An oligonucleotide probe for streptococcus thermophilus and its preparation method and application

Abstract

The application relates to the technical field of biological detection, in particular to a Streptococcus thermophilus oligonucleotide probe and a preparation method and application thereof; the oligonucleotide probe has a nucleotide sequence as shown in SEQ ID NO. 1. The V1 region of the 16S rRNA gene has conservation and specificity, the V1 region of the 16s rRNA sequence of the Streptococcus thermophilus is used as a target gene, a plurality of oligonucleotide probes with a length of 20 bp are designed, the non-specificity of the oligonucleotide probe can be effectively reduced, then the oligonucleotide probes are searched and analyzed in a nucleotide sequence library, oligonucleotide probes meeting the requirements of fluorescence in situ hybridization can be screened out, finally, the oligonucleotide probes are actually detected by using a plurality of strains, and the oligonucleotide probes with higher specificity can be screened out and combined with the Streptococcus thermophilus of a sample to be detected, so that the accuracy of the oligonucleotide probe in fluorescence in situ hybridization and flow analysis technology can be improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, in particular to an oligonucleotide probe for Streptococcus thermophilus, a preparation method and application thereof. BACKGROUND

[0002] Streptococcus thermophilus, which is classified as a subspecies level, plays an important role in the field of food. In addition to the health property of probiotic effect, Streptococcus thermophilus also has a probiotic effect in food. In the food standard related to the definition of yogurt concept, Streptococcus thermophilus is also a necessary strain. The existing standard clearly stipulates that the viable count of lactic acid bacteria in fermented milk should not be less than 1×10 6 CFU / g (mL). For live bacteria type fermented milk, whether in the production process of fermented milk or during the sales period, the effectiveness of probiotic food depends largely on the viable count, so the viable count is a necessary parameter for evaluating the quality of such food. How to realize the rapid and accurate quantification of the viable count of lactic acid bacteria in fermented milk is very important. The most commonly used standard method for counting lactic acid bacteria at the present stage is still the traditional culture counting method, but this method has a long detection period and low efficiency, and the shelf life of live bacteria type fermented milk is short, which needs to be quickly put into the market after production. Therefore, the traditional culture counting method cannot meet the demand of rapid counting of the viable count of live bacteria type fermented milk, so it is very important to establish a rapid and accurate detection method for the viable count of Streptococcus thermophilus in food.

[0003] The current rapid detection method for Streptococcus thermophilus is mainly fluorescence in situ hybridization (FISH). FISH is a molecular biology method that utilizes the principle of base complementary pairing to make oligonucleotide probes containing fluorescent groups enter bacteria. At this time, the oligonucleotide probe and the target DNA or RNA in the bacteria will form a hybrid under the action of hybridization buffer, and then the fluorescence signal emitted by the fluorescent group coupled to the probe is detected, thereby realizing the detection of specific bacteria. In addition, the number of ribosomes in bacterial cells is generally 10 4 ~ 10 5and highly conserved regions, and only a small number of nucleotide sequences in certain positions are changed, and these changes are generally species-specific. In addition, rRNA has more molecular information and is about 1500 bp in length, which is at a relatively moderate length level, and these characteristics make 16S rRNA sequence the most ideal target sequence for gene classification. Therefore, according to the conservation and specificity of 16s rRNA sequence, oligonucleotide probes of different classification levels can be designed. At present, oligonucleotide probes for bacterial 16s rRNA sequence are generally at the genus level, and specific comparison of these oligonucleotide probes with the core nucleotide sequence library of all bacterial species in NCBI can find that these oligonucleotide probes can achieve more than 90% specific binding effect. In addition, at this level, specific comparison of bacterial 16s rRNA sequence oligonucleotide probes with the core nucleotide sequence library of all bacterial species in NCBI can find that these oligonucleotide probes can achieve more than 80% specific binding effect. In addition, the current technology for detecting the type and quantity of live bacteria is flow cytometry (FCM); FCM is a technology for high-efficiency and multi-parameter analysis of cells in liquid phase by flow cytometry, and flow cytometry is a sensor for flowing and measuring cells or subcellular particles suspended in liquid, which generally consists of three parts: liquid flow system, optical system and analysis system. Therefore, if FCM technology and FISH technology are combined, the type and quantity of Streptococcus thermophilus can be effectively determined, but there is no specific oligonucleotide probe for this combined technology at present.

[0004] The current detection techniques of Streptococcus thermophilus include: (1) According to the content of GB4789.35—2016 "National food safety standard Food microbiological examination Lactic acid bacteria test", using pouring plate method and using MC medium, Streptococcus thermophilus is cultured in aerobic environment at 35℃-37℃ for 70h-74h, and then counted after culture. (2) Real-time fluorescent quantitative PCR method for identification of Streptococcus thermophilus, the specific steps are as follows: first, using Primer Express V3.0 software to design corresponding primers and probes with Streptococcus thermophilus target gene RecA as candidate target gene; second, labeling probe, respectively marking FAM fluorescent group at 5' end of probe, then marking TAMRA quenching group at 3' end; third, according to the operation manual of bacterial genome DNA extraction kit, extract the genomic DNA of bacteria to obtain the target gene; fourth, use the designed primers and labeled probes to amplify the target gene by real-time fluorescent quantitative PCR, the amplification parameters are as follows: 50℃, 2min; 95℃, 10min; 95℃, 5s; 60℃, 40s; collect carboxyfluorescein fluorescence signal during amplification, 40 cycles in the amplification process, and the total amplification and detection time is about 2.5 hours; fifth, analyze the data: the exponential phase of real-time fluorescent quantitative PCR amplification curve is obvious, determine the Ct value of amplification product, if Ct value<35, it is directly determined as positive; if Ct value is 35-40, it is determined as suspicious sample, which needs to be repeated to determine the sample again; if Ct value>40, it is determined as negative. (3) Real-time fluorescent quantitative PCR method for identification of Streptococcus thermophilus, the specific steps are as follows: first, prepare probe, design oligonucleotide probe for 23s rRNA sequence of Streptococcus thermophilus, then detect the specificity of the probe by 12 kinds of bacteria detection. And through Blast search, confirm that the designed oligonucleotide probe sequence matches Streptococcus thermophilus. The specific oligonucleotide probe is: STH23 probe 5-CATGCCTTCGCTTACGCT-3; second, label probe, use CY3 fluorescent group to label the designed oligonucleotide probe; third, sample fixation, use 4% polyformaldehyde (4%) with a mass concentration of 4% at 4℃ for 3h-16h; fourth, hybridization, hybridize the oligonucleotide probe and the fixed sample in the hybridization buffer solution with the addition of 20% formamide solution at 46℃ hybridization temperature for 2h; fifth, remove impurities, remove the unbound oligonucleotide probe after hybridization of the fixed sample through a series of washing steps; sixth, detect fluorescence signal to determine the type of bacteria.Step 7: The hybridized Streptococcus thermophilus is fixed in 0.1M PBS solution containing 5% glutaraldehyde and 2% osmium tetroxide at 4℃ for 8h, and then the fixed product is washed with 0.1M PBS solution to obtain a suspension, and the suspension is carefully smeared on the surface of a polycarbonate film with a diameter of 25mm, and then the polycarbonate film is immersed in liquid nitrogen for ice bath to obtain a frozen sample. Step 8: The polycarbonate film of the frozen sample is detected by using a scanning electron microscope (SEM) of JEOL JSM5410 type under the condition of 20kV voltage.

[0005] 5-CATGGCCTTCGCTTACGTC-3; Step 2: labeling the probe, using DNA probe isotope ([gamma32P]ATP) kinase to label the 5' end; Step 3: extracting nucleic acid from the pure culture of the test strain by using fast lysis technology, and denaturing the extracted crude nucleic acid at 55℃ for 5min; Step 4: combining the denatured nucleic acid with a nylon membrane in a dot blotting instrument, and fixing the nucleic acid on the membrane by heating at 80℃ for 2h; Step 5: incubating the nylon membrane with fixed nucleic acid in a salt standard solution at room temperature for 1h, and then pre-hybridizing in a pre-hybridization buffer containing specific components at 38℃ for 2h; Step 6: hybridizing in the pre-hybridization solution containing 5pmol of labeled probe for 4h; Step 7: washing the nylon membrane in a 2xSSC solution containing 0.1% SDS at room temperature for 5min twice, and then washing at a specific temperature of 54℃ related to the probe; Step 8: detecting the fluorescence signal to determine the type of bacteria. The intensity, position and quantity of the fluorescence signal are analyzed by autoradiography, and the position and quantity of the target in Streptococcus thermophilus are determined. SUMMARY

[0006] The present application provides an oligonucleotide probe for Streptococcus thermophilus, a preparation method and application thereof, so as to solve the technical problem of how to improve the accuracy of the oligonucleotide probe under the conditions of fluorescence in situ hybridization and flow cytometry analysis.

[0007] In a first aspect, the present application provides an oligonucleotide probe for Streptococcus thermophilus, which has a nucleotide sequence as shown in SEQ ID NO. 1.

[0008] Optionally, the 5' end of the oligonucleotide probe is connected with a fluorescent group; the fluorescent group includes at least one of the following: Alexa Flour 488, 6-carboxyfluorescein, hexachlorofluorescein, cyanine 3, Alexa Flour 555, carboxytetramethylrhodamine, disulfonic acid diethyl, and Alexa Flour 647.

[0009] In a second aspect, the embodiments of the present application provide a method for preparing the oligonucleotide probe of the first aspect, the method comprising:

[0010] Taking the 16s rRNA sequence of Streptococcus thermophilus as a sample, the oligonucleotide probe is designed in the V1 region of the sample, and a plurality of groups of preset probes are obtained;

[0011] According to the principle of whether it meets the requirements of fluorescence in situ hybridization, the plurality of groups of preset probes are searched and analyzed on different nucleotide sequence libraries to obtain a primary screening probe;

[0012] The primary screening probe is subjected to specificity analysis using a plurality of bacterial species, and the probe with the highest specificity is selected to obtain an oligonucleotide probe with SEQ ID NO. 1.

[0013] Optionally, the length of the plurality of groups of preset probes is ≥20bp; and / or

[0014] The number of bacterial species is ≥30.

[0015] In a third aspect, the embodiments of the present application provide a kit for detecting Streptococcus thermophilus, the kit comprising the oligonucleotide probe of the first aspect.

[0016] In a fourth aspect, the embodiments of the present application provide a detection method for Streptococcus thermophilus for the purpose of non-disease diagnosis and treatment, the detection method comprising:

[0017] Resuspend the sample to be detected to obtain a resuspended bacteria solution;

[0018] Purify the resuspended bacteria solution to obtain a bacteria resuspension;

[0019] Incubate the hybridization buffer, the bacteria resuspension, and the oligonucleotide probe of the first aspect to obtain a hybridization product;

[0020] Centrifuge and resuspend the hybridization product multiple times to obtain a hybridization sample to be detected;

[0021] Perform flow analysis on the hybridization sample to be detected to determine the type and quantity of the hybridization sample to be detected.

[0022] Optionally, the mass m1 of the oligonucleotide probe, the volume V1 of the hybridization buffer, and the volume V2 of the bacterial cell resuspension satisfy the relationship: m1:(V1+V2)≥6:1, wherein the unit of m1 is ng, and the units of V1 and V2 are both μL.

[0023] The volume V1 of the hybridization buffer and the volume V2 of the bacterial cell resuspension satisfy the relationship: V1:V2≤9:1.

[0024] Optionally, the components of the hybridization buffer include sodium chloride, tris-hydroxymethyl aminomethane hydrochloride, sodium dodecyl sulfate, and formamide, the molar concentration of the sodium chloride is 0.9 mol / L, the molar concentration of the tris-hydroxymethyl aminomethane hydrochloride is 20 mmol / L, the mass m2 of the sodium dodecyl sulfate and the volume V3 of the hybridization buffer satisfy the relationship: m2:V3=0.1:100, wherein the unit of m2 is g, and the unit of V3 is L, and the mass m3 of the formamide and the volume V4 of the hybridization buffer satisfy the relationship: m3:V4=25:100.

[0025] Optionally, the temperature of the incubation is 46℃, and the time of the incubation is 50 min.

[0026] Optionally, the purification treatment of the to-be-tested bacterial resuspension to obtain the bacterial cell resuspension includes the steps of:

[0027] Mixing the propidium iodide bromide solution and the to-be-tested bacterial resuspension to obtain a mixed solution;

[0028] Sequentially performing light and dark alternation on the mixed solution, so that the dead bacteria of Streptococcus thermophilus in the mixed solution combine with the propidium iodide bromide to form a precipitate, to obtain a decontaminated mixed solution;

[0029] Performing sample fixation and centrifugal resuspension on the decontaminated mixed solution to obtain the bacterial cell resuspension; wherein the reagent used for the sample fixation is alcohol with a mass concentration of 75%.

[0030] Compared with the prior art, the above technical solution provided by the embodiments of the present application has the following advantages:

[0031] The oligonucleotide probe for Streptococcus thermophilus provided by the embodiment of the application has both conservation and specificity based on the V1 region of the 16S rRNA gene, a plurality of oligonucleotide probes with a length of 20 bp are designed by taking the V1 region of the 16s rRNA sequence of Streptococcus thermophilus as the target gene, the oligonucleotide probe with this length can effectively reduce the non-specificity of the oligonucleotide probe, then the oligonucleotide probes are searched and analyzed in the nucleotide sequence library, oligonucleotide probes meeting the requirements of fluorescence in situ hybridization can be screened out, and finally a plurality of strains are used to actually detect the oligonucleotide probes to screen out oligonucleotide probes with higher specificity, the oligonucleotide probes with higher specificity can be combined with the Streptococcus thermophilus to be detected sufficiently, so that the accuracy of the oligonucleotide probes in fluorescence in situ hybridization and flow analysis technology can be improved. BRIEF DESCRIPTION OF DRAWINGS

[0032] The drawings incorporated in the specification and constituting a part of the specification illustrate embodiments consistent with the present application and, together with the specification, serve to explain the principles of the present application.

