KASP marker closely linked with wheat mutant je0424 thousand-grain weight gene and application of KASP marker closely linked with wheat mutant je0424 thousand-grain weight gene

By developing KASP markers closely linked to the wheat mutant je0424 100-grain weight gene, including TGW83 and TGW86, the problem of insufficient heritage resources in the increase in wheat yield was solved, and efficient screening and breeding of new wheat varieties with high 100-grain weight was achieved, and the breeding process was accelerated.

CN120193115APending Publication Date: 2025-06-24INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510338871.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The existing technology has insufficient heritage resources for increasing wheat yields, making it difficult to effectively increase the weight of wheat 1,000 grains.

Method used

A KASP marker closely linked to the wheat mutant je0424 kilogram weight gene, including TGW83 and TGW86, was developed to screen and breed new wheat varieties with high kilogram weight.

Benefits of technology

Through the application of this KASP marker, high-throughput and rapid assisted selection during the seedling stage can be screened out wheat materials with a height of 1,000 grains, accelerate the breeding process, and solve the problem of insufficient heritage resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120193115A_ABST
    Figure CN120193115A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology and crop breeding, in particular to a KASP marker closely linked with a wheat mutant je0424 thousand grain weight gene and application of the KASP marker. The KASP marker comprises TGW83 and TGW86, and the KASP marker comprises TGW83 and TGW86; the TGW83 is composed of a first primer or a derivative thereof, a second primer or a derivative thereof and a third primer; the TGW86 is composed of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof and a sixth primer; the sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are respectively as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. The TGW83 and the TGW86 are molecular markers closely linked with thousand grain weight mutant genes, and can be used for molecular marker-assisted selection and screening of new wheat materials with high thousand grain weight. Besides, the KASP marker closely linked with the wheat mutant je0424 thousand-grain weight gene is a molecular marker closely linked with the thousand-grain weight gene, so that high-throughput and seedling-stage rapid auxiliary selection can be realized, and the breeding process is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular biology and crop breeding, and particularly relates to a KASP marker closely linked to the thousand-grain weight gene of wheat mutant je0424 and its application. Background Art

[0002] China's wheat production is facing the dual pressures of population growth and shrinking arable land. Cultivating high-yield and stable-yield wheat varieties has become a major requirement for ensuring food security. Among the three elements of wheat yield components, the thousand-grain weight has become a relatively stable yield-increasing factor due to its high heritability. Analyzing its genetic basis and developing practical molecular markers are of great significance for variety improvement.

[0003] In recent years, researchers have made important breakthroughs through forward genetic strategies. Using EMS mutagenesis populations, Chen et al. (2020) and Li et al. (2023) respectively cloned the KAT-2A gene on chromosome 6B and the TaACT7-D gene on chromosome 1DS. The TaTGW-7A gene first cloned by Hu et al. (2016) is highly present in the core germplasm (65%) and released varieties (86%), showing its significant positive selection effect in the breeding process in China. The Liu team (2023) revealed that the TaTPP-7A gene on chromosome 7A regulates embryo lactose metabolism through the T6P-SnRK1 pathway. The domestication and selection characteristics of this gene suggest that it is an important breeding target. In addition, many genes have pleiotropy. The Tasg-D1 gene reported by Cheng et al. (2020) not only regulates grain weight but also affects agronomic traits such as plant height and spike morphology; Niaz et al. (2023) found that the TaGL1 gene on chromosome 1B regulates grain length through a 97bp insertion-deletion variation in the intron region. The loss of its function can reduce the thousand-grain weight by 16-36%, showing a significant genetic effect.

[0004] Currently, the global food security situation has put forward higher requirements for wheat yield improvement. Although several key genes have been analyzed, the existing genetic resources are still insufficient. Summary of the Invention

[0005] The present invention solves the problem of insufficient genetic resources for improving wheat yield, and provides a KASP marker closely linked to the thousand-grain weight gene of wheat mutant je0424 and its application, screening new materials with high thousand-grain weight in wheat, cultivating new wheat varieties with high yield, and accelerating the breeding process.

