QPCR (quantitative polymerase chain reaction) method for detecting saccharomyces cerevisiae, Wickerhamomyces anomalus and zygosaccharomyces bayer and application of qPCR method

Abstract

The invention discloses a qPCR (quantitative polymerase chain reaction) method for detecting saccharomyces cerevisiae, Wickerhamomyces anomalus and zygosaccharomyces bayer and application of the qPCR method, and belongs to the technical field of bioengineering. The invention establishes a method for screening specific gene segments and designing qPCR primers based on multi-yeast genome comparison, successfully identifies the specific genes of saccharomyces cerevisiae, Wickerhamomyces anomalus and zygosaccharomyces bayer, verifies high specificity in non-target yeast, establishes qPCR standard curves of the three yeasts, and provides a basis for screening the specific genes of the saccharomyces cerevisiae, the Wickerhamomyces anomalus and the zygosaccharomyces bayer. The linear range is 103-108 copies / [mu] L, the detection limit reaches 10 copies / [mu] L, and the quantification limit reaches 103 copies / [mu] L. The method realizes quantitative and qualitative detection of saccharomyces cerevisiae, Wickerhamomyces anomalus and zygosaccharomyces bayer in a pure bacterium sample and a simulated fermentation sample, has the characteristics of high sensitivity, high specificity, high stability and the like, and is accurate and reliable in detection result.

Description

Technical Field

[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to a qPCR method for detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii, and its application. Background Art

[0002] Yeasts are the main microorganisms in the production process of brewing foods. They convert sugars into alcohol and other flavor compounds through fermentation, endowing brewing foods with unique flavors and aromas. Their quantity and activity directly affect production efficiency and the quality of brewing foods. Quantitative detection of yeasts in brewing foods and their production processes helps optimize fermentation conditions, control the production process, and ensure the consistency of the final product quality.

[0003] Traditional yeast detection mainly relies on traditional plate counting methods, that is, diluting the sample and spreading it on a specific medium (such as WLN medium for isolating yeasts), then selecting single colonies with different colony morphologies and inoculating them again for purification, observing the colony morphology and cell morphology and performing plate counting. However, this method is time-consuming, complex in operation, and the single morphological identification result is prone to deviation. With the development of molecular biology techniques, PCR-based detection methods have received attention due to their high sensitivity and specificity. Real-time quantitative PCR (qPCR) technology, by adding a fluorescent dye (such as SYBR GREEN) to the PCR reaction, real-time monitors the fluorescent signal during DNA amplification, generates a fluorescence intensity curve, and quantifies the copy number of microorganisms by comparing with a standard product. It is a simple, highly repeatable, and sensitive microbial detection method, greatly improving the detection efficiency.

[0004] Saccharomyces cerevisiae exists in the fermentation processes of various wines and vinegars and is the fermentation power of the wine body. It also has an alcoholic fermentation function in the vinegar fermentation process; Zygosaccharomyces bailii produces ethanol and higher alcohols and has high tolerance to high temperature, high acid, and high-concentration ethanol; Wickerhamomyces anomalus is heat-tolerant stress, an ester-producing and aroma-producing yeast, which is beneficial to enhancing the aroma of soy sauce. These three yeasts are common core functional yeasts in brewing foods and are often used as detection objects. In recent years, some literatures have developed qPCR detection methods for these three yeasts. However, the inventors have found through research that the currently reported specific qPCR primers and yeast-specific genes are difficult to distinguish yeast strains that are closely related to them, resulting in problems such as non-specific amplification in the detection results.

[0005] CN112695120A discloses a primer, kit and method for rapid identification and quantification of Saccharomyces cerevisiae. The 173bp nucleotide sequence corresponding to alcohol dehydrogenase (ADH5) is a highly specific sequence of Saccharomyces cerevisiae, and primer sequences for identifying Saccharomyces cerevisiae are obtained therefrom. However, the present invention has attempted to compare the alcohol dehydrogenase genes of Saccharomyces cerevisiae and other related species to find non-conserved regions therein for designing specific primers for Saccharomyces cerevisiae. However, the present invention has tried alcohol dehydrogenases 1-7, and the non-conserved regions corresponding to these genes show very poor specificity in the specific evaluation objects, especially for Saccharomyces bayanus, Saccharomyces paradoxus and Saccharomyces pastorianus which are very closely related to it. Therefore, the method of CN112695120A may be difficult to ensure the differentiation of yeast strains with similar genetic relationships.

