAACG (SEQ ID NO:5), Detection probe (5’-3’): ACGACAACGCGCTCCGCTACCGCG (SEQ ID NO:6), with a fluorescent group ROX modified at the 5’ end and a fluorescent quenching group BHQ1 labeled at the 3’ end; The methylation-specific primers and probes for the ZNF582 gene include: Forward primer (5’-3’): ATCGGTGTGTTTTGTGCGTTTGC (SEQ ID NO:7), Reverse primer (5’-3’): CAAAACGCGCTTCCACCACG (SEQ ID NO:8), Detection probe (5’-3’): CCGATAAATTCGCCGTACGCAACCG (SEQ ID NO:9), with a fluorescent group CY5 modified at the 5’ end and a fluorescent quenching group BHQ2 labeled at the 3’ end; The methylation-specific primers and probes for the ACTB internal reference gene include: Forward primer (5’-3’): GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO:19), Reverse primer (5’-3’): CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO:20), Detection probe (5’-3’): ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO:21), with a fluorescent group VIC modified at the 5’ end and a fluorescent quenching group BHQ1 labeled at the 3’ end; II. The second nucleic acid composition includes: 0.8 μM SOX1 forward primer, 0.8 μM SOX1 reverse primer, 0.6 μM SOX1 detection probe, 0.8 μM Septin9 forward primer, 0.8 μM Septin9 reverse primer, 0.6 μM Septin9 detection probe, 0.8 μM PCDHGB7 forward primer, 0.8 μM PCDHGB7 reverse primer, 0.6 μM PCDHGB7 detection probe, 0.6 μM ACTB forward primer, 0.6 μM ACTB reverse primer, 0.4 μM ACTB detection probe; The SOX1 gene methylation-specific primers and probes include: Forward primer (5’-3’): TTGGAGGTCGTTGAGGATCGAGC (SEQ ID NO:10), Reverse primer (5’-3’): ACGATACGCTAAACCCGACCCG (SEQ ID NO:11), Detection probe (5’-3’): CTCGCCGACCGCCGCTACGCG (SEQ ID NO:12), with a fluorescent group FAM modified at the 5’ end and a fluorescent quenching group BHQ1 labeled at the 3’ end; The Septin9 gene methylation-specific primers and probes include: Forward primer (5’-3’): TCGTATGTTCGTTTTGCGTTTTTCG (SEQ ID NO:13), Reverse primer (5’-3’): ATTCTCTATCACCGCCGCCGCG (SEQ ID NO:14), Detection probe (5’-3’): CCTACAAAAATTAAACGACAACGCACGCG (SEQ ID NO:15), with a fluorescent group ROX modified at the 5’ end and a fluorescent quenching group BHQ1 labeled at the 3’ end; The PCDHGB7 gene methylation-specific primers and probes include: Forward primer (5’-3’): TTAGCGAGAATTCGAGCGAAC (SEQ ID NO:16), Reverse primer (5’-3’): TCGAATAACGAATCGACTCACACAACG (SEQ ID NO:17), Detection probe (5’-3’): TAGAGGCGTCGGGTCGGTTCGCG (SEQ ID NO:18), with a fluorescent group CY5 modified at the 5’ end and a fluorescent quenching group BHQ2 labeled at the 3’ end; ACTB internal reference gene specific primers and probes include: Forward primer (5'-3'): GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 19), Reverse primer (5'-3'): CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 20), Detection probe (5'-3'): ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 21), the 5' end is modified with the fluorescent group VIC, and the 3' end is labeled with the fluorescent quencher group BHQ1; 3. Selection of positive quality control and negative quality control: The positive quality control is the genomic DNA of Hela cell line, and the negative quality control is the genomic DNA of 293T cell line; 4. The PCR reaction solution includes: PCR reaction buffer, dNTP, nuclease-free water, Taq enzyme; the final concentrations of the components of the PCR reaction solution are: 1XPCR buffer, 0.4mM dNTP, nuclease-free water, 0.1U / μlTaq enzyme.