[0006] The technical solution claimed by the present invention is as follows:

[0007] A KASP marker closely linked to the thousand-grain weight gene of wheat mutant je0424, including TGW83 and TGW86; the TGW83 consists of a first primer or its derivative, a second primer or its derivative, and a third primer; the TGW86 consists of a fourth primer or its derivative, a fifth primer or its derivative, and a sixth primer;

[0008] The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer, and the sixth primer are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 respectively.

[0009] The derivative of the first primer is a first fluorescent sequence linked to the 5' end of the single-stranded DNA molecule shown in SEQ ID NO:1; the derivative of the second primer is a second fluorescent sequence linked to the 5' end of the single-stranded DNA molecule shown in SEQ ID NO:2; the first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX; the sequences of FAM and HEX are shown in SEQ ID NO:11 and SEQ ID NO:12 respectively.

[0010] In the above KASP marker, the nucleotide sequences of the forward primers of the two alleles with different terminal bases of TGW83 are: 5’GAAGGTGACCAAGTTCATGCTcaatcacattcttgtaagccacaG 3’ (SEQ ID NO:7), 5’GAAGGTCGGAGTCAACGGATTcaatcacattcttgtaagccacaA 3’ (SEQ ID NO:8); the nucleotide sequence of the universal reverse primer of TGW83 is: 5’ggcCaagaccgctgatgtA 3’ (SEQ ID NO:3).

[0011] The derivative of the fourth primer is a third fluorescent sequence linked to the 5' end of the single-stranded DNA molecule shown in SEQ ID NO:4; the derivative of the fifth primer is a fourth fluorescent sequence linked to the 5' end of the single-stranded DNA molecule shown in SEQ ID NO:5; the third fluorescent sequence is the fluorescent sequence FAM; the fourth fluorescent sequence is the fluorescent sequence HEX; the sequences of FAM and HEX are shown in SEQ ID NO:11 and SEQ ID NO:12 respectively.

[0012] Among the above KASP markers, the nucleotide sequences of the forward primers of the two alleles with different terminal bases of TGW86 are respectively: 5’GAAGGTGACCAAGTTCATGCTccgattcttttagaagCacaccC 3’ (SEQ ID NO:9), 5’GAAGGTCGGAGTCAACGGATTccgattcttttagaagCacaccT 3’ (SEQ ID NO:10); the nucleotide sequence of the universal reverse primer of TGW86 is: 5’ccttatacagatcacgatacggtG 3’ (SEQ ID NO:6).

[0013] The present invention also provides a PCR reagent containing the above KASP marker closely linked to the thousand-grain weight gene of wheat mutant je0424.

[0014] The present invention also provides a kit containing the above KASP marker closely linked to the thousand-grain weight gene of wheat mutant je0424 or the above PCR reagent.

[0015] The application of the KASP marker closely linked to the thousand-grain weight gene of wheat mutant je0424, or the PCR reagent, or the kit in at least one of the following also belongs to the protection scope of the present invention:

[0016] (A) Identifying or assisting in identifying the thousand-grain weight of wheat;

[0017] (B) Preparing a product for identifying or assisting in identifying the thousand-grain weight of wheat;

[0018] (C) Detecting, screening or breeding wheat with high thousand-grain weight;

[0019] (D) Preparing a product for detecting, screening or breeding wheat with high thousand-grain weight;

[0020] (E) Identifying or assisting in identifying the thousand-grain weight genotype of wheat.

[0021] The present invention also provides a method for identifying or assisting in identifying the thousand-grain weight of wheat, including the following steps: performing a KASP reaction on the wheat to be tested with the KASP marker closely linked to the thousand-grain weight gene of wheat mutant je0424, detecting the reaction product, and the thousand-grain weight of the wheat to be tested whose reaction product produces the color of the fluorescent sequence linked to the 5’ end of the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:4 is greater than the thousand-grain weight of the wheat to be tested whose reaction product produces the color of the fluorescent sequence linked to the 5’ end of the DNA molecule shown in SEQ ID NO:2 or SEQ ID NO:5.

[0022] The present invention also provides a method for identifying or assisting in the identification of wheat thousand-kernel weight genotypes, comprising the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker closely linked to the thousand-kernel weight gene of the wheat mutant je0424, detecting the reaction product, and the wheat to be tested whose reaction product produces the color of the fluorescent sequence linked to the 5' end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 is a high thousand-kernel weight genotype wheat.