[0006] CN111560455A discloses a quantitative analysis method for Zygosaccharomyces bailii. By extracting 26S rRNA of 22 microorganisms and comparing all the extracted 26S rRNA sequences, a specific fragment of the hypervariable region of 26S rRNA of Zygosaccharomyces bailii with a length of 89bp is obtained, and specific primer sequences for Zygosaccharomyces bailii are obtained. However, this method requires searching for a gene shared by a certain target yeast and other non-target yeasts, and then comparing the different parts of the sequences of the target yeast. The workload of investigating the literature is cumbersome; moreover, 26S rRNA may be very similar among yeasts of the same genus but different species. This method does not select yeasts of the same genus but different species for specific evaluation, and it may also be difficult to solve the problem of differentiating yeast strains with similar genetic relationships.

[0007] Therefore, it is urgent to screen highly specific genes of these three core functional yeasts, differentiate yeast strains with similar genetic relationships, and establish an absolute quantitative analysis method. Summary of the Invention

[0008] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a qPCR detection method for quantitatively detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus and Zygosaccharomyces bailii. The present invention has identified highly specific genes of three target yeasts, realized the absolute quantification of Saccharomyces cerevisiae, Wickerhamomyces anomalus and Zygosaccharomyces bailii using a standard curve, solved the problem that existing specific primers often have non-specific amplification in yeasts with similar genetic relationships, and verified the feasibility of the established qPCR detection method in pure bacterial samples and simulated fermentation samples.

[0009] To achieve the above object, the present invention first provides a specific primer sequence for detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus and / or Zygosaccharomyces bailii. Among them, the specific primer sequences of Saccharomyces cerevisiae are shown in SEQ ID NO: 3 and SEQ ID NO: 4, the specific primer sequences of Wickerhamomyces anomalus are shown in SEQ ID NO: 7 and SEQ ID NO: 8, and the specific primer sequences of Zygosaccharomyces bailii are shown in SEQ ID NO: 13 and SEQ ID NO: 14.

[0010] The present invention also provides a qPCR method for detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus and / or Zygosaccharomyces bailii, which comprises the following steps:

[0011] A. Prepare the PCR product of Saccharomyces cerevisiae according to the primers shown in SEQ ID NO: 22 and SEQ ID NO: 23, and configure the PCR product into a series of Saccharomyces cerevisiae DNA templates with different and known concentrations;

[0012] and / or, prepare the PCR product of Wickerhamomyces anomalus according to the primers shown in SEQ ID NO: 24 and SEQ ID NO: 25, and configure the PCR product into a series of Wickerhamomyces anomalus DNA templates with different and known concentrations;

[0013] and / or, prepare the PCR product of Zygosaccharomyces bailii according to the primers shown in SEQ ID NO: 26 and SEQ ID NO: 27, and configure the PCR product into a series of Zygosaccharomyces bailii DNA templates with different and known concentrations;

[0014] B. Use the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 to perform qPCR on the series of Saccharomyces cerevisiae DNA templates with different concentrations respectively. Take the Lg value of DNA concentration as the abscissa and the Ct value as the ordinate to draw the standard curve of Saccharomyces cerevisiae;

[0015] and / or, use the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 to perform qPCR on the series of Wickerhamomyces anomalus DNA templates with different concentrations respectively. Take the Lg value of DNA concentration as the abscissa and the Ct value as the ordinate to draw the standard curve of Wickerhamomyces anomalus;

[0016] And / or, qPCR was performed on the DNA templates of Saccharomyces bayanus at a series of concentrations using the primer pairs shown in SEQ ID NO: 13 and SEQ ID NO: 14. With the logarithm value of the DNA concentration as the abscissa and the Ct value as the ordinate, a standard curve of Saccharomyces bayanus was plotted;