[0038] Example 3: PCR detection method for methylation of cervical cancer-related genes A pair of specific primers and probes are designed in the promoter region of cervical cancer-related genes and internal reference genes in the human genome. The primers and probes are then used to amplify the sample DNA converted by bisulfite. The relative fluorescence value Ct value of the PCR amplification result of the relevant gene is used to determine whether the sample to be tested is methylated, and the risk of cervical cancer is indirectly determined based on the methylation.
[0039] The specific detection methods are as follows: Step 1: Extract the DNA of the sample to be tested and perform bisulfite conversion on it. The converted DNA is used as a template for PCR amplification. The reagents used for the conversion treatment are bisulfite or bisulfite and other auxiliary reagents (the corresponding reagents are purchased from Epitect Fast Bisulfite Conversion Kit of QIAGEN, Germany); Step 2: Provide the kit for detecting methylation of cervical cancer-related genes in Example 2, and perform PCR amplification on the template. The details are as follows: 1. Take out each component of the kit and place it at room temperature. After the temperature is balanced to room temperature, melt the PCR reaction solution and the first nucleic acid composition / second nucleic acid composition (see Table 4) according to the sample size of the subject and the quality control product; 2. Vortex the PCR reaction solution and the first nucleic acid composition / the second nucleic acid composition for 10-15 seconds and centrifuge briefly; 3. Preparation of PCR pre-reaction solution: If the number of samples to be detected is n, add the corresponding volumes of PCR reaction solution and DNA polymerase to a centrifuge tube according to the ratio in Table 4, vortex and mix well, centrifuge briefly to collect the liquid droplets on the tube wall; 4. Preparation of PCR reaction plate: Immediately dispense the prepared PCR pre-reaction solution into the PCR reaction plate at 15 μL / well. Then, add 10 μL of the bisulfite-converted genomic DNA of the sample to be tested (abbreviated as bisDNA), the bisDNA of the positive control, and the bisDNA of the negative control into their respective PCR amplification reaction wells, and seal with a sealing film; Table 4 Preparation of PCR pre-reaction solution (PCR Master Mix) Reagent Primer-probe mixture 1 / Primer-probe mixture 2 PCR reaction solution Volume (μL) 5.5×n 11×n 5. Place the 96-well PCR plate into the sample slot of the PCR instrument and record the placement order. Set Passive Reference to None, and set the reaction program as shown in Table 5; Table 5 Reaction program
[0040] Step 3: Determine whether the sample to be tested is methylated based on the fluorescence Ct values of the amplification results of the target genes JAM3, PAX1, ZNF582, SOX1, Septin9, PCDHGB7 and the internal reference gene ACTB. Specifically as follows: 1. Calculate the △Ct value: △Ct value = Ct value of the target gene - Ct value of the internal reference (△Ct = Ct(FAM / ROX / CY5) - Ct(VIC)). The Ct value of the target gene refers to the Ct value corresponding to the signal of the sample target gene (FAM / ROX / CY5 signal); the Ct value of the internal reference refers to the Ct value of the corresponding internal reference signal (VIC signal) of the sample; 2. Judgment of the PCR detection results of the sample: After determining the Ct value and △Ct value according to the above steps, use the following method for judgment: When the Ct of the internal reference ACTB ≥ 35, the result is invalid; when the Ct of the internal reference ACTB < 35, the result is valid. If any one of the target genes shows a peak and △Ct < 8, the sample is determined to be positive, otherwise it is determined to be negative.
[0041] For the specific experimental data based on the present invention, see Figure 1 - Figure 8 , where Figure 1 is the amplification curve of the JAM3 gene methylation positive sample of the present invention; Figure 2 is the amplification curve of the PAX1 gene methylation positive sample of the present invention; Figure 3It is the amplification curve of the ZNF582 gene methylation positive sample of the present invention; Figure 4 It is the amplification curve of the SOX1 gene methylation positive sample of the present invention; Figure 5 It is the amplification curve of the Septin9 gene methylation positive sample of the present invention; Figure 6 It is the amplification curve of the PCDHGB7 gene methylation positive sample of the present invention; Figure 7 It is the amplification curve of the negative sample of the present invention; It can be seen the amplification curve relationship between the cervical cancer-related methylation genes and the ACTB internal reference gene of different methylation samples. If there is no amplification curve for both the target gene and the internal reference gene, see Figure 8 , indicating that the sample is unqualified and needs to be retested or resampled.