[0023] Through BSA-Seq primary mapping analysis, the present invention locates the thousand-kernel weight mutant gene on chromosome 4B; by developing KASP molecular markers and constructing a genetic linkage map, it is determined that the thousand-kernel weight mutant gene is located in the interval of approximately 1.16 cM between the markers TGW83 and TGW86 on chromosome 4B. TGW83 and TGW86 are molecular markers closely linked to the thousand-kernel weight mutant gene and can be used for molecular marker-assisted selection to screen new wheat materials.

[0024] Beneficial effects:

[0025] The present invention provides a KASP marker closely linked to the thousand-kernel weight gene of the wheat mutant je0424 and its application. The markers include TGW83 and TGW86. TGW83 and TGW86 are molecular markers closely linked to the thousand-kernel weight mutant gene and can be used for molecular marker-assisted selection to screen new wheat materials with high thousand-kernel weight and cultivate high-yield wheat, solving the problem of insufficient genetic resources for improving wheat yield. In addition, the KASP marker closely linked to the thousand-kernel weight gene in the present invention is a molecular marker closely linked to the thousand-kernel weight mutant gene, which can achieve high-throughput and rapid seedling-stage assisted selection, accelerating the breeding process. Description of the Drawings

[0026] Figure 1 Comparison of the thousand-kernel weight of the wild-type Jing 411 and the mutant je0424 in the embodiment of the present invention; wherein: on the left in A is the wild-type Jing 411, and on the right is the mutant je0424; on the left in B is the wild-type Jing 411, and on the right is the mutant je0424.

[0027] Figure 2 Schematic diagram of the primary mapping analysis of the thousand-kernel weight mutant gene in the embodiment of the present invention.

[0028] Figure 3 Schematic diagram of the genetic mapping of the thousand-kernel weight mutant gene on chromosome 4BS in the embodiment of the present invention.

[0029] Figure 4TGW83 and TGW86 KASP marker detection results in the embodiments of the present invention; the blue dots represent samples of the wild-type Jing 411 genotype, the red dots represent samples of the mutant je0424 genotype, and the green dots represent heterozygous samples; among them, A is the TGW83 KASP marker detection result; B is the TGW86 KASP marker detection result. Detailed implementation manners

[0030] The present invention will be further elaborated in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only for explanation and illustration, and do not limit the scope of the present invention in any way.

[0031] First group of embodiments, KASP markers closely linked to the thousand-grain weight gene of wheat mutant je0424

[0032] This group of embodiments provides KASP markers closely linked to the thousand-grain weight gene of wheat mutant je0424, including TGW83 and TGW86; among them, the TGW83 is composed of a first primer or its derivative, a second primer or its derivative, and a third primer; the TGW86 is composed of a fourth primer or its derivative, a fifth primer or its derivative, and a sixth primer;

[0033] The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer, and the sixth primer are shown as SEQ ID NO:1 (caatcacatt cttgtaagcc acag), SEQ ID NO:2 (caatcacatt cttgtaagccacaa), SEQ ID NO:3 (ggccaagacc gctgatgta), SEQ ID NO:4 (ccgattcttt tagaagcacaccc), SEQ ID NO:5 (ccgattcttt tagaagcaca cct), and SEQ ID NO:6 (ccttatacagatcacgatac ggtg), respectively.

[0034] The derivative of the first primer is the 5' end of the single-stranded DNA molecule shown in SEQ ID NO:1 linked with a first fluorescent sequence; the derivative of the second primer is the 5' end of the single-stranded DNA molecule shown in SEQ ID NO:2 linked with a second fluorescent sequence; the first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX.

[0035] The derivative of the fourth primer is a single-stranded DNA molecule shown in SEQ ID NO: 4 with a third fluorescent sequence linked to its 5' end; the derivative of the fifth primer is a single-stranded DNA molecule shown in SEQ ID NO: 5 with a fourth fluorescent sequence linked to its 5' end; the third fluorescent sequence is the fluorescent sequence FAM; the fourth fluorescent sequence is the fluorescent sequence HEX.

[0036] The nucleotide sequences of the two allele forward primers of TGW83 with different terminal bases are respectively: 5’GAAGGTGACCAAGTTCATGCTcaatcacattcttgtaagcCacaG 3’ (SEQ ID NO: 7), 5’GAAGGTCGGAGTCAACGGATTcaatcacattcttgtaagcCacaA 3’ (SEQ ID NO: 8); the nucleotide sequence of the TGW83 universal reverse primer is: 5’ggcCaagaccgctgatgtA3’ (SEQ ID NO: 3);

[0037] The nucleotide sequences of the two allele forward primers of TGW86 with different terminal bases are respectively: 5’GAAGGTGACCAAGTTCATGCTccgattcttttagaagCacaccC 3’ (SEQ ID NO: 9), 5’GAAGGTCGGAGTCAACGGATTccgattcttttagaagCacaccT 3’ (SEQ ID NO: 10); the nucleotide sequence of the TGW86 universal reverse primer is: 5’ccttatacagatcacgatacggtG 3’ (SEQ ID NO: 6). Second group of examples, a PCR reagent

[0038] This group of examples provides a PCR reagent containing the KASP markers closely linked to the thousand-grain weight gene of the wheat mutant je0424 described in the first group of examples.

[0039] Third group of examples, a kit

[0040] This group of examples provides a kit containing the KASP markers closely linked to the thousand-grain weight gene of the wheat mutant je0424 described in the first group of examples or the PCR reagent described in the second group of examples.

[0041] Fourth group of examples, applications of KASP markers or PCR reagents or kits

[0042] The present group of embodiments provides the use of the KASP markers closely linked to the thousand-grain weight gene of the wheat mutant je0424 described in the first group of embodiments, or the PCR reagents described in the second group of embodiments, or the kits described in the third group of embodiments in at least one of the following:

[0043] (A) Identifying or assisting in the identification of wheat thousand-grain weight;

[0044] (B) Preparing a product for identifying or assisting in the identification of wheat thousand-grain weight;

[0045] (C) Detecting, screening, or breeding high-thousand-grain weight wheat;

[0046] (D) Preparing a product for detecting, screening, or breeding high-thousand-grain weight wheat;

[0047] (E) Identifying or assisting in the identification of wheat thousand-grain weight genotypes.

[0048] The fifth group of embodiments, a method for identifying or assisting in the identification of wheat thousand-grain weight

[0049] The present group of embodiments provides a method for identifying or assisting in the identification of wheat thousand-grain weight, including the following steps: performing a KASP reaction on the wheat to be tested using the KASP markers closely linked to the thousand-grain weight gene of the wheat mutant je0424 described in the first group of embodiments, detecting the reaction product, and the thousand-grain weight of the wheat to be tested whose reaction product produces the color of the fluorescent sequence linked to the 5'-end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 is greater than that of the wheat to be tested whose reaction product produces the color of the fluorescent sequence linked to the 5'-end of the DNA molecule shown in SEQ ID NO: 2 or SEQ ID NO: 5.

[0050] The sixth group of embodiments, a method for identifying or assisting in the identification of wheat thousand-grain weight genotypes

[0051] The present group of embodiments provides a method for identifying or assisting in the identification of wheat thousand-grain weight genotypes, including the following steps: performing a KASP reaction on the wheat to be tested using the KASP markers closely linked to the thousand-grain weight gene of the wheat mutant je0424 described in the first group of embodiments, detecting the reaction product, and the wheat to be tested whose reaction product produces the color of the fluorescent sequence linked to the 5'-end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 is a high-thousand-grain weight genotype wheat.

[0052] Experimental examples

[0053] Biomaterial source:

[0054] Wheat wild type: Jing 411, a known variety that has passed variety approval (purchased from Beijing Seed Company).

[0055] Wheat mutant je0424: It is a stable thousand-grain weight mutant material derived from Jing 411 by EMS mutagenesis. The public can obtain it from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. The mutagenesis method is as follows: Soak the dry seeds of Jing 411 in water for 10 hours, then change to 1.0% EMS treatment for 4 hours, and at the same time conduct slight shaking at 50 rpm under dark conditions. Rinse the treated seeds under running water for 4 hours, and then plant them in the field. After continuous planting for 6 generations, the stable thousand-grain weight mutant je0424 was screened out.

[0056] Experimental Example 1. Comparison of thousand-grain weight between wild type and mutant je0424

[0057] 1. Experimental materials and methods

[0058] The wild type of wheat variety Jing 411 and its mutant je0424 were used to conduct field experiments at the experimental base of the Middle Breeding Field of the Institute of Crop Science, Chinese Academy of Agricultural Sciences (CAAS). The planting pattern with a row length of 2 meters was adopted, and 15 plants were planted in each row. After harvesting at maturity, the SC-G type automatic seed measurement and thousand-grain weight analysis system produced by Hangzhou Wanshen Detection Technology Co., Ltd. was used for seed phenotype determination. During the experimental period (2022 - 2024), the materials were continuously tracked and observed for three growing seasons, and no less than 5 biological replicates were set for each sample.

[0059] 2. Experimental results

[0060] Through three-year field observations, the grain traits of the wild type of Jing 411 and its mutant je0424 were systematically evaluated. Phenotypic analysis showed that the dynamic range of the thousand-grain weight of the wild type Jing 411 was 41.3 - 58.7 g, while that of the mutant je0424 decreased significantly to 22.1 - 38.6 g (p < 0.0001, t-test). Compared with the wild type, the reduction rate of the thousand-grain weight of je0424 reached 43.96%, showing extremely significant genetic differences ( Figure 1 B).

[0061] Experimental Example 2. Initial mapping of the thousand-grain weight mutant gene based on exon capture resequencing

[0062] 1. Genetic population construction and experimental methods

[0063] First, a genetic segregation population of the wild type of Jing 411 and the mutant je0424 was constructed by reciprocal crosses, and an F2 population containing 555 individual plants was obtained for gene mapping. Under the conditions of conventional field management, the young leaf tissues of individual plants in the F2 population were collected respectively, and genomic DNA was extracted by the PVP40 method. At maturity, the phenotypic values of the thousand-grain weight of each individual plant were systematically measured, and a phenotypic database was established.

[0064] From each F2 population, 15 - 25 individual plants with extreme phenotypes of high 1000 - grain weight (>45 g) and low 1000 - grain weight (<35 g) were separately selected, and their DNA samples were mixed at equimolar concentration to construct extreme mixed pools of high and low 1000 - grain weight. Using the whole - exome capture sequencing technology, the two parents and four extreme mixed pools were deeply sequenced. According to the genotype data obtained from the re - sequencing, the QTLseqr algorithm was used to filter and analyze the differential sites between the mixed pools and the parents, and finally the key chromosomal regions controlling the 1000 - grain weight were locked.

[0065] 2. Experimental results

[0066] Combined with the BSA (bulked segregant analysis) method, the exome capture sequencing data of the constructed F2 individual - plant mixed pools of high and low 1000 - grain weight were filtered and screened using the QTLseqr algorithm. According to the genotypes of the obtained differential sites and the sequencing depths, combined with the phenotypic information of the mixed pools, ED (empirical Bayes differential expression) association analysis was carried out. The ED value was used to reflect the linkage strength between the SNP sites and the 1000 - grain weight genes. A QTL ( Figure 2 ) controlling the 1000 - grain weight was found on chromosome 4B.

[0067] Experimental Example 3: Genetic linkage mapping analysis and verification of the 1000 - grain weight mutant gene

[0068] 1. Experimental method

[0069] Based on the polymorphic sites on chromosome 4B of the two parents Jing 411 and je0424 obtained from the exome capture re - sequencing, and based on the known flanking sequences, two forward primers with different terminal bases for alleles and one reverse primer were designed. Sequences with different fluorescent probes were respectively linked to the 5' ends of the two forward primers. Using KASP Master mix (LGC), the genotype of the sample can be determined according to the fluorescence signal detected after PCR amplification. According to the SNP sites on chromosome 4B of Jing 411 and je0424, a total of 72 pairs of KASP marker primers were designed. By detecting the genotypes in the parents and some individual plants of the population, 14 pairs of KASP markers with good genotyping were screened and used for the construction of the genetic linkage map.

[0070] 555 individual plants in the Jing 411 / je0424 F2 population were analyzed. The genotypes of each individual plant were determined using KASP markers. Combining the genotype and 1000 - grain weight phenotypic data, the QTL IciMapping 4.0 software was used for genetic linkage mapping analysis of the 1000 - grain weight mutant gene.

[0071] A pair of KASP markers TGW83 and TGW86 tightly linked to the wheat thousand-grain weight mutant gene were obtained by the above method. The nucleotide sequences of the forward primers of the two alleles with different terminal bases of TGW83 are respectively: 5’GAAGGTGACCAAGTTCATGCTcaatcacattcttgtaagcCacaG 3’ (SEQ ID NO:7), 5’GAAGGTCGGAGTCAACGGATTcaatcacattcttgtaagcCacaA3’ (SEQ ID NO:8), and the nucleotide sequence of the common reverse primer of TGW83 is: 5’ggcCaagaccgctgatgtA3’ (SEQ ID NO:3), and the amplified band length is 76bp; the nucleotide sequences of the forward primers of the two alleles with different terminal bases of TGW86 are respectively: 5’GAAGGTGACCAAGTTCATGCTccgattcttttagaagCacaccC 3’ (SEQ ID NO:9), 5’GAAGGTCGGAGTCAACGGATTccgattcttttagaagCacaccT 3’ (SEQ ID NO:10), and the nucleotide sequence of the common reverse primer of TGW86 is: 5’ccttatacagatcacgatacggtG 3’ (SEQ ID NO:6), and the amplified band length is 98bp.

[0072] The fluorescent tag sequences linked to the 5’ ends of the forward primers of TGW83 and TGW86 are respectively: FAM, HEX; the sequences of FAM and HEX are shown as SEQ ID NO:11 (5’GAAGGTGACCAAGTTCATGCT) and SEQ ID NO:12 (5’GAAGGTCGGAGTCAACGGATT).

[0073] The KASP reaction system of TGW83 and TGW86 is: 2×KASP Master mix 2.5μL, primermix0.07μL (12μL of each of the two forward primers, 36μL of the common primer, and then supplemented with 40μL of ultrapure water to make up 100μL, which is the primer mix), 50mM MgCl2 0.04μL, 30ng of genomic DNA, and supplemented with ultrapure water to 5μL. Its PCR amplification program is: pre-denaturation at 94℃ for 15min; denaturation at 94℃ for 20s, annealing at 65℃ for 1min, a total of 9 cycles, and the temperature is reduced by 0.6℃ for each cycle; denaturation at 94℃ for 20s, annealing at 57℃ for 1min, a total of 30 cycles.

[0074] The results of the PCR products were obtained by detecting the fluorescence signals with a FLUOstar Omega microplate reader. The amplification products with FAM sequence tags were labeled blue, and the amplification products with HEX sequence tags were labeled red. The FAM sequence tag primers were at locus G (TGW83) or locus C (TGW86), and the HEX sequence tag primers were at locus A (TGW83) or locus T (TGW86).

[0075] 2. Experimental results

[0076] Using KASP markers, the F2 segregating population was genotyped to obtain the population genotypes. Combining with the phenotypes, a genetic linkage map was constructed. The results showed that the thousand-grain weight mutant gene was located in the interval of about 1.16 cM between the markers TGW83 and TGW86 on the short arm of chromosome 4B (calculated by QTL IciMapping 4.0 software)( Figure 3 ), the LOD value was 5.60, and the phenotypic contribution rate was 4.93% (the calculation methods of the LOD value and the phenotypic contribution rate are shown in the following non-patent literature: Meng et al. 2015, QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop Journal 3, 269 - 283.).

[0077] Through fluorescence signal detection (FLUOstar Omega microplate reader), TGW83( Figure 4 in A) and the TGW86 marker( Figure 4 in B) could clearly separate the genotype of the mutant je0424 (red dots) and the genotype of Jing 411 (blue dots). The genotype information obtained using these two markers would predict the presence of the thousand-grain weight mutant gene.

Claims

1. A KASP marker tightly linked to the thousand-grain weight gene of wheat mutant je0424, characterized in that: Including TGW83 and TGW86; The TGW83 is composed of a first primer or a derivative thereof, a second primer or a derivative thereof, and a third primer; The TGW86 consists of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof, and a sixth primer; The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer and the sixth primer are shown as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

2. The KASP marker tightly linked to the thousand-grain weight gene of wheat mutant je0424 according to claim 1, characterized in that: The derivative of the first primer is a single-stranded DNA molecule as shown in SEQ ID NO:1 with the 5' end connected to a first fluorescent sequence; the derivative of the second primer is a single-stranded DNA molecule as shown in SEQ ID NO:2 with the 5' end connected to a second fluorescent sequence; the first fluorescent sequence is a fluorescent sequence FAM; the second fluorescent sequence is a fluorescent sequence HEX; the sequences of FAM and HEX are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively.

3. The KASP marker tightly linked to the thousand-grain weight gene of wheat mutant je0424 according to claim 2, characterized in that: The nucleotide sequences of the two TGW83 allele forward primers with different terminal bases are shown in SEQ ID NO:7 and SEQ ID NO:8 respectively; the nucleotide sequence of the TGW83 universal reverse primer is shown in SEQ ID NO:

3.

4. The KASP marker tightly linked to the thousand-grain weight gene of wheat mutant je0424 according to claim 1, characterized in that: The derivative of the fourth primer is a single-stranded DNA molecule as shown in SEQ ID NO:4 with the 5' end connected to a third fluorescent sequence; the derivative of the fifth primer is a single-stranded DNA molecule as shown in SEQ ID NO:5 with the 5' end connected to a fourth fluorescent sequence; the third fluorescent sequence is a fluorescent sequence FAM; the fourth fluorescent sequence is a fluorescent sequence HEX; the sequences of FAM and HEX are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively.

5. The KASP marker tightly linked to the thousand-grain weight gene of wheat mutant je0424 according to claim 4, characterized in that: The nucleotide sequences of the two TGW86 allele forward primers with different terminal bases are shown in SEQ ID NO:9 and SEQ ID NO:10 respectively; the nucleotide sequence of the TGW86 universal reverse primer is shown in SEQ ID NO:

6.

6. A PCR reagent, characterized in that The PCR reagent comprises the KASP marker tightly linked to the thousand-grain weight gene of the wheat mutant je0424 as described in any one of claims 1-5.

7. A kit, characterized in that: The kit comprises the PCR reagent of claim 6 or the KASP marker tightly linked to the thousand-grain weight gene of the wheat mutant je0424 as described in any one of claims 1 to 5.

8. Use of the KASP marker tightly linked to the thousand-grain weight gene of wheat mutant je0424 according to any one of claims 1 to 5, the PCR reagent according to claim 6, or the kit according to claim 7 in at least one of the following: (A) Identify or assist in identifying wheat thousand-grain weight; (B) preparing and identifying or assisting in the identification of wheat thousand-grain weight products; (C) detecting, selecting or breeding high thousand-grain weight wheat; (D) preparing, testing, screening or breeding high thousand-grain weight wheat products; (E) Identification or auxiliary identification of wheat thousand-grain weight genotypes.

9. A method for identifying or assisting in identifying wheat thousand-grain weight, characterized in that: The method comprises the following steps: performing a KASP reaction on wheat to be tested using the KASP marker tightly linked to the thousand-grain weight gene of the wheat mutant je0424 as described in any one of claims 2 to 5, detecting the reaction product, and the thousand-grain weight of the wheat to be tested whose reaction product produces a color such as the color of the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:4 is greater than the thousand-grain weight of the wheat to be tested whose reaction product produces a color such as the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO:2 or SEQ ID NO:

5.

10. A method for identifying or assisting in identifying wheat thousand-grain weight genotypes, characterized in that: The method comprises the following steps: using the KASP marker tightly linked to the thousand-grain weight gene of the wheat mutant je0424 as described in any one of claims 2 to 5 to carry out a KASP reaction on the wheat to be tested, detecting the reaction product, and the wheat to be tested whose reaction product produces the color of the fluorescent sequence connected to the 5' end of the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 4 is a high thousand-grain weight genotype wheat.

Citation Information

Patent Citations

  • KASP primer group related to wheat grain weight and application

    CN116590466A

  • KASP marker related to thousand seed weight of wheat and application of KASP marker

    CN119553003A