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced as follows, and obviously, other drawings can also be obtained by those skilled in the art without any creative labor on the basis of these drawings.

[0034] Figure 1 The flowchart of the method for preparing the oligonucleotide probe provided by the embodiment of the present application is shown in the figure.

[0035] Figure 2 The flowchart of the detection method for Streptococcus thermophilus for the purpose of non-disease diagnosis and treatment provided by the embodiment of the present application is shown in the figure.

[0036] Figure 3 The detailed flowchart of the detection method for Streptococcus thermophilus for the purpose of non-disease diagnosis and treatment provided by the embodiment of the present application is shown in the figure.

[0037] Figure 4 The probe detection time comparison result graph of different detection methods provided by the present application is shown in the figure.

[0038] Figure 5 The specificity comparison result graph of the detection method provided by the embodiment 2 of the present application in the detection process of Streptococcus thermophilus and other non-Streptococcus thermophilus is shown in the figure, wherein, Figure 5 A is the specificity detection result graph of Streptococcus thermophilus, Figure 5 B is the specificity detection result graph of other non-Streptococcus thermophilus, in the figure, red is the negative control without adding the oligonucleotide probe, and blue is the positive result of adding the oligonucleotide probe.

[0039] Figure 6 The detection results of the oligonucleotide probes of Example 1 and Comparative Example 3 in different bacteria are compared in the following figures, wherein, Figure 6 A is the detection result of the oligonucleotide probe of Example 1 in Streptococcus thermophilus CICC6038, Figure 6 B is the detection result of the oligonucleotide probe of Comparative Example 3 in Streptococcus thermophilus CICC6038, Figure 6 C is the detection result of the oligonucleotide probe of Example 1 in Lactobacillus delbrueckii subsp. bulgaricus HH LB57, Figure 6 D is the detection result of the oligonucleotide probe of Comparative Example 3 in Lactobacillus delbrueckii subsp. bulgaricus HH LB57, Figure 6 E is the detection result of the oligonucleotide probe of Example 1 in Escherichia coli ATCC 13706, Figure 6 F is the detection result of the oligonucleotide probe of Comparative Example 3 in Escherichia coli ATCC 13706, wherein red is the negative control without the oligonucleotide probe, and blue is the positive result with the oligonucleotide probe;

[0040] Figure 7 The detection results of the detection methods of Example 2 and Comparative Example 1 in different samples of the ratio of live bacteria to dead bacteria of Streptococcus thermophilus are compared in the following figures;

[0041] Figure 8 The correlation curve of the detection results of the detection methods of Example 2 and Comparative Example 1 is shown in the following figure;

[0042] Figure 9 The results of the repeatability experiment of the detection method provided in Example 2 are shown in the following figure;

[0043] Figure 10 The influence of different concentrations of formamide on the detection results of Streptococcus thermophilus in the detection methods of Example 2, Comparative Example 5 and Comparative Example 6 is shown in the following figures, wherein, Figure 10 A is the influence of no formamide on the detection of Streptococcus thermophilus in Comparative Example 5, Figure 10 B is the influence of 25% formamide on the detection of Streptococcus thermophilus in Example 2, Figure 10 C is the influence of 50% formamide on the detection of Streptococcus thermophilus in Comparative Example 6, wherein red is the negative control without the oligonucleotide probe, and blue is the positive result with the oligonucleotide probe;

[0044] Figure 11 The influence of different sample fixing reagents on the detection results of Streptococcus thermophilus in the detection methods of Example 2 and Comparative Example 7 is shown in the following figure, wherein, Figure 11Figure 7 is a chart showing the effect of adding paraformaldehyde to fix the reagent on the detection results of Streptococcus thermophilus in Comparative Example 7, Figure 11 Figure 8 is a chart showing the effect of adding 75% alcohol on the detection results of Streptococcus thermophilus in Example 2, in which red is a negative control without adding oligonucleotide probe, and blue is a positive result with the addition of oligonucleotide probe;

[0045] Figure 12 Figure 9 is a chart showing the effect of different incubation temperature conditions provided in the present application on the detection results of Streptococcus thermophilus;

[0046] Figure 13 Figure 10 is a chart showing the effect of different incubation time conditions provided in the present application on the detection results of Streptococcus thermophilus;

[0047] Figure 14 Figure 11 is a chart showing the effect of different amounts of oligonucleotide probe added in the present application on the detection results of Streptococcus thermophilus. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical solutions and advantages of the embodiments of the present application clearer, the technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of the present application.

[0049] Various embodiments of the present application can exist in the form of a range; it should be understood that the description in the form of a range is only for the convenience and brevity, and should not be understood as a hard limit on the scope of the present application; therefore, it should be considered that the described range has specifically disclosed all possible sub-ranges and single values in the range; for example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers in the described range, such as 1, 2, 3, 4, 5 and 6, which applies to any range; in addition, whenever a numerical range is indicated in the present application, it refers to any cited number (fraction or integer) in the indicated range.

[0050] In this document, the terms "comprise" and "comprising" and the like refer to "including but not limited to". The terms "first", "second" and the like, as used in the description and the claims, do not imply any physical or logical relationship between the entities or operations so designated. The term "and / or", describing an association between associated objects, means that there can be three relationships: A and / or B, means that A exists alone, A and B exist together, B exists alone. "At least one" means one or more, "multiple" means two or more; "at least one" or "at least one of the following" or the like means any combination of these items, including single or multiple combinations; for example, "at least one of a, b or c", or "at least one of a, b and c", can mean a, b, c, a-b (i.e. a and b), a-c, b-c, or a-b-c, where a, b, c can be single or multiple. "Parts" such as weight parts, mass parts, etc. represent the ratio relationship between components. In the ratio relationship described herein, the parameters that need to be described by the ratio should be understood as the front item of the ratio formula according to the order of description, and the ratio number should be understood as the latter item of the ratio formula, for example, the mass ratio of substance A, substance B and substance C is 1:2:3, then substance A, substance B and substance C should be corresponding to the ratio number in the ratio formula according to the description order, i.e. the mass of substance A: the mass of substance B: the mass of substance C = 1:2:3.

[0051] Unless otherwise specifically stated, the various raw materials, reagents, instruments and equipment used in this document can be purchased on the market or can be prepared by existing methods.

[0052] It should be noted that for the prior art (1) described in the background art, the inventors found that the technology has the following defects: 1. The dilution coating plate method is time-consuming and the detection result needs to wait for 3 days, which makes the detection time longer; 2. The method is easily contaminated by other bacteria during the detection process, so that some bacteria other than Streptococcus thermophilus will grow on the MC medium. For the prior art (2) described in the background art, the inventors found that the technology has the following defects: 1. The technology needs to design three high-specificity sequences of upstream primers, downstream primers and probes; 2. The technology can only accurately identify the live Streptococcus thermophilus, but still has limitations in accurate counting. For the prior art (3) described in the background art, the inventors found that the technology has the following defects: 1. The technology only uses 12 kinds of bacteria to detect the specificity of the probe, which leads to a big loophole in the actual detection specificity of the probe. The inventors of the present application verified the specificity of the probe in the experiment, and found that there were different degrees of combination for Lactobacillus delbrueckii bulgaricus, Escherichia coli and other bacteria; 2. The fixation time and hybridization time of the technology are long, which is not conducive to the development of rapid detection method. In addition, the technology uses SEM to detect the fluorescence signal, which not only requires a high-precision scanning electron microscope in the laboratory, but also has a complicated detection process and a long detection time, which is more not conducive to the development of rapid detection method. 3. The technology can only preliminarily identify the live Streptococcus thermophilus, and has limitations in accurate counting. For the prior art (4) described in the background art, the inventors found that the technology has the following defects: 1. The specificity of the probe designed by the technology is only detected by 10 kinds of bacteria, which leads to a big loophole in the actual detection specificity of the probe. In addition, the inventors of the present application found that the specificity of the probe is very poor by Blast search of the probe sequence; 2. The technology needs to extract nucleic acid, and also needs to fix and denature the nucleic acid on the nylon membrane. This process involves pre-hybridization and hybridization of nucleic acid and nylon membrane, and the overall process is relatively complicated and time-consuming. At the same time, the technology also involves immunoradiography technology to detect the fluorescence signal, which not only requires high equipment in the laboratory, but also needs professional technicians to operate, which is not conducive to the popularization of the technology; 3. The technology cannot accurately count the live bacteria, and the counting result deviates greatly from the actual result.

[0053] Therefore, the existing Streptococcus thermophilus detection method has the defects of low detection accuracy of oligonucleotide probe and difficulty in accurately counting the number of live bacteria.

[0054] The oligonucleotide probe for Streptococcus thermophilus provided by the embodiments of the present application has a nucleotide sequence as shown in SEQ ID NO. 1.

[0055] It should be noted that the design of the oligonucleotide probe has the following advantages:

[0056] 1. Probe design principle: (1) Target selection basis: based on the V1 region of the 16S rRNA gene of Streptococcus thermophilus, which has both conservation and specificity, since the V1 region of the 16S rRNA gene of Streptococcus thermophilus contains 50bp-150bp of nucleotide sequence, its conserved region can be used as a stable binding site for the probe, while the V1 variable region carries less species-specific base differences, which makes this region highly conserved within the species (sequence similarity > 99%) in Streptococcus thermophilus, but there are significant sequence differences between the V1 region and other Streptococcus (such as Group B Streptococcus); (2) Probe parameter optimization: 20bp length design can balance the specificity and melting temperature (Tm value control at 55-65°C) of the probe, and can reduce the probability of non-specific binding of the probe to other impurities;

[0057] 2. Probe screening process: (1) In vitro verification stage: by comparing the designed oligonucleotide probe with ProbeCheck and BLAST nucleotide sequence library to exclude sequence homology with common symbiotic bacteria such as Lactobacillus and Staphylococcus (threshold set at <70%), and further screening based on the requirements of fluorescence in situ hybridization technology, probes with >90% fluorescence intensity after labeling FAM / Cy3 can be screened by fluorescence quenching test; (2) Actual detection verification: 1) Test strains cover: using Streptococcus thermophilus standard strains (such as IMAU20756, GX20231204, etc.), closely related species (such as Streptococcus salivarius, Streptococcus pneumoniae), common contaminants in dairy products (such as Lactococcus lactis, Escherichia coli) and other strains as detection objects, based on flow cytometry quantitative analysis, to determine the binding efficiency of the oligonucleotide probe, and to screen high-specificity probes with signal intensity ratio (target bacteria / non-target bacteria) >10:1.

[0058] 3. Technical advantages and applications: (1) Improved detection performance: the specific oligonucleotide probe can reduce the false positive rate of fluorescence in situ hybridization (FISH) technology, which can reduce the false positive rate of traditional oligonucleotide probes by at least one order of magnitude; (2) High detection accuracy: supports rapid quantification of Streptococcus thermophilus in complex samples (such as yogurt fermentation broth), with low detection limit.

[0059] 4. Industrial application scenarios: (1) Dairy fermentation process monitoring: the oligonucleotide probe can track the metabolic activity and spatial distribution of Streptococcus thermophilus in real time; (2) Probiotic preparation quality control: the oligonucleotide probe can distinguish between target strains and contaminants (such as hemolytic streptococci).

[0060] The oligonucleotide probe for Streptococcus thermophilus provided by the embodiment of the present application, combined with fluorescence in situ hybridization and flow analysis technology system, is verified and screened in multiple dimensions to ensure that the nucleotide probe maintains high specificity in complex microbial communities, and provides a reliable tool for accurate detection of Streptococcus thermophilus.

[0061] In some optional embodiments, the 5' end of the oligonucleotide probe is connected with a fluorescent group; the fluorescent group includes at least one of Alexa Flour 488, 6-carboxyfluorescein, hexachlorofluorescein, cyanine 3, Alexa Flour 555, carboxytetramethylrhodamine, disulfonic acid diethyl, and Alexa Flour 647.

[0062] In these embodiments, the 5' end of the oligonucleotide probe is connected with a fluorescent group, and the fluorescent group can include at least one of Alexa Flour 488, 6-carboxyfluorescein (FAM), hexachlorofluorescein (HEX), cyanine 3 (Cy3), Alexa Flour 555, carboxytetramethylrhodamine (TAMRA), disulfonic acid diethyl (Cy5), and Alexa Flour 647, so that the upstream end of the oligonucleotide probe is connected with a specific fluorescent group, and these fluorescent groups can effectively reflect the binding degree of the oligonucleotide probe in the fluorescence in situ hybridization and flow analysis technology system, and can improve the accuracy of the final determination.

[0063] Figure 1 An example of a method for preparing an oligonucleotide probe provided by the embodiment of the present application is shown in the flowchart;

[0064] Based on a general inventive concept, as Figure 1 The embodiment of the present application provides a method for preparing the oligonucleotide probe, and the method comprises the following steps:

[0065] S1. Taking the 16s rRNA sequence of Streptococcus thermophilus as a sample, designing an oligonucleotide probe in the V1 region of the sample, and obtaining a plurality of groups of preset probes;

[0066] S2. Taking whether meeting the fluorescence in situ hybridization requirement as the principle, searching and analyzing a plurality of groups of the preset probes on different nucleotide sequence libraries to obtain a primary screening probe;

[0067] S3. Using a plurality of bacterial species to analyze the specificity of the primary screening probe, and selecting the probe with the highest specificity to obtain an oligonucleotide probe with SEQ ID NO. 1.

[0068] The method is for the preparation method of the oligonucleotide probe described above, and specific information of the oligonucleotide probe can be referred to the above embodiment. Since the method adopts part or all of the technical solutions of the above embodiment, it at least has all the beneficial effects brought by the technical solutions of the above embodiment, and here is not repeated.

[0069] It should be noted that the requirements of fluorescence in situ hybridization mainly refer to the following characteristics:

[0070] 1. Sequence complementarity: the probe needs to be strictly complementary to the 16s rRNA sequence of Streptococcus thermophilus.

[0071] 2. Specificity: the probe needs to be optimized to exclude homology with non-target sequences to avoid cross-reaction and inaccurate detection results.

[0072] 3. Suitable probe concentration: suitable probe concentration can shorten the process of fluorescence in situ hybridization and reduce material consumption.

[0073] 4. High stability of the probe: high stability of the probe can ensure long-term storage to meet the needs of fluorescence in situ hybridization at different time periods.

[0074] It should be noted that specificity analysis refers to the process of binding between the primary screening probe and different bacterial species and emitting fluorescence signals. Only when the primary screening probe emits fluorescence signals after binding with Streptococcus thermophilus, it can be considered as the probe with the highest specificity.

[0075] In some optional embodiments, the length of the plurality of groups of preset probes is ≥20bp; and / or

[0076] The number of bacterial species is ≥30.

[0077] In these embodiments, the length of the plurality of groups of preset probes can be ≥20bp, so that the oligonucleotide probe with this length can balance the specificity of the probe and the melting temperature (Tm value controlled at 55℃-65℃), and can reduce the probability of non-specific binding of the probe with other impurities, thereby effectively reducing the non-specificity of the oligonucleotide probe. In addition, the number of bacterial species is ≥30, which can effectively avoid cross-reaction of the oligonucleotide probe with other bacterial species, thereby effectively improving the specificity of the oligonucleotide probe.

[0078] Based on a general inventive concept, the embodiments of the present application provide a kit for detecting Streptococcus thermophilus, which comprises the oligonucleotide probe.

[0079] The kit is realized based on the above-mentioned oligonucleotide probe, and specific information of the oligonucleotide probe can be referred to the above-mentioned embodiment. Since the kit adopts part or all of the technical solutions of the above-mentioned embodiment, at least all the beneficial effects brought by the technical solutions of the above-mentioned embodiment are possessed, which will not be repeated here.

[0080] Figure 2 An example of a detection method of Streptococcus thermophilus for non-disease diagnosis and treatment provided by the embodiment of the application is shown in the flowchart;

[0081] Based on a general inventive concept, as Figure 2 shown, the embodiment of the application provides a detection method of Streptococcus thermophilus for non-disease diagnosis and treatment, which comprises:

[0082] S1. Resuspending a sample to be detected to obtain a resuspension liquid of bacteria to be detected;

[0083] S2. Purifying the resuspension liquid of bacteria to be detected to obtain a resuspension liquid of bacteria;

[0084] S3. Incubating a hybridization buffer, the resuspension liquid of bacteria and the oligonucleotide probe to obtain a hybridization product;

[0085] S4. Centrifuging and resuspending the hybridization product for multiple times to obtain a hybridization sample to be detected;

[0086] S5. Performing flow analysis on the hybridization sample to be detected to determine the type and quantity of the hybridization sample to be detected.

[0087] The detection method is realized based on the above-mentioned oligonucleotide probe, and specific information of the oligonucleotide probe can be referred to the above-mentioned embodiment. Since the detection method adopts part or all of the technical solutions of the above-mentioned embodiment, at least all the beneficial effects brought by the technical solutions of the above-mentioned embodiment are possessed, which will not be repeated here.

[0088] It should be noted that the sample to be detected can be pre-processed without losing bacterial activity according to its characteristics to facilitate subsequent resuspension to obtain the resuspension liquid of bacteria to be detected.

[0089] In some optional embodiments, the mass m1 of the oligonucleotide probe, the volume V1 of the hybridization buffer and the volume V2 of the resuspension liquid of bacteria satisfy the relationship: m1:(V1+V2)≥6:1, if the unit of m1 is ng, then the units of V1 and V2 are both μL;

[0090] The volume V1 of the hybridization buffer and the volume V2 of the resuspension liquid of bacteria satisfy the relationship: V1:V2≤9:1.

[0091] In these embodiments, the mass m1 of the oligonucleotide probe, the volume V1 of the hybridization buffer, and the volume V2 of the bacterial cell suspension can satisfy the relationship: m1:(V1+V2)≥6:1, and the volume V1 of the hybridization buffer and the volume V2 of the bacterial cell suspension can satisfy the relationship: V1:V2≤9:1, so that the bacterial cell suspension can be sufficiently mixed with the oligonucleotide probe in the hybridization buffer, and the oligonucleotide probe can be specifically combined with the bacterial cell suspension to determine the species and quantity of the hybridization sample.

[0092] In some alternative embodiments, the components of the hybridization buffer include sodium chloride, tris-hydroxymethyl aminomethane hydrochloride, sodium dodecyl sulfate, and formamide, the molar concentration of the sodium chloride is 0.9 mol / L, the molar concentration of the tris-hydroxymethyl aminomethane hydrochloride is 20 mmol / L, the mass m2 of the sodium dodecyl sulfate and the volume V3 of the hybridization buffer satisfy the relationship: m2:V3=0.1:100, if the unit of m2 is g, the unit of V3 is L, and the mass m3 of the formamide and the volume V4 of the hybridization buffer satisfy the relationship: m3:V4=25:100.

[0093] In these embodiments, the components of the hybridization buffer have the following advantages:

[0094] 1. The role of sodium chloride (0.9 mol / L): (1) regulating ionic strength: a high concentration of sodium chloride promotes the electrostatic binding of the oligonucleotide probe and the target nucleic acid of the bacterial cell suspension by enhancing the ionic strength of the solution, thereby improving the hybridization efficiency; (2) maintaining osmotic pressure balance: compatible with the physiological environment of biological samples (such as cells or bacterial cells), reducing sample damage and maintaining the stability of nucleic acid structure.

[0095] 2. Tris-hydroxymethyl aminomethane hydrochloride (Tris-HCl, 20 mmol / L): (1) stabilizing the pH environment: as the core of the buffer system, it maintains the pH of the hybridization reaction solution in the range of 7.0-7.5, preventing the degradation of nucleic acids due to acid-base fluctuations; (2) synergistic ionic effect: cooperates with sodium chloride to optimize the binding kinetics of the probe-target, reducing non-specific adsorption.

[0096] 3. Sodium dodecyl sulfate (SDS, 0.1 g / L): (1) inhibiting nuclease activity: by destroying the hydrophobic structure of proteins, it inactivates the residual RNase / DNase in the sample, protecting the integrity of the probe and target nucleic acid; (2) reducing background interference: combined with a high-salt environment, it weakens the non-specific binding of sample impurities or lipids to the probe, improving the signal-to-noise ratio.

[0097] 4. Formamide (25% w / v): (1) Lower hybridization temperature: By weakening the strength of nucleic acid double-stranded hydrogen bonds, the hybridization reaction can be carried out under mild conditions of 42-45°C, avoiding the destruction of sample morphology (such as cell structure) by high temperature; (2) Enhance probe penetration: Promote the penetration of the probe through the cell wall / membrane structure (such as gram-positive bacteria or immobilized tissues), and improve the accessibility of in situ hybridization targets.

[0098] 5. Component synergy: The component formula of the hybridization buffer is synergistically designed by optimizing the ionic strength (such as sodium chloride + Tris-HCl), decontamination and protection (SDS), and reaction condition regulation (formamide), which significantly improves the specificity and sensitivity of hybridization, and is suitable for precise detection of complex samples (such as microbial communities or clinical tissue sections).

[0099] In some alternative embodiments, the temperature of the incubation is 46°C, and the time of the incubation is 50 min.

[0100] In these embodiments, the temperature of the incubation can be 46°C, and the time of the incubation can be 50 min, so that the oligonucleotide probe can be specifically combined between the bacteria in the bacteria resuspension in the hybridization buffer, thereby determining the species and quantity of the test hybridization sample.

[0101] Figure 3 An example of a detailed flowchart of a detection method of Streptococcus thermophilus for non-disease diagnosis and treatment provided by the embodiments of the present application is shown;

[0102] In some alternative embodiments, as shown in Figure 3 The purification treatment of the test bacteria resuspension to obtain the bacteria resuspension includes the steps of:

[0103] S201. Mix the propidium azide bromide solution and the test bacteria resuspension to obtain a mixed solution;

[0104] S202. Perform light and dark alternation on the mixed solution in sequence, so that the Streptococcus thermophilus dead bacteria in the mixed solution combine with the propidium azide bromide to form a precipitate, and obtain a decontaminated mixed solution;

[0105] S203. Perform sample fixation and centrifugal resuspension on the decontaminated mixed solution to obtain a bacteria resuspension; wherein the reagent used for the sample fixation is alcohol with a mass concentration of 75%.

[0106] In these embodiments, the use of the propidium azide bromide solution can improve the stability of the test bacteria resuspension, and in addition, through the light and dark alternation method, the precipitate formed by the combination of Streptococcus thermophilus dead bacteria and propidium azide bromide can be removed, so that a decontaminated mixed solution containing live Streptococcus thermophilus bacteria can be obtained, facilitating the subsequent incubation.

[0107] The application will be further described below in connection with specific examples. The experimental methods in the following examples are generally determined according to national standards / industry standards, if there is no corresponding national standard / industry standard, then according to the general international standards, conventional conditions or according to the conditions suggested by the manufacturer.

[0108] Example 1

[0109] As shown in the following, a method for preparing an oligonucleotide probe comprises: Figure 1

[0110] S1. Taking the 16s rRNA sequence of Streptococcus thermophilus as a sample, oligonucleotide probes are designed in the V1 region of the sample by using the ARB-Silva software package, and a plurality of groups of preset probes are obtained;

[0111] S2. According to the principle of whether it meets the requirements of fluorescence in situ hybridization, the plurality of groups of preset probes are searched and analyzed on ProbeCheck and Blast nucleotide sequence library to obtain primary screening probes, and then the primary screening probes are labeled with appropriate fluorescent groups (specifically Cy3, Alexa Flour 488 and Alexa Flour 647);

[0112] S3. The primary screening probes are subjected to specificity analysis using a plurality of bacterial species, and the probe with the highest specificity is selected to obtain the oligonucleotide probe ST1: CGCAACTCATCCAAGAAGAG (SEQ ID NO. 1).

[0113] Example 2

[0114] On the basis of the disclosure of Example 1, the following operations are further performed:

[0115] As shown in the following, a method for detecting Streptococcus thermophilus for the purpose of diagnosis and treatment of non-disease, the detection method comprises: Figure 3

[0116] S1. The sample to be detected is subjected to resuspension treatment to obtain a resuspended bacteria solution;

[0117] S201. Dissolve the propidium monoazide bromide (PMA) with a mass concentration of 20% to obtain a PMA solution with a molar concentration of 20 mmol / L, then mix 2 μL of propidium monoazide bromide solution with 1 mL of resuspended bacteria solution to obtain a mixed solution with a final molar concentration of PMA of 50 μmol / L;

[0118] ​​S202. Mix the mixed solution once per minute, then mix in the dark for 5 min, and then expose it to halogen light for 10 min. Place it on ice during the exposure process to prevent temperature rise during the exposure process. This causes the dead Streptococcus thermophilus in the mixed solution to bind with propidium iodide to form a precipitate, thereby preventing the dead Streptococcus thermophilus from subsequently binding with the oligonucleotide probe in the fluorescence in situ hybridization, so as to ensure that the oligonucleotide probe is fully combined with the live Streptococcus thermophilus, thereby obtaining a purified mixed solution;

[0119] S203. Use alcohol with a mass concentration of 75% to fix the purified mixed solution for 5 min. The fixed purified mixed solution can be stored in a refrigerator at -20°C for a long time until the hybridization experiment is performed for detection. Then, 1 mL of the fixed purified mixed solution is centrifuged at 10,000 g for 3 min, and finally resuspended with 40 μL of PBS solution to obtain a bacterial body resuspension.

[0120] S3. Add 20 μL of the bacterial body resuspension to 180 μL of the hybridization buffer, and add 6 ng / μL of the oligonucleotide probe for incubation, thereby obtaining a hybridization product.

[0121] S4. Centrifuge the hybridization product at 12,000 g for 3 min, resuspend it with 200 μL of the hybridization buffer, and then centrifuge it again to remove the unbound oligonucleotide probe. Finally, resuspend it with a suitable volume of PBS to obtain a to-be-tested hybridization sample. The to-be-tested hybridization sample is allowed to be placed in the dark at room temperature for more than 48 h.

[0122] S5. Perform flow cytometry analysis on the to-be-tested hybridization sample to detect the fluorescence signal. The intensity, position, and number of the fluorescence signal are analyzed by the flow cytometry analyzer to determine the type and number of the to-be-tested hybridization sample.

[0123] The mass m1 of the oligonucleotide probe, the volume V1 of the hybridization buffer, and the volume V2 of the bacterial body resuspension satisfy the relationship: m1:(V1+V2)=6:1. If the unit of m1 is ng, then the units of V1 and V2 are both μL.

[0124] The volume V1 of the hybridization buffer and the volume V2 of the bacterial body resuspension satisfy the relationship: V1:V2=9:1.

[0125] The components of the hybridization buffer include: sodium chloride, Tris-HCl (pH 7.5), sodium dodecyl sulfate and formamide, the molar concentration of sodium chloride is 0.9 mol / L; the molar concentration of Tris-HCl is 20 mmol / L; the mass m2 of sodium dodecyl sulfate and the volume V3 of the hybridization buffer satisfy the relationship: m2:V3=0.1:100, if the unit of m2 is g, then the unit of V3 is L; the mass m3 of formamide and the volume V4 of the hybridization buffer satisfy the relationship: m3:V4=25:100.

[0126] The temperature of the incubation is 46℃, and the time of the incubation is 50 min.