[0017] In step B, the two-step qPCR amplification program was used for qPCR, and the reaction conditions were: 94°C for 5 min, followed by 94°C for 5 s, 64 - 68°C for 30 s, for 30 cycles;

[0018] In step B, the concentrations of the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 were 200 - 600 nM (at this time, the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 were used simultaneously, and their concentrations were the same);

[0019] In step B, the concentrations of the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 were 200 - 600 nM (at this time, the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 were used simultaneously, and their concentrations were the same);

[0020] In step B, the concentrations of the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 were 200 - 600 nM (at this time, the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 were used simultaneously, and their concentrations were the same);

[0021] C. Extract the genome from the test sample. Under the same reaction conditions and primer concentrations as in step B, qPCR was performed on the genome of the test sample using the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4. The Ct value of the qPCR was substituted into the standard curve of Saccharomyces cerevisiae to calculate the number of Saccharomyces cerevisiae in the test sample;

[0022] And / or, qPCR was performed on the genome of the test sample using the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8. The Ct value of the qPCR was substituted into the standard curve of Wickerhamomyces anomalus to calculate the number of Wickerhamomyces anomalus in the test sample;

[0023] And / or, qPCR was performed on the genome of the test sample using the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14. The Ct value of the qPCR was substituted into the standard curve of Saccharomyces bayanus to calculate the number of Saccharomyces bayanus in the test sample.

[0024] Preferably, in the above qPCR method, in steps B and C, the reaction conditions are: 94°C for 5 min, then 94°C for 5 s, 65 - 67°C for 30 s, for 30 cycles.

[0025] More preferably, in the above qPCR method, in steps B and C, the reaction conditions are: 94°C for 5 min, then 94°C for 5 s, 66°C for 30 s, for 30 cycles.

[0026] Preferably, in the above qPCR method, in steps B and C, the concentrations of the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 are 300 - 500 nM.

[0027] More preferably, in the above qPCR method, in steps B and C, the concentrations of the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 are 400 nM.

[0028] Preferably, in the above qPCR method, in steps B and C, the concentrations of the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 are 300 - 500 nM.

[0029] More preferably, in the above qPCR method, in steps B and C, the concentrations of the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 are 400 nM.

[0030] Preferably, in the above qPCR method, in steps B and C, the concentrations of the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 are 300 - 500 nM.

[0031] More preferably, in the above qPCR method, in steps B and C, the concentrations of the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 are 400 nM.

[0032] Among them, in the above qPCR method, in step B, the reaction system includes: 12.5 μL SYBR Green qPCR MasterMix, 1 μL of upstream and downstream primers at 5.0 - 15.0 μM (in the reaction system, the initial concentrations of the upstream and downstream primers are determined according to the final concentration. For example, when the optimal primer concentration in the examples of the present invention is 400 nM, 1 μL of each of the upstream and downstream primers at an initial concentration of 10.0 μM is added to the reaction system. After adding to the reaction system, the final concentration is 400 nM, that is, 1 μL of 10.0 μM upstream and downstream primers in the reaction system), 1 μL of DNA template, supplemented with ddH2O to 25 μL; the melting curve program is set as: the initial temperature is 60°C, the end temperature is 95°C, the heating rate is 5°C / s, for a total of 36 cycles, and the temperature change in each cycle is 1°C, lasting for 15 s.

[0033] Among them, in the above qPCR method, in step B, the linear range of the standard curve of *Saccharomyces cerevisiae*, *Wickerhamomyces anomalus* and / or *Zygosaccharomyces bailii* is 10 3 -10 8 copies / μL, R 2 ≥0.996; among them, the standard curve of *Saccharomyces cerevisiae* is y = -3.36x + 35.25, the standard curve of *Wickerhamomyces anomalus* is y = -3.21x + 34.60, and the standard curve of *Zygosaccharomyces bailii* is y = -3.26x + 35.96; y represents the Ct value, x represents the Lg value of DNA concentration, and the unit of DNA concentration is copies / μL.

[0034] Among them, in the above qPCR method, the specific primers SEQ ID NO: 3 and SEQ ID NO: 4 of *Saccharomyces cerevisiae*, the specific primers SEQ ID NO: 7 and SEQ ID NO: 8 of *Wickerhamomyces anomalus*, and the specific primers SEQ ID NO: 13 and SEQ ID NO: 14 of *Zygosaccharomyces bailii* are screened by the following method:

[0035] a. Data acquisition and processing: Download the genomic coding sequences of the target yeast strains, and at the same time obtain the protein sequences of non-target yeast strains with close genetic relationship. Merge all the protein sequences of non-target yeasts to construct a protein sequence dataset for screening specific gene sequences; the target yeasts are *Saccharomyces cerevisiae*, *Wickerhamomyces anomalus* and / or *Zygosaccharomyces bailii*;

[0036] b. Screening of specific gene sequences: Align the genomic coding sequences of the target yeasts with the constructed non-target yeast protein sequence dataset, filter all the successfully aligned common sequences, and retain the unaligned sequences as specific gene sequences;

[0037] c. Design of specific primers: According to the specific gene sequences obtained in step b, batch-design qPCR primers, set the amplification length ≤ 300bp, and exclude primers with multiple binding sites and product length inconsistencies through genomic alignment. Select the 3 pairs of primers with the best parameter scores for each of *Saccharomyces cerevisiae*, *Wickerhamomyces anomalus* and *Zygosaccharomyces bailii* (each strain has 3 pairs of primers, and there are a total of 9 pairs of primers for *Saccharomyces cerevisiae*, *Wickerhamomyces anomalus* and *Zygosaccharomyces bailii*);

[0038] d. Screening of specific primers: Under the qPCR reaction conditions of: 94°C for 5 min, then 94°C for 5 s, 66°C for 30 s, 30 cycles, and the primer working concentration of 400 nM, screen the primer pairs obtained in step C to respectively obtain the specific primers of *Saccharomyces cerevisiae*, *Wickerhamomyces anomalus* and / or *Zygosaccharomyces bailii*.

[0039] In the present invention, the DNA standard used for establishing the standard curves of Saccharomyces cerevisiae, Wickerhamomyces anomalus and / or Zygosaccharomyces bailii is the PCR product of three yeast-specific genes. The primers for preparing the PCR products are shown in Table 3, and the method for preparing the PCR products using the primers in Table 3 is a conventional method in the art.

[0040] Among them, in the above qPCR method, the non-target yeast species are Pichia kudriavzevii, Schizosaccharomyces pombe, Saccharomyces pastorianus, Debaryomyces hansenii, Meyerozyma guilliermondii, Pichia membranifaciens, Zygosaccharomyces bisporus, Yarrowia lipolytica, Candida mellicola, Lindnera rhododendri, Candida tropicalis, Torulaspora delbrueckii, Saccharomyces bayanus, Kluyveromyces exiguus, Saccharomycopsis fibuligera, Pichia manshurica, and Kluyveromyces marxianus.

[0041] Among them, in the above qPCR method, the specific gene of Saccharomyces cerevisiae is SC-2811, Genbank accession number: NM_001270751.1.

[0042] Among them, in the above qPCR method, the specific gene of Wickerhamomyces anomalus is WA-280, Genbank accession number: XM_019182897.1.

[0043] Among them, in the above qPCR method, the specific gene of Zygosaccharomyces bailii is ZB-3518, Genbank accession number: HG316462.1.

[0044] The present invention also provides a method for qualitatively detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus and / or Zygosaccharomyces bailii, which comprises the following steps:

[0045] Extract the genome from the sample to be tested, perform qPCR on the genome of the sample to be tested using the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4, and set a blank control. After deducting the blank control, if the difference in Ct values of Saccharomyces cerevisiae ≡ 0 (or no Ct is displayed on the instrument), it indicates that Saccharomyces cerevisiae is not contained in the sample to be tested; if the difference in Ct values of Saccharomyces cerevisiae > 0 (i.e., a certain Ct value greater than 0 is displayed on the instrument), it indicates that Saccharomyces cerevisiae is contained in the sample to be tested;

[0046] And / or, use the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 to perform qPCR on the genome of the sample to be tested, and set a blank control. After deducting the blank control, if the difference in Ct values of abnormal Wickerhamomyces is ≡0, it indicates that the sample to be tested does not contain abnormal Wickerhamomyces; if the difference in Ct values of abnormal Wickerhamomyces > 0, it indicates that the sample to be tested contains abnormal Wickerhamomyces;

[0047] And / or, use the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 to perform qPCR on the genome of the sample to be tested, and set a blank control. After deducting the blank control, if the difference in Ct values of Saccharomyces bayanus is ≡0, it indicates that the sample to be tested does not contain Saccharomyces bayanus; if the difference in Ct values of Saccharomyces bayanus > 0, it indicates that the sample to be tested contains Saccharomyces bayanus;

[0048] The qPCR reaction system is: 12.5 μL SYBR Green qPCR Master Mix, 1 μL each of 10.0 μM upstream and downstream primers, 1 μL of the genome of the sample to be tested, and ddH2O is added to make up to 25 μL; the qPCR program is: 94°C for 5 min, then 94°C for 5 s, 66°C for 30 s, for 30 cycles; the melting curve program is set as: the initial temperature is 60°C, the end temperature is 95°C, the heating rate is 5°C / s, for 36 cycles, and the temperature change for each cycle is 1°C, lasting for 15 s.

[0049] The present invention also provides the application of the above quantitative or qualitative detection method in the field of brewing foods, so as to detect whether brewing foods contain Saccharomyces cerevisiae, abnormal Wickerhamomyces and / or Saccharomyces bayanus, or to detect the content of Saccharomyces cerevisiae, abnormal Wickerhamomyces and / or Saccharomyces bayanus.

[0050] In the present invention, 6 specific primers targeting Saccharomyces cerevisiae, abnormal Wickerhamomyces and Saccharomyces bayanus cannot be added to the sample to be tested simultaneously, because the Ct values of the three yeasts cannot be obtained in this way, and thus the precise quantification of a certain yeast cannot be achieved. If the present invention wants to achieve the simultaneous detection of three strains, 2 specific primers targeting Saccharomyces cerevisiae, abnormal Wickerhamomyces and Saccharomyces bayanus can be added to the sample to be tested respectively and put into the qPCR instrument for reaction simultaneously, because their optimal reaction conditions are the same.

[0051] In the present invention, the microbial genome database used can be selected from the commonly used databases in the art, such as GenBank database, NCBI, etc.

[0052] In the present invention, the comparison tools or methods for protein sequences and nucleic acid sequences can adopt the common tools or methods in the art, such as the BLASTX method, etc.

[0053] In the present invention, the gene sequence design software used can be selected from the commonly used software in the art, such as Primer3-py software, etc.

[0054] In the present invention, the method for annotating genomic sequences to obtain corresponding protein-coding sequences can adopt the commonly used methods in the art, such as manual protein annotation, or annotation through the online website http: / / eggnog-mapper.embl.de / , etc.

[0055] In the present invention, the software for calculating the copy number of bacterial strains used can be selected from the commonly used software in the art, such as Snapgene software, etc.

[0056] Advantages of the present invention:

[0057] Through bioinformatics methods, the present invention compares Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii with other closely related yeasts, identifies highly specific genes of the three target yeasts, and obtains highly specific primers; on this basis, the qPCR reaction conditions and primer working concentrations are further optimized to achieve high specificity in non-target yeasts, with high sensitivity and specificity, which can ensure that the target yeast strain is used during fermentation and avoid contamination by other miscellaneous bacteria.

[0058] By establishing the standard curves of qPCR methods for Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii, the present invention realizes the absolute quantitative detection of the three strains, and their linear ranges are all 10 3 -10 8 copies / μL, R 2 ≥0.996, with relatively high sensitivity, the detection limits all reach 10 copies / μL, and the quantification limits all reach 10 3 copies / μL; moreover, Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii all show extremely high stability and consistency in the repeated experiments of different batches in qPCR detection, indicating that the established qPCR detection method for brewing yeasts has good repeatability between batches.

[0059] The present invention can accurately determine the actual numbers of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii in pure bacterial samples and simulated fermentation samples during the brewing process, which helps to reflect the microbial community situation in real time during the production process, ensure the stability and controllability of the fermentation process, provide a method reference for the digital and intelligent development of brewing foods, and is of great significance for realizing the modernization of the brewing process of traditional brewing foods. Description of the Drawings

[0060] Figure 1The phylogenetic tree at the species level of a total of 20 yeasts, including the target yeast and other non-target yeasts, established according to the 26S rRNA D1 / D2 sequence of the present invention.

[0061] Figure 2 The qPCR primer screening amplification curve of Wickerhamomyces anomalus at an annealing temperature of 60°C; among them, A is the primer pair WA-F1 / R1, B is the primer pair WA-F2 / R2, and C is the primer pair WA-F3 / R3.

[0062] Figure 3 The qPCR primer screening amplification curve of Wickerhamomyces anomalus at an annealing temperature of 62°C; among them, A is the primer pair WA-F1 / R1, B is the primer pair WA-F2 / R2, and C is the primer pair WA-F3 / R3.

[0063] Figure 4 The qPCR primer screening amplification curve of Wickerhamomyces anomalus at an annealing temperature of 64°C; among them, A is the primer pair WA-F1 / R1, B is the primer pair WA-F2 / R2, and C is the primer pair WA-F3 / R3.

[0064] Figure 5 The qPCR primer screening amplification curve of Wickerhamomyces anomalus at an annealing temperature of 66°C; among them, A is the primer pair WA-F1 / R1, B is the primer pair WA-F2 / R2, and C is the primer pair WA-F3 / R3.

[0065] Figure 6 The qPCR primer screening amplification curve of Wickerhamomyces anomalus at an annealing temperature of 68°C; among them, A is the primer pair WA-F1 / R1, B is the primer pair WA-F2 / R2, and C is the primer pair WA-F3 / R3.

[0066] Figure 7 The qPCR primer screening amplification curve of Wickerhamomyces anomalus at a primer concentration of 200 nM; among them, A is the primer pair WA-F1 / R1, B is the primer pair WA-F2 / R2, and C is the primer pair WA-F3 / R3.

[0067] Figure 8 The qPCR primer screening amplification curve of Wickerhamomyces anomalus at a primer concentration of 800 nM; among them, A is the primer pair WA-F1 / R1, B is the primer pair WA-F2 / R2, and C is the primer pair WA-F3 / R3.

[0068] Figure 9 The qPCR primer screening amplification curve of Saccharomyces cerevisiae; among them, A is the primer pair SC-F1 / R1, B is the primer pair SC-F2 / R2, and C is the primer pair SC-F3 / R3.

[0069] Figure 10 Amplification curves for qPCR primer screening of Saccharomyces bayanus; among them, A is primer pair ZB-F1 / R1, B is primer pair ZB-F2 / R2, and C is primer pair ZB-F3 / R3.

[0070] Figure 11 Melting curves for qPCR primer screening of Wickerhamomyces anomalus under the optimal qPCR conditions; among them, A is primer pair WA-F1 / R1, B is primer pair WA-F2 / R2, and C is primer pair WA-F3 / R3.

[0071] Figure 12 Melting curves for qPCR primer screening of Saccharomyces cerevisiae under the optimal qPCR conditions; among them, A is primer pair SC-F1 / R1, B is primer pair SC-F2 / R2, and C is primer pair SC-F3 / R3.

[0072] Figure 13 Melting curves for qPCR primer screening of Saccharomyces bayanus under the optimal qPCR conditions; among them, A is primer pair ZB-F1 / R1, B is primer pair ZB-F2 / R2, and C is primer pair ZB-F3 / R3.

[0073] Figure 14 Amplification curves for qPCR detection of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Saccharomyces bayanus in the present invention at 10 3 -10 8 copies / μL DNA samples; among them, A is Saccharomyces cerevisiae, B is Wickerhamomyces anomalus, and C is Saccharomyces bayanus.

[0074] Figure 15 Standard curves for qPCR detection of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Saccharomyces bayanus established in the present invention; among them, A is Saccharomyces cerevisiae, B is Wickerhamomyces anomalus, and C is Saccharomyces bayanus.

[0075] Figure 16 Results graph for repeatability verification of the qPCR detection method established in the present invention for different concentrations of Saccharomyces cerevisiae, with a significant difference p > 0.05.

[0076] Figure 17 Results graph for repeatability verification of the qPCR detection method established in the present invention for different concentrations of Wickerhamomyces anomalus, with a significant difference p > 0.05.

[0077] Figure 18 Results graph for repeatability verification of the qPCR detection method established in the present invention for different concentrations of Saccharomyces bayanus, with a significant difference p > 0.05. Detailed implementation methods

[0078] To further elaborate on the technical means and effects adopted by the present invention, the following further illustrates the technical solution of the present invention through specific embodiments. However, the present invention is not limited to the scope of the embodiments. The materials used in the following embodiments are not limited to those listed above, and other similar materials can be used for substitution. For instruments without specific conditions specified, they are in accordance with conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, the reagents and methods used in the present invention are conventional reagents and conventional methods in the technical field.

[0079] Example 1: Design of qPCR primers

[0080] Bioinformatics analysis was performed on the genomic coding region DNA sequences of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii in the microbial genome database, and specific gene fragments of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii were screened. The specific steps were as follows: Download the genomic coding sequences of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii from the microbial genome database, as well as the protein sequences of Saccharomyces cerevisiae, Wickerhamomyces anomalus, Pichia kudriavzevii, Schizosaccharomyces pombe, Saccharomyces pastorianus, Debaryomyces hansenii, Meyerozyma guilliermondii, Pichia membranifaciens, Zygosaccharomyces bisporus, Saccharomyces paradoxus, Candida mellicola, Lindnera rhododendri, Candida tropicalis, and Torulaspora delbrueckii. In the NCBI database, there are no protein sequences for Zygosaccharomyces bailii, K. exigua, Saccharomycopsis fibuligera, Pichia manshurica, Zygosaccharomyces bailii, and Kluyveromyces phaffii. Therefore, the whole-genome sequences were downloaded, and their protein-coding sequences were obtained through annotation on the online website http: / / eggnog-mapper.embl.de / . Finally, the protein sequences of all non-target yeasts were merged to construct a protein sequence dataset for specific sequence screening.

[0081] Use the comparison tool of protein sequences and nucleic acid sequences to align the genomic coding sequences of the target yeast in the protein sequence dataset. Among them, the BLASTX parameters are: -evalue 1e-1 (for Saccharomyces cerevisiae), -no-evalue (for Wickerhamomyces anomalus and Zygosaccharomyces bailii). Finally, filter out the aligned sequences in the genomic coding sequences of the target yeast (the output file of the BLASTX method: the common sequences of the target yeast and non-target yeasts), and the remaining sequences are the specific sequences of the target yeast. According to the specific sequences, use gene sequence design software to batch design qPCR primers, and remove the primers that may cause non-specific amplification based on the alignment of the primers on the target yeast genome (if the primer has binding sites at multiple positions on the same chromosome or the theoretical qPCR product length does not match the actual situation of the chromosome, the primer is deleted). On the premise of meeting the primer and probe design principles, ensure that the amplified fragment is within 300 bp. Finally, select 3 pairs of primers with better parameter scores for experimental verification. The designed different primer sequences are shown in Table 1.

[0082] Table 1 PCR specific primer sequence table of Saccharomyces cerevisiae, Wickerhamomyces anomalus and Zygosaccharomyces bailii

[0083]

[0084]

[0085] Example 2: Screening of qPCR primers

[0086] 1. Optimization of annealing temperature

[0087] The present invention selects another 17 non-target yeasts common in the fermentation system (including Saccharomyces pastorianus, Saccharomyces bayanus, Schizosaccharomyces pombe, Saccharomycopsis fibuligera, Candida paradoxa, Candida tropicalis, Pichia membranifaciens, Meyerozyma guilliermondii, Pichia kluyveri, Debaryomyces hansenii, Pichia manshurica, Zygosaccharomyces bisporus, Candida mