Nucleic acid composition, kit and detection method for detecting methylation of cervical cancer-related genes

Abstract

The present invention relates to the field of biological detection technology, and in particular to a nucleic acid composition, kit, and detection method for detecting methylation of cervical cancer-related genes. The nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition, or a combination of the first and second nucleic acid compositions; the first nucleic acid composition comprises: a primer and probe specific for methylation of the JAM3 gene, a primer and probe specific for methylation of the PAX1 gene, and a primer and probe specific for methylation of the ZNF582 gene; the second nucleic acid composition comprises: a primer and probe specific for methylation of the SOX1 gene, a primer and probe specific for methylation of the Septin9 gene, and a primer and probe specific for methylation of the PCDHGB7 gene. The nucleic acid composition discovered by the present invention has the advantages of accurate and timely detection of cervical cancer, high detection throughput, good specificity, and good sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, in particular to a nucleic acid composition, a kit and a detection method for detecting methylation of cervical cancer-related genes. Background Art

[0002] Cervical cancer is the most common gynecological cancer and the second most common female malignant tumor worldwide. The development and progression of cervical cancer is a slow, gradual process, typically progressing from cervical intraepithelial neoplasia (CINI) to II to III, carcinoma in situ, early invasive carcinoma, and finally invasive carcinoma. It takes approximately 10 to 15 years for CINI to develop into invasive carcinoma, and about 3 to 4 years for carcinoma in situ to develop into invasive carcinoma. Carcinoma in situ is asymptomatic during this period, requiring active screening to detect.

[0003] Early screening, timely detection, and appropriate treatment are important means of preventing and treating cervical cancer. Abnormal DNA methylation often occurs in the early stages of cancer and persists throughout the development and progression of cancer. Once established, DNA methylation requires prolonged, sustained stimulation from the external environment to change. Therefore, DNA methylation testing can serve as an important biomarker for cancer diagnosis, early screening, and prognosis.

[0004] Current research shows that cervical cancer, like many other cancers, is the result of the long-term effects of multiple carcinogenic factors. Its pathological process is a complex process of accumulation of multiple gene mutations, involving abnormal methylation of multiple oncogenes and tumor suppressor genes. Most of these abnormal methylations are hypermethylation of tumor suppressor genes, which often leads to transcriptional silencing of tumor suppressor genes. Studies have shown that the AUC of Septin9 methylation for cervical cancer detection can reach 0.854. A multicenter study in Taiwan Province, my country, evaluating the use of PAX1 / SOX1 for clinical detection of high-grade cervical cancer lesions, showed that PAX1 and SOX1 were highly sensitive to CIN3. + The sensitivities were 64% and 71%, the specificities were 91% and 77%, and the AUCs were 0.77 and 0.83, respectively.

[0005] DNA methylation detection methods can be broadly divided into two categories: whole-genome methylation analysis and site-specific methylation detection. Whole-genome methylation analysis is relatively expensive and is often used as a high-throughput screening tool for target gene discovery. Site-specific methylation detection methods include restriction endonuclease analysis with sodium bisulfite (COBRA), methylation-specific PCR (MSP), methylation fluorescence quantitative analysis (MethyLight), and methylation-sensitive high-resolution melting curve analysis. Restriction endonuclease analysis can only detect methylation at specific restriction sites. Methylation-specific PCR, based on conventional PCR and electrophoresis analysis, is cumbersome and prone to sample contamination. Methylation-sensitive high-resolution melting curve analysis has high instrumentation requirements and requires a fluorescence quantitative PCR instrument with a high-resolution melting (HRM) module. Methylation fluorescence quantitative analysis is widely used in DNA methylation detection due to its high throughput and high sensitivity, and the absence of post-PCR electrophoresis and hybridization, which reduces contamination and operational errors. Currently, the detection accuracy of single genes in the methylation fluorescence quantitative method for detecting cervical cancer DNA methylation is not ideal, and the diagnostic effect is limited. Researchers often improve the detection sensitivity by combining multiple genes for joint detection, but multi-gene joint detection may lead to reduced specificity. At the same time, if a single-tube single-gene test is used for detection, more reagents are required, the operation of the experimenter is increased, and the experimental cost is high.

[0006] Therefore, the market urgently needs to develop a stable, reliable, highly sensitive and specific cervical cancer detection method. Summary of the Invention

[0007] In order to address the deficiencies of the prior art, the purpose of the present invention is to provide a nucleic acid composition, a kit and a detection method for detecting methylation of cervical cancer-related genes. The kit configured with the nucleic acid composition discovered in the present invention has the advantages of accurate and timely detection results of cervical cancer, high detection throughput, good specificity and good sensitivity.

[0008] In a first aspect, the present invention provides a nucleic acid composition for detecting methylation of cervical cancer-related genes, characterized in that the nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition, or a combination of the first nucleic acid composition and the second nucleic acid composition; the first nucleic acid composition comprises: a JAM3 gene methylation-specific primer and probe, a PAX1 gene methylation-specific primer and probe, and a ZNF582 gene methylation-specific primer and probe; the second nucleic acid composition comprises: a SOX1 gene methylation-specific primer and probe, a Septin9 gene methylation-specific primer and probe, and a PCDHGB7 gene methylation-specific primer and probe;

[0009] The JAM3 gene methylation-specific primers and probes include:

[0010] Forward primer: SEQ ID NO: 1,

[0011] Reverse primer: SEQ ID NO: 2,

[0012] Probe: SEQ ID NO: 3;

[0013] The PAX1 gene methylation-specific primers and probes include:

[0014] Forward primer: SEQ ID NO: 4,

[0015] Reverse primer: SEQ ID NO: 5,

[0016] Probe: SEQ ID NO: 6;

[0017] The ZNF582 gene methylation-specific primers and probes include:

[0018] Forward primer: SEQ ID NO: 7,

[0019] Reverse primer: SEQ ID NO: 8,

[0020] Probe: SEQ ID NO: 9;

[0021] The SOX1 gene methylation-specific primers and probes include:

[0022] Forward primer: SEQ ID NO: 10,

[0023] Reverse primer: SEQ ID NO: 11,

[0024] Probe: SEQ ID NO: 12;

[0025] The Septin9 gene methylation-specific primers and probes include:

[0026] Forward primer: SEQ ID NO: 13,

[0027] Reverse primer: SEQ ID NO: 14,

[0028] Probe: SEQ ID NO: 15;

[0029] The PCDHGB7 gene methylation-specific primers and probes include:

[0030] Forward primer: SEQ ID NO: 16,

[0031] Reverse primer: SEQ ID NO: 17,

[0032] Probe: SEQ ID NO: 18.

[0033] Optionally, the 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5.

[0034] Optionally, the 3' end of the probe comprises a fluorescence quenching group, and the fluorescence quenching group includes any one of MGB, BHQ1, BHQ2, and BHQ3.

[0035] Optionally, ACTB internal reference gene specific primers and probes are also included.

[0036] The ACTB internal reference gene specific primers and probes include:

[0037] Forward primer: SEQ ID NO: 19,

[0038] Reverse primer: SEQ ID NO: 20,

[0039] Probe: SEQ ID NO: 21.

[0040] In a second aspect, the present invention provides a kit for detecting methylation of cervical cancer-related genes, the kit comprising the nucleic acid composition described in the first aspect, and also comprising a PCR reaction solution, a positive quality control product, and a negative quality control product.

[0041] Optionally, the positive quality control product is methylated cell line genomic DNA.

[0042] Optionally, the negative control is unmethylated cell line genomic DNA.

[0043] In a third aspect, the present invention provides a method for detecting methylation of cervical cancer-related genes, comprising the following steps:

[0044] Step 1: Extract DNA from the sample to be tested, and use the converted DNA as a template for PCR;

[0045] Step 2: Perform PCR amplification using the kit described in the second step;

[0046] Step 3: Determine whether the sample to be tested is methylated based on the fluorescence Ct value of the amplification result.

[0047] Optionally, in step 1, the reagent used for the conversion treatment is bisulfite or bisulfite.

[0048] Optionally, in step 2, the reaction procedure of PCR amplification is: pre-denaturation at 95°C for 5 minutes; 95°C for 15 seconds, 60°C for 30 seconds, and 45 to 50 cycles.

[0049] The beneficial effects of the present invention are as follows:

[0050] 1. Complementary advantages of target genes: The nucleic acid composition provided by the present invention is the optimal combination screened through multiple data analysis and multiple clinical trials, which ensures the synergistic effect of different target detection effects and eliminates the mutual interference between different target primers and probes;

[0051] 2. Covering multiple methylation sites and high accuracy: Targeting multiple methylation detection sites on candidate genes with high methylation in cervical cancer, specific methylation primers and probes are designed, covering 73 methylated CpG sites. This allows for the methylation status of a large area of ​​the target gene region to be determined, ensuring the accuracy of the test.

[0052] 3. Single-tube multiplex gene methylation detection: Establish a single-tube multiplex gene methylation detection site joint detection, which reduces reagent consumption, reduces consumables costs, reduces the complexity of experimental operations, and improves the accuracy of results;

[0053] 4. High acceptance: The kit for detecting methylation of cervical cancer-related genes provided by the present invention recommends that the sample be cervical swabs. It can assist in the diagnosis of cervical cancer by detecting the methylation status of genes related to exfoliated cells, achieving non-invasive detection and high acceptance among the public.

[0054] The present invention designs primers and probes with high specificity and configures them into a kit that is easy to use and has reliable detection results. In combination with a scientific and reasonable multiplex PCR reaction system, the present invention has the characteristics of simplicity, high throughput, good sensitivity and specificity. When using the kit of the present invention for cervical cancer screening, with CIN2 as the clinical diagnostic cutoff value, the clinical sensitivity is 88.57%, the specificity is 93.65%, and the overall compliance rate reaches 92.86%, achieving accurate early screening and diagnosis of cervical cancer, so as to indirectly carry out timely and effective diagnosis and treatment of cervical cancer, thereby reducing medical costs, saving social resources, and improving people's quality of life. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 This is the amplification curve of the JAM3 gene methylation-positive sample of the present invention;

[0056] Figure 2 This is the amplification curve of the PAX1 gene methylation-positive sample of the present invention;

[0057] Figure 3 This is a graph showing amplification of a ZNF582 gene methylation-positive sample according to the present invention;

[0058] Figure 4 This is the amplification curve of the SOX1 gene methylation-positive sample of the present invention;

[0059] Figure 5 This is the amplification curve of the Septin9 gene methylation-positive sample of the present invention;

[0060] Figure 6 This is a graph showing the amplification curve of a PCDHGB7 gene methylation-positive sample of the present invention;

[0061] Figure 7 is the amplification curve diagram of the negative sample of the present invention;

[0062] Figure 8 This is a graph showing that neither the target gene nor the internal reference gene of the present invention has an amplification curve. DETAILED DESCRIPTION

[0063] The present invention is described in detail below with reference to specific embodiments.

[0064] A method for detecting methylation of cervical cancer-related genes, comprising the following steps:

[0065] Step 1: Extract the DNA of the sample to be tested, and use the converted DNA as the genomic DNA sample for PCR template; the reagent used for the conversion treatment is bisulfite or bisulfite. The sequence designed after bisulfite treatment can ensure the quality control of the housekeeping gene for the sample;

[0066] Step 2: PCR amplification of genomic DNA samples was performed using a kit for detecting methylation of cervical cancer-related genes. The kit includes: primer-probe mixture 1, primer-probe mixture 2, PCR reaction solution, negative quality control and positive quality control; primer-probe mixture 1 includes: JAM3 gene methylation-specific primers and probes (sequences shown in SEQ ID NOs: 1-3, respectively), PAX1 gene methylation-specific primers and probes (sequences shown in SEQ ID NOs: 4-6, respectively), ZNF582 gene methylation-specific primers and probes (sequences shown in SEQ ID NOs: 7-9, respectively), and ACTB internal reference gene-specific primers and probes (sequences shown in SEQ ID NOs: 19-21, respectively); primer-probe mixture 2 includes: SOX1 gene methylation-specific primers and probes (sequences shown in SEQ ID NOs: 10-12, respectively), Septin9 gene methylation-specific primers (sequences shown in SEQ ID NOs: 13-15, respectively), PCDHGB7 gene methylation-specific primers and probes (sequences shown in SEQ ID NOs: SEQ ID NOs: 16-18), specific primers and probes for the ACTB internal reference gene (sequences shown in SEQ ID NOs: 19-21, respectively); PCR reaction solution including: PCR reaction buffer, dNTPs, nuclease-free water, and Taq enzyme;

[0067] Step 3: Determine whether the sample to be tested is methylated based on the fluorescence Ct value of the amplification results of the target genes JAM3, PAX1, ZNF582, SOX1, Septin9, PCDHGB7 and the internal reference gene ACTB.

[0068] As a preferred embodiment, the reaction procedure of PCR amplification is: denaturation at 95°C for 5 minutes; cycling for 45 cycles, 95°C for 15 seconds, and 60°C for 30 seconds. It should be noted that the PCR amplification procedure is not limited, and any procedure that can amplify genomic DNA samples is applicable to the present invention.

[0069] Preferably, the 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5.

[0070] Preferably, the 3' end of the probe comprises a fluorescence quenching group, and the fluorescence quenching group includes any one of MGB, BHQ1, BHQ2, and BHQ3.

[0071] As a preferred method, the positive control material is Hela cell line genomic DNA, and the negative control material is 293T cell line genomic DNA.

[0072] As an embodiment, the final concentrations of the components of the primer-probe mixture 1 are: 0.4-0.6 μM JAM3 forward primer, 0.4-0.6 μM JAM3 reverse primer, 0.2-0.3 μM JAM3 detection probe, 0.4-0.6 μM PAX1 forward primer, 0.4-0.6 μM PAX1 reverse primer, 0.2-0.3 μM PAX1 detection probe, 0.4-0.6 μM ZNF582 forward primer, 0.4-0.6 μM ZNF582 reverse primer, and 0.2-0.3 μM ZNF582 detection probe. The final concentrations of primer-probe mix 2 are: 0.4-0.6 μM SOX1 forward primer, 0.4-0.6 μM SOX1 reverse primer, 0.2-0.3 μM SOX1 detection probe, 0.4-0.6 μM Septin9 forward primer, 0.4-0.6 μM Septin9 reverse primer, 0.2-0.3 μM Septin9 detection probe, 0.4-0.6 μM PCDHGB7 forward primer, 0.4-0.6 μM PCDHGB7 reverse primer, 0.2-0.3 μM PCDHGB7 detection probe. The final concentrations of the PCR reaction mixture are: 1X PCR buffer, 0.2-0.5 mM dNTPs, nuclease-free water, and 0.05-0.2 U / μL Taq enzyme. It should be noted that the reagent formulas of the primer-probe mixture and the reaction solution are not limited. What is provided here is only a preferred embodiment. Other reaction solution formulas that can cooperate with sample DNA amplification are also applicable to the present invention.

[0073] It should be emphasized here that the detection method of the present invention is not limited, and any detection method using the nucleic acid composition of the present invention is within the scope of protection of the present invention.

[0074] In order to more clearly demonstrate the technical solution of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0075] Example 1: Screening of nucleic acid compositions

[0076] To verify the detection effect of the primer-probe combination for cervical cancer gene methylation detection, 20 clinically positive (P1-20) and 10 clinically negative (N1-10) cervical exfoliated cell samples were tested using primer probes for 6 targets (refer to Example 2 for specific sequences). The specific results are shown in Table 1, where "1" represents a positive test and "0" represents a negative test.

[0077] Table 1 Single-plex experiment results

[0078]

[0079] Based on the results in Table 1, the statistical analysis results are shown in Table 2. As shown in Table 2, the single primer-probe combination provided by the present invention has a detection sensitivity between 65.0% and 75.0%, and a specificity between 90.0% and 100.0%. Combining targets can improve detection effectiveness, with the three-gene combination of PAX1, JAM3, ZNF582, and Septin9, SOX1, and PCDHGB7 performing particularly well, with a sensitivity of 95.0% and a specificity of 90%.

[0080] Table 2 Statistics of single-plex experiment results

[0081]

[0082] Based on the analysis of single-tube testing for single-gene, single-site cervical cancer, this testing method is time-consuming, labor-intensive, and carries a high risk of contamination. However, testing multiple genes in the same tube can significantly reduce reagent and consumables, lower the risk of experimental contamination, and reduce labor costs. DNA samples from 20 clinically positive (P1-20) and 10 clinically negative (N1-10) cervical exfoliated cell samples were used as templates to test the effectiveness of single-tube multiplex PCR. It was found that the primer-probe combinations of JAM3, PAX1, and ZNF582 in one tube and SOX1, Septin9, and PCDHGB7 in one tube had the least interference between primers. The results of these optimal combinations are shown in Table 3. The sensitivity of the single-tube multiplex PCR decreased slightly compared to singleplex PCR, but significantly improved compared to singleplex primer-probe combinations. Therefore, the primer-probe combinations of JAM3, PAX1, and ZNF582 and SOX1, Septin9, and PCDHGB7 were selected for further study.

[0083] Table 3 Statistics of multiplex PCR experimental results

[0084]

[0085] Example 2: Kit Preparation

[0086] 1. The first nucleic acid composition comprises: 0.8 μM JAM3 forward primer, 0.8 μM JAM3 reverse primer, 0.6 μM JAM3 detection probe, 0.8 μM PAX1 forward primer, 0.8 μM PAX1 reverse primer, 0.6 μM PAX1 detection probe, 0.8 μM ZNF582 forward primer, 0.8 μM ZNF582 reverse primer, 0.6 μM ZNF582 detection probe, 0.6 μM ACTB forward primer, 0.6 μM ACTB reverse primer, 0.4 μM ACTB detection probe;

[0087] JAM3 gene methylation-specific primers and probes include:

[0088] Forward primer (5'-3'): TGTGTCGGTTTAGAGTATCGTTGTATTC (SEQ ID NO: 1),

[0089] Reverse primer (5'-3'): ACCTACCAAAACCCTACGACCCG (SEQ ID NO: 2),

[0090] Detection probe (5'-3'): ACGACCGCCGAACCCAACCGAACCG (SEQ ID NO: 3), the 5' end is modified with the fluorescent group FAM, and the 3' end is labeled with the fluorescence quencher group BHQ1;

[0091] PAX1 gene methylation-specific primers and probes include:

[0092] Forward primer (5'-3'): TAGTCGCGGGTTGGAGACGC (SEQ ID NO: 4),

[0093] Reverse primer (5'-3'): ACGACGACGACAAACCCTAAAACG (SEQ ID NO: 5),

[0094] Detection probe (5'-3'): ACGACAACGCGCTCCGCTACCGCG (SEQ ID NO: 6), the 5' end is modified with the fluorescent group ROX, and the 3' end is labeled with the fluorescence quencher group BHQ1;

[0095] ZNF582 gene methylation-specific primers and probes include:

[0096] Forward primer (5'-3'): ATCGGTGTGTTTTGTGCGTTTGC (SEQ ID NO: 7),

[0097] Reverse primer (5'-3'): CAAAACGCGCTTCCACCACG (SEQ ID NO: 8),

[0098] Detection probe (5'-3'): CCGATAAATTCGCCGTACGCAACCG (SEQ ID NO: 9), the 5' end is modified with the fluorescent group CY5, and the 3' end is labeled with the fluorescence quencher group BHQ2;

[0099] ACTB internal reference gene-specific primers and probes include:

[0100] Forward primer (5'-3'): GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 19),

[0101] Reverse primer (5'-3'): CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 20),

[0102] Detection probe (5'-3'): ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 21), the 5' end is modified with the fluorescent group VIC, and the 3' end is labeled with the fluorescence quencher group BHQ1;

[0103] 2. The second nucleic acid composition comprises: 0.8 μM SOX1 forward primer, 0.8 μM SOX1 reverse primer, 0.6 μM SOX1 detection probe, 0.8 μM Septin9 forward primer, 0.8 μM Septin9 reverse primer, 0.6 μM Septin9 detection probe, 0.8 μM PCDHGB7 forward primer, 0.8 μM PCDHGB7 reverse primer, 0.6 μM PCDHGB7 detection probe, 0.6 μM ACTB forward primer, 0.6 μM ACTB reverse primer, 0.4 μM ACTB detection probe;

[0104] SOX1 gene methylation-specific primers and probes include:

[0105] Forward primer (5'-3'): TTGGAGGTCGTTGAGGATCGAGC (SEQ ID NO: 10),

[0106] Reverse primer (5'-3'): ACGATACGCTAAACCCGACCCG (SEQ ID NO: 11),

[0107] Detection probe (5'-3'): CTCGCCGACCGCCGCTACGCG (SEQ ID NO: 12), with the 5' end modified with the fluorescent group FAM and the 3' end labeled with the fluorescence quencher group BHQ1;

[0108] Septin9 gene methylation-specific primers and probes include:

[0109] Forward primer (5'-3'): TCGTATGTTCGTTTTGCGTTTTTCG (SEQ ID NO: 13),

[0110] Reverse primer (5'-3'): ATTCTCTATCACCGCCGCCGCG (SEQ ID NO: 14),

[0111] Detection probe (5'-3'): CCTACAAAAATTAAACGACAACGCACGCG (SEQ ID NO: 15), with the 5' end modified with the fluorescent group ROX and the 3' end labeled with the fluorescence quencher group BHQ1;

[0112] PCDHGB7 gene methylation-specific primers and probes include:

[0113] Forward primer (5'-3'): TTAGCGAGAATTCGAGCGAAC (SEQ ID NO: 16),

[0114] Reverse primer (5'-3'): TCGAATAACGAATCGACTCACACAACG (SEQ ID NO: 17),

[0115] Detection probe (5'-3'): TAGAGGCGTCGGGTCGGTTCGCG (SEQ ID NO: 18), with the 5' end modified with the fluorescent group CY5 and the 3' end labeled with the fluorescence quencher group BHQ2;

[0116] ACTB internal reference gene-specific primers and probes include:

[0117] Forward primer (5'-3'): GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 19),

[0118] Reverse primer (5'-3'): CCAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 20),

[0119] Detection probe (5'-3'): ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 21), the 5' end is modified with the fluorescent group VIC, and the 3' end is labeled with the fluorescence quencher group BHQ1;

[0120] 3. Selection of positive and negative quality control materials: The positive quality control material is Hela cell line genomic DNA, and the negative quality control material is 293T cell line genomic DNA;

[0121] 4. PCR reaction solution includes: PCR reaction buffer, dNTP, nuclease-free water, Taq enzyme; the final concentration of PCR reaction solution components is: 1X PCR buffer, 0.4mM dNTP, nuclease-free water, 0.1U / μl Taq enzyme.

[0122] Example 3: PCR detection method for methylation of cervical cancer-related genes

[0123] A pair of specific primers and probes are designed from the promoter regions of cervical cancer-related genes and reference genes in the human genome. These primers and probes are then used to amplify bisulfite-converted sample DNA. The relative fluorescence (Ct) value of the PCR amplification results of the relevant genes is used to determine whether the sample is methylated, and the risk of cervical cancer is indirectly determined based on the methylation.

[0124] The specific detection methods are as follows:

[0125] Step 1: Extract the DNA from the sample and perform bisulfite conversion on it. The converted DNA is used as a template for qPCR amplification. The conversion reagents used are bisulfite or bisulfite and other auxiliary reagents (the corresponding reagents are purchased from the Epitect Fast Bisulfite Conversion Kit of QIAGEN, Germany).

[0126] Step 2: Provide the kit for detecting methylation of cervical cancer-related genes described in Example 2, and perform PCR amplification on the template. The details are as follows:

[0127] 1. Remove all components of the kit and place them at room temperature. After the temperature has equilibrated to room temperature, thaw the PCR reaction solution and the first nucleic acid composition / second nucleic acid composition (see Table 4) according to the sample size of the subject and the quality control sample.

[0128] 2. Vortex the PCR reaction solution and the first nucleic acid composition / second nucleic acid composition for 10-15 seconds and centrifuge briefly;

[0129] 3. Preparation of PCR pre-reaction solution: For the number of cells to be tested, add the corresponding volume of PCR reaction solution and DNA polymerase according to the ratio in Table 4 to a centrifuge tube, vortex to mix, and centrifuge briefly to remove the droplets from the tube wall;

[0130] 4. PCR reaction plate preparation: Immediately dispense the prepared PCR pre-reaction solution into the PCR reaction plate at a volume of 15 μL / well. Add 10 μL of bisDNA (bisDNA) chemically converted from the test sample, the positive control, and the negative control to the respective PCR amplification reaction wells, and seal with sealing film.

[0131] Table 4 Preparation of PCR Master Mix

[0132] Reagents Primer probe mix 1 / primer probe mix 2 PCR reaction solution Volume (μL) 5.5×n 11×n

[0133] 5. Place the 96-well PCR plate into the sample slot of the PCR instrument and record the placement order. Set the Passive Reference to None and set the reaction program as shown in Table 5.

[0134] Table 5 Reaction procedure

[0135]

[0136] Step 3: Based on the target genes JAM3, PAX1, ZNF582, SOX1, Septin9, PCDHGB7 and internal reference genes

[0137] The fluorescence Ct value of the ACTB amplification result is used to determine whether the sample to be tested is methylated. The details are as follows:

[0138] 1. Calculate the ΔCt value: ΔCt value = target gene Ct value - internal reference Ct value (ΔCt = Ct(FAM / ROX / CY5) - Ct(VIC)). The target gene Ct value refers to the Ct value corresponding to the target gene signal (FAM / ROX / CY5 signal) of the sample; the internal reference Ct value refers to the Ct value of the internal reference signal (VIC signal) corresponding to the sample.

[0139] 2. Determination of sample PCR test results: After determining the Ct value and ΔCt value according to the above steps, use the following method to determine: when the Ct value of the internal reference ACTB is ≥35, the result is invalid; when the Ct value of the internal reference ACTB is <35, the result is valid. If there is any peak in the target gene and the ΔCt value is <8, the sample is judged as positive; otherwise, it is judged as negative.

[0140] Based on the specific experimental data of the present invention, see Figures 1-8 ,in, Figure 1 This is the amplification curve of the JAM3 gene methylation-positive sample of the present invention; Figure 2 This is the amplification curve of the PAX1 gene methylation-positive sample of the present invention; Figure 3 This is a graph showing amplification of a ZNF582 gene methylation-positive sample according to the present invention; Figure 4 This is the amplification curve of the SOX1 gene methylation-positive sample of the present invention; Figure 5 This is the amplification curve of the Septin9 gene methylation-positive sample of the present invention; Figure 6 This is a graph showing the amplification curve of a PCDHGB7 gene methylation-positive sample of the present invention; Figure 7 This is the amplification curve of the negative sample of the present invention; it can be seen that the amplification curve relationship between the methylated genes related to cervical cancer and the ACTB internal reference gene in different methylated samples is shown. If there is no amplification curve for both the target gene and the internal reference gene, Figure 8 , indicating that the sample is unqualified and needs to be tested again or resampled.

[0141] Example 4: Validation of the kit's effectiveness using a large number of clinical samples

[0142] Using a negative colposcopy and / or histopathological result as the clinical reference standard, 142 negative cases, 47 CIN1 cases, 22 CIN2 cases, and 13 ≥CIN3 cases were selected for testing. DNA was extracted from each sample. DNA extraction can be performed using any standard method known in the art. Specifically, in this case, the sample DNA was extracted using a specific extraction protocol according to the detection system described in Example 3.

[0143] The DNA sample is pretreated to convert unmethylated cytosine at the 5' position to uracil. In this example, this pretreatment is achieved by treatment with a bisulfite reagent. Bisulfite DNA modification is performed by conversion pretreatment using the detection system described in Example 3.

[0144] DNA samples from 142 pre-treated negative cases and 82 cervical cancer cases were added to the detection system described in Example 3 for multiplex detection of JAM3, PAX1, ZNF582, SOX1, Septin9, PCDHGB7, and the reference gene ACTB. Real-time PCR was performed on bisulfite-converted DNA.

[0145] The PCR conditions used in the experimental case were based on the qPCR conditions in Example 2.

[0146] The results are shown in Table 6, which shows the results of testing 142 negative cases and 82 cervical cancer case samples using the multiplex assay of the present invention.

[0147] Table 6 Detection results of exfoliated cell samples from cervical cancer patients using the kit of the present invention

[0148] Clinical classification Number of cases Detected positive Negative Negative 142 1 141 CIN1 47 11 36 CIN2 22 19 3 CIN3+ 13 12 1 total 224 43 181

[0149] Taking CIN2 as the clinical diagnostic cutoff, the results are shown in Table 7. The clinical sensitivity of the in vitro diagnostic reagent was 88.57%, the specificity was 93.65%, the positive predictive value was 72.09%, the negative predictive value was 97.79%, and the overall compliance rate reached 92.86%.

[0150] Table 7 Statistical results using CIN2 as the clinical diagnostic cutoff

[0151]

[0152] Taking CIN3+ as the clinical diagnostic cutoff, the results are shown in Table 8. The clinical sensitivity of the in vitro diagnostic reagent was 92.31%, the specificity was 85.31%, the positive predictive value was 27.91%, the negative predictive value was 99.45%, and the overall compliance rate reached 85.71%.

[0153] Table 8 Statistical results using CIN3+ as the clinical diagnostic cutoff

[0154]

[0155] The above validation experiments demonstrate that combining JAM3, PAX1, and ZNF582 into a first nucleic acid composition and SOX1, Septin9, and PCDHGB7 into a second nucleic acid composition allows for the detection of three targets in a single reaction system, as well as simultaneous detection of six targets in a single sample. This significantly improves sensitivity and demonstrates a synergistic effect in the detection of methylation in cervical cancer-related genes. The combination of forward primers, reverse primers, and probes specific for JAM3, PAX1, and ZNF582, and for SOX1, Septin9, and PCDHGB7, for simultaneous detection of cervical cancer methylation is an innovative discovery.

[0156] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.

Claims

1. A nucleic acid composition for detecting methylation of cervical cancer-related genes, characterized in that: The nucleic acid composition is a combination of a first nucleic acid composition and a second nucleic acid composition; the first nucleic acid composition includes: a JAM3 gene methylation-specific primer and probe, a PAX1 gene methylation-specific primer and probe, and a ZNF582 gene methylation-specific primer and probe; the second nucleic acid composition includes: a SOX1 gene methylation-specific primer and probe, a Septin9 gene methylation-specific primer and probe, and a PCDHGB7 gene methylation-specific primer and probe; The JAM3 gene methylation-specific primers and probes include: Forward primer: SEQ ID NO: 1, Reverse primer: SEQ ID NO: 2, Probe: SEQ ID NO: 3; The PAX1 gene methylation-specific primers and probes include: Forward primer: SEQ ID NO: 4, Reverse primer: SEQ ID NO: 5, Probe: SEQ ID NO: 6; The ZNF582 gene methylation-specific primers and probes include: Forward primer: SEQ ID NO: 7, Reverse primer: SEQ ID NO: 8, Probe: SEQ ID NO: 9; The SOX1 gene methylation-specific primers and probes include: Forward primer: SEQ ID NO: 10, Reverse primer: SEQ ID NO: 11, Probe: SEQ ID NO: 12; The Septin9 gene methylation-specific primers and probes include: Forward primer: SEQ ID NO: 13, Reverse primer: SEQ ID NO: 14, Probe: SEQ ID NO: 15; The PCDHGB7 gene methylation-specific primers and probes include: Forward primer: SEQ ID NO: 16, Reverse primer: SEQ ID NO: 17, Probe: SEQ ID NO:

18.

2. A nucleic acid composition for detecting methylation of cervical cancer-related genes according to claim 1, characterized in that: The 5' end of the probe contains a fluorescent reporter group, and the fluorescent reporter group includes any one of FAM, VIC, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5.

3. A nucleic acid composition for detecting methylation of cervical cancer-related genes according to claim 1, characterized in that: The 3' end of the probe comprises a fluorescence quenching group, and the fluorescence quenching group comprises any one of MGB, BHQ1, BHQ2, and BHQ3.

4. A nucleic acid composition for detecting methylation of cervical cancer-related genes according to claim 1, characterized in that: The nucleic acid composition also includes ACTB internal reference gene specific primers and probes, The ACTB internal reference gene specific primers and probes include: Forward primer: SEQ ID NO: 19, Reverse primer: SEQ ID NO: 20, Probe: SEQ ID NO:

21.

5. A kit for detecting methylation of cervical cancer-related genes, characterized in that: The kit comprises the nucleic acid composition according to any one of claims 1 to 4, and further comprises a PCR reaction solution, a positive quality control product, and a negative quality control product.

6. A kit for detecting methylation of cervical cancer-related genes according to claim 5, characterized in that: The positive quality control product is methylated cell line genomic DNA.

7. A kit for detecting methylation of cervical cancer-related genes according to claim 5, characterized in that: The negative quality control product is unmethylated cell line genomic DNA.

Images