[0127] The flow cytometer in the above step is A50-Micro from Apogee Company, which contains two 20 mW lasers (638 nm laser and 488 nm laser) to analyze the stained sample, and the optical resolution in the small-angle light scattering and large-angle light scattering channels can reach 80 nm, and the performance of the flow cytometer is suitable for the detection of bacteria. Alexa flour 488 can detect green fluorescence at the fluorescence channel FL1 (525 nm), and PMA can detect red fluorescence at FL2 (680 nm). The detection voltages of FL1 and FL2 are 360 V and 400 V, respectively. The flow cytometer should maintain a uniform analysis speed of 10.5 μL / min for sample analysis, the loading volume is 100 μL, and the detection time is 30 s. The results are shown in Figure 4 , the data detection is performed with 488-GRN (green fluorescence channel) as the abscissa and 488-RED (red fluorescence channel) as the ordinate, and each sample is detected 3 times, and the final data is averaged.

[0128] As shown in Figure 4 , the red part covered under the orange part represents the PMA-stained dead bacteria, and the orange part is the state of the bacteria body combined with the oligonucleotide probe after the PMA-stained dead bacteria, and the orange part completely coincides with the red part, which indicates that the PMA-combined dead bacteria will not be combined with the oligonucleotide probe. The blue part is the negative live bacteria control (without adding the oligonucleotide probe), and the green part is the Streptococcus thermophilus positive live bacteria result (adding the oligonucleotide probe). When detecting the number of Streptococcus thermophilus, the green area is circled to determine the number.

[0129] Comparative Example 1

[0130] On the basis of the disclosure in Example 2, the following operations are further performed:

[0131] The prior art (1) described in the background art is used.

[0132] Comparative Example 2

[0133] On the basis of the disclosure of Example 2, the following operations were further performed:

[0134] The prior art (2) described in the background art was used.

[0135] Comparative Example 3

[0136] On the basis of the disclosure of Example 2, the following operations were further performed:

[0137] The prior art (3) described in the background art was used, specifically referring to J, MORENO Y, AMOROCHO C M, et al. A combination of direct viable count and fluorescence in situ hybridization for specific enumeration of viable Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus: DVC-FISH to detect viable LAB [J / OL]. Letters in Applied Microbiology, 2012, 54(3): 247-254

[0138] Comparative Example 4

[0139] On the basis of the disclosure of Example 2, the following operations were further performed:

[0140] The prior art (4) described in the background art was used.

[0141] Comparative Example 5

[0142] On the basis of the disclosure of Example 2, the following operations were further performed:

[0143] Formamide was not added in the hybridization buffer.

[0144] Comparative Example 6

[0145] On the basis of the disclosure of Example 2, the following operations were further performed:

[0146] The mass m3 of formamide and the volume V4 of the hybridization buffer satisfy the relationship: m3:V4 = 50:100.

[0147] Comparative Example 7

[0148] On the basis of the disclosure of Example 2, the following further operations are performed:

[0149] Paraformaldehyde is used instead of alcohol with a mass concentration of 75% to fix the sample.

[0150] Comparative Example 8

[0151] On the basis of the disclosure of Example 2, the following further operations are performed:

[0152] The temperature of the incubation after hybridization is set at 42℃, 44℃, 48℃, 50℃ and 52℃ respectively.

[0153] Comparative Example 9

[0154] On the basis of the disclosure of Example 2, the following further operations are performed:

[0155] The time of the incubation after hybridization is 10min, 20min, 30min, 40min, 60min, 90min and 120min.

[0156] Comparative Example 10

[0157] On the basis of the disclosure of Example 2, the following further operations are performed:

[0158] The mass m1 of the oligonucleotide probe, the volume V1 of the hybridization buffer and the volume V2 of the bacterial cell suspension satisfy the relationship: m1:(V1+V2)=3:1, 4:1, 5:1, 7:1 and 8:1.

[0159] Related experiments and effect data:

[0160] 1. Probe detection time comparison: the total detection time of the technologies recorded in Example 2, Comparative Examples 1 to 4 is compared, and the results are shown in Table 2. Figure 4 Figure 4 It can be seen that the detection method for Streptococcus thermophilus provided by the application for the purpose of non-disease diagnosis and treatment has a time required from sample preparation to sample detection of less than 90min.

[0161] 2. Specificity comparison: 1) detection object specificity: the detection method of Example 2 is applied to multiple bacterial species, and the distribution of the bacterial species and the specificity results are shown in Table 1. At the same time, Streptococcus thermophilus and other non-Streptococcus thermophilus are compared, and the results are shown in Table 2.

[0162] Figure 5

[0163] Table 1 Distribution of different bacterial species and specificity results

[0164] ​​​

[0165] In Table 1, "+" represents positive, which means that the strain can bind with the ST1 probe, and "-" represents negative, which means that the strain cannot bind with the ST1 probe.

[0166] 2) Specificity of detection results: Based on the strains in Table 1, Streptococcus thermophilus CICC6038, Lactobacillus delbrueckii bulgaricus HH LB57 and Escherichia coli ATCC 13706 were selected as detection objects, and the oligonucleotide probe of Example 1 and the oligonucleotide probe of Comparative Example 3 were used as experimental objects, respectively, to detect the determination results, and the results are shown in Table 2. Figure 6 Figure 6 It can be seen that the oligonucleotide probe of Comparative Example 3 can specifically bind to non-Streptococcus thermophilus, and the oligonucleotide probe provided in Example 1 of the present application can only specifically bind to Streptococcus thermophilus, so the oligonucleotide probe provided in Example 1 of the present application has good specificity.

[0167] 3. Difference of oligonucleotide probe: The oligonucleotide probe provided in Example 1, the probe used in Comparative Example 3 and Comparative Example 4 were compared, and the target gene RecA of Streptococcus thermophilus was introduced as a control. The results show that the difference between the oligonucleotide probe designed in Example 1 of the present application and these probes or the target gene is more than 60%.

[0168] 4. Accuracy of counting results: According to samples with different ratios of dead and live Streptococcus thermophilus, the samples were detected by the detection method of Example 2 and the detection method of Comparative Example 1, respectively, and the results are shown in Table 3. Figure 7 It is shown that the complex technology provided in Example 2 of the present application and the pour plate both produce similar results for all samples, which indicates that the detection method provided in Example 2 of the present application has good accuracy and high potential for practical application in quantifying the number of live Streptococcus thermophilus in yogurt.

[0169] In order to further evaluate the detection range and accuracy of the detection method provided in Example 2 of the present application for quantifying live Streptococcus thermophilus, Streptococcus thermophilus with a final concentration of 10 4 CFU / mL to 10 9 CFU / mL was used as a detection object, and the samples were compared by using the detection method of Example 2 and the detection method of Comparative Example 1, respectively. As shown in Table 4, Figure 8 the results show that the results of the detection method of Example 2 and the detection method of Comparative Example 1 have good linear correlation (R 2 ​= 0.9998), and the linear relationship between the two detection methods was y = 0.9959x + 0.00221 (logarithmic), the average relative standard deviation of the detection results of each S. thermophilus concentration by the detection method of Example 2 was 3.37, which was significantly smaller than the average relative standard deviation 10.09 of the pour plate method, indicating that the stability of the detection method provided by Example 2 was stronger than that of the pour plate method, and had better accuracy.

[0170] 5. Operation repeatability: According to the detection method provided by Example 2, a detection kit matched with a flow analyzer was designed, then the same tube of live bacteria solution was evenly divided into 5 tubes, the live bacteria number in each tube was detected by using the designed kit, and the repeatability of the flow analysis method was verified by comparing the results of the 5 groups, and the results are shown in Figure 9 , the RSD of lactobacillus was 4.37%, which indicated that the repeatability of the detection method provided by Example 2 was good, and the fluorescence signal intensity obtained by detection did not change sharply with the increase of the placement time of the processed sample, which indicated that the stability of the detection method provided by Example 2 was high.

[0171] 6. Parameter determination process of the detection method of Example 2: 1) Determination of the mass concentration of formamide in the hybridization buffer: the detection methods of Example 2, Comparative Example 5 and Comparative Example 6 were used to detect S. thermophilus, and the results are shown in Figure 10 , which indicated that when the mass concentration of formamide was 25%, the binding degree of the oligonucleotide probe and the sample was better, so that the accuracy of the results obtained by the detection method of Example 2 was higher.

[0172] 2) Determination of the type of fixed reagent: the detection methods of Example 2 and Example 7 were used to detect S. thermophilus, and the results are shown in Figure 11 , which indicated that when the mass concentration of alcohol used as a fixing agent was 75%, the fixing degree of the oligonucleotide probe and the sample could be improved, so that the accuracy of the results obtained by the detection method of Example 2 was higher.

[0173] 3) Effect of incubation temperature after hybridization: the detection methods of Example 2 and Comparative Example 8 were used to detect S. thermophilus, and the results are shown in Figure 12 , under different incubation temperature conditions, the measured fluorescence intensity signal showed a trend of first rising and then falling with the increase of the incubation temperature, which indicated that using an incubation temperature of 46°C could effectively improve the fluorescence signal intensity to a certain range, so that the accuracy of the results obtained by the detection method of Example 2 could be improved.

[0174] 4) The effect of the temperature of post-hybridization incubation: the detection method of Example 2 and the detection method disclosed in Example 9 were used to detect Streptococcus thermophilus, respectively, and the results are shown in Table 3. Under different incubation time conditions, the measured fluorescence intensity signal was stable as the incubation time was prolonged, which indicated that the use of this condition of 50 min of incubation temperature had made the oligonucleotide probe fully combined with the sample. Figure 13

[0175] 5) The effect of the amount of oligonucleotide probe added: the detection method of Example 2 and the detection method disclosed in Example 10 were used to detect Streptococcus thermophilus, respectively, and the results are shown in Table 4. Under different conditions of the amount of oligonucleotide probe added, the measured fluorescence intensity signal was stable as the amount of oligonucleotide probe added was increased, which indicated that the use of this condition of 6 ng / μL of the amount of oligonucleotide probe added had made the oligonucleotide probe fully combined with the sample. Figure 14

[0176] In summary, the oligonucleotide probe for Streptococcus thermophilus provided in the embodiments of the present application combines the fluorescence in situ hybridization and flow analysis technology system, and is verified and screened in multiple dimensions to ensure that the nucleotide probe maintains high specificity in a complex microbial community, thereby providing a reliable tool for accurate detection of Streptococcus thermophilus.

[0177] In addition, the oligonucleotide probe for Streptococcus thermophilus provided in the embodiments of the present application may also achieve the effect of the present application although the sequence of the screened oligonucleotide probe only has the nucleotide sequence shown in SEQ ID NO. 1, and the remaining nucleotide sequences of about 20 bp in length may also achieve the effect of the present application, which will not be described in detail herein.

[0178] In addition, the detection method for Streptococcus thermophilus for the purpose of non-disease diagnosis and treatment provided in the embodiments of the present application is not only limited in the flow cytometer, but can also be covered in other instruments capable of detecting fluorescent groups, such as microscopic flow cytometry, scanning electron microscopy, etc., which can be replaced or combined with the detection method provided in the embodiments of the present application.

[0179] The above description is merely specific embodiments of the present application, enabling those skilled in the art to understand or implement the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined in the present application can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown in the present application, but will conform to the widest scope consistent with the principles and novel features of the present application.​​

Claims

1. A method for quantifying the viable count of Streptococcus thermophilus in yogurt, characterized in that, The method includes: The sample to be tested is resuspended to obtain the test bacteria resuspension; The propidium azide bromide solution and the resuspension of the test bacteria were mixed to obtain a mixed solution; The mixed solution was subjected to alternating light and dark conditions to allow the thermophilic streptococci in the mixed solution to combine with propidium bromide azide to form a precipitate, thus obtaining a purified mixed solution. The impurity-removing mixed solution was subjected to sample fixation and centrifugation resuspending to obtain a bacterial resuspending solution; wherein, the reagent used for sample fixation was 75% ethanol by mass concentration; The hybridization buffer, bacterial resuspension, and oligonucleotide probe were incubated to obtain the hybridization product; The hybridization product was centrifuged and resuspended multiple times to obtain the hybridization sample to be tested. The hybridization samples to be tested were subjected to flow cytometry analysis to determine the type and quantity of the hybridization samples to be tested; The nucleotide sequence of the oligonucleotide probe is shown in SEQ ID NO.1; The hybridization buffer comprises: sodium chloride, tris(hydroxymethyl)aminomethane hydrochloride, sodium dodecyl sulfate, and formamide. The molar concentration of sodium chloride is 0.9 mol / L; the molar concentration of tris(hydroxymethyl)aminomethane hydrochloride is 20 mmol / L; the mass m2 of sodium dodecyl sulfate and the volume V3 of the hybridization buffer satisfy the relationship: m2:V3=0.1:100, where m2 is in g and V3 is in L; the mass m3 of formamide and the volume V4 of the hybridization buffer satisfy the relationship: m3:V4=25:

100.

2. The method according to claim 1, characterized in that, The mass m1 of the oligonucleotide probe, the volume V1 of the hybridization buffer, and the volume V2 of the bacterial resuspension satisfy the following relationship: m1:(V1+V2)≥6:

1. If the unit of m1 is ng, then the units of V1 and V2 are both μL. The volume V1 of the hybridization buffer and the volume V2 of the bacterial resuspension satisfy the following relationship: V1:V2≤9:

1.

3. The method according to claim 1, characterized in that, The incubation temperature was 46°C, and the incubation time was 50 minutes.

4. The method according to claim 1, characterized in that, The oligonucleotide probe has a fluorescent group attached to its 5' end; the fluorescent group is selected from one of the following: Alexa Flour 488, 6-carboxyfluorescein, hexachlorofluorescein, anthocyanin 3, Alexa Flour 555, carboxytetramethylrhodamine, disulfonic acid diethyl and Alexa Flour 647.

Images