[0042] Example 4: Verification of the kit effect with a large number of clinical samples
[0043] Taking the negative result of colposcopy and / or histopathology examination as the clinical reference standard, 142 cases of negative cases, 47 cases of CIN1 cases, 22 cases of CIN2 cases, and 13 cases of ≥CIN3 cases of cervical exfoliated cell samples were selected as the detection objects. The DNA of each sample was extracted. The extraction of DNA can be carried out by any standard means in the prior art. Specifically, in this case, the sample DNA used was extracted according to the detection system in Example 3 by using a specific extraction protocol.
[0044] The DNA samples were pretreated to convert the cytosine unmethylated at the 5'-position into uracil. In this example, this pretreatment was achieved by treating with bisulfite reagent. The modification of bisulfite DNA was carried out by using the detection system in Example 3 for conversion pretreatment.
[0045] The detection system in Example 3 was added to the pretreated DNA samples of 142 negative cases and 82 cervical cancer cases to diversely detect JAM3, PAX1, ZNF582, SOX1, Septin9, PCDHGB7 and the internal reference gene ACTB. Real-time PCR was carried out on the bisulfite-converted DNA.
[0046] Among them, the PCR conditions adopted in the experimental case were carried out according to the qPCR conditions in Example 2.
[0047] The results are shown in Table 6, and Table 6 shows the results of detecting 142 negative cases and 82 cervical cancer case samples by using the multiplex assay of the present invention.
[0048] Table 6 Detection results of exfoliated cell samples of cervical cancer patients by using the kit of the present invention Clinical classification Number of cases Positive detection Negative detection Negative 142 1 141 CIN1 47 11 36 CIN2 22 19 3 CIN3+ 13 12 1 Total 224 43 181
[0049] Taking CIN2 as the clinical diagnosis threshold, the results are shown in Table 7. The clinical sensitivity of the test in vitro diagnostic reagent is 88.57%, the specificity is 93.65%, the positive predictive value is 72.09%, the negative predictive value is 97.79%, and the total coincidence rate reaches 92.86%.
[0050] Table 7 Statistical results with CIN2 as the clinical diagnosis threshold
[0051] Taking CIN3+ as the clinical diagnosis threshold, the results are shown in Table 8. The clinical sensitivity of the test in vitro diagnostic reagent is 92.31%, the specificity is 85.31%, the positive predictive value is 27.91%, the negative predictive value is 99.45%, and the total coincidence rate reaches 85.71%.
[0052] Table 8 Statistical results with CIN3+ as the clinical diagnosis threshold
[0053] It can be seen from the above verification experiments that combining JAM3, PAX1 and ZNF582 into the first nucleic acid composition, and combining SOX1, Septin9 and PCDHGB7 into the second nucleic acid composition to complete the detection of 3 targets and the simultaneous detection of 6 targets in one sample in a reaction system greatly improves the sensitivity and has a synergistic effect on the sensitivity of detecting methylation of cervical cancer-related genes. Combining the specific forward primers, reverse primers and probes of JAM3, PAX1 and ZNF582 together, and combining the specific forward primers, reverse primers and probes of SOX1, Septin9 and PCDHGB7 together for the simultaneous detection of cervical cancer methylation is an innovative discovery.
[0054] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form. Any technical solutions obtained by using equivalent replacements or equivalent transformations fall within the protection scope of the present invention.
Claims
1. A nucleic acid composition for detecting methylation of cervical cancer-related genes, characterized in that, The nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition, or a combination of the first nucleic acid composition and the second nucleic acid composition; The first nucleic acid composition includes: methylation-specific primers and probes for the JAM3 gene, methylation-specific primers and probes for the PAX1 gene, and methylation-specific primers and probes for the ZNF582 gene; the second nucleic acid composition includes: methylation-specific primers and probes for the SOX1 gene, methylation-specific primers and probes for the Septin9 gene, and methylation-specific primers and probes for the PCDHGB7 gene; The methylation-specific primers and probes for the JAM3 gene include: Forward primer: SEQ ID NO:1, Reverse primer: SEQ ID NO:2, Probe: SEQ ID NO:3; The methylation-specific primers and probes for the PAX1 gene include: Forward primer: SEQ ID NO:4, Reverse primer: SEQ ID NO:5, Probe: SEQ ID NO:6; The methylation-specific primers and probes for the ZNF582 gene include: Forward primer: SEQ ID NO:7, Reverse primer: SEQ ID NO:8, Probe: SEQ ID NO:9; The methylation-specific primers and probes for the SOX1 gene include: Forward primer: SEQ ID NO:10, Reverse primer: SEQ ID NO:11, Probe: SEQ ID NO:12; The methylation-specific primers and probes for the Septin9 gene include: Forward primer: SEQ ID NO:13, Reverse primer: SEQ ID NO:14, Probe: SEQ ID NO:15; The methylation-specific primers and probes for the PCDHGB7 gene include: Forward primer: SEQ ID NO:16, Reverse primer: SEQ ID NO:17, Probe: SEQ ID NO:
18.
2. The nucleic acid composition for detecting methylation of cervical cancer-related genes according to claim 1, wherein The 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, CY5.
3. The nucleic acid composition for detecting methylation of cervical cancer-related genes according to claim 1, characterized in that, The 3' end of the probe contains a fluorescent quenching group, and the fluorescent quenching group includes any one of MGB, BHQ1, BHQ2, BHQ3.
4. The nucleic acid composition for detecting methylation of cervical cancer-related genes according to claim 1, characterized in that, The nucleic acid composition further includes methylation-specific primers and probes for the ACTB internal reference gene, The methylation-specific primers and probes for the ACTB internal reference gene include: Forward primer: SEQ ID NO:19, Reverse primer: SEQ ID NO:20, Probe: SEQ ID NO:
21.
5. A kit for detecting the methylation of cervical cancer-related genes, characterized in that, The kit includes the nucleic acid composition according to any one of claims 1-4, and further includes a PCR reaction solution, a positive control product, and a negative control product.
6. The kit for detecting methylation of cervical cancer-related genes according to claim 5, wherein The positive control product is genomic DNA of a methylated cell line.
7. A kit for detecting methylation of cervical cancer-related genes according to claim 5, characterized in that, The negative control product is genomic DNA of an unmethylated cell line.
8. A method for detecting methylation of genes related to cervical cancer, characterized in that, It includes the following steps: Step 1: Extract the DNA of the sample to be detected, and use the DNA after transformation treatment as the template for PCR; Step 2: Perform PCR amplification using a kit for detecting methylation of cervical cancer-related genes according to claim 5; Step 3: Determine whether methylation has occurred in the sample to be detected based on the fluorescence Ct value of the amplification result.
9. A method for detecting methylation of cervical cancer-related genes according to claim 8, characterized in that, In the said Step 1, the reagent used for the conversion treatment is bisulfite or metabisulfite.
10. A method for detecting methylation of cervical cancer-related genes according to claim 8, characterized in that, In the said Step 2, the reaction program for PCR amplification is: pre-denaturation at 95°C for 5 min; 95°C for 15 sec, 60°C for 30 sec, for 45 - 50 cycles.
Citation Information
Patent Citations
Primer probe combination and kit for methylation detection of cervical cancer related genes and application thereof
CN113249485A
Kit for detecting methylation of cervical cell genes
CN114672568A
Cervical cancer related gene methylation detection probe combination, kit and detection method
CN116064805A
Kit for early detection of high-grade cervical lesions and cervical cancer
CN117265096A
Detection reagent and kit for methylation of cervical cancer SOX1-SEPTIN9-TAC1 gene
CN117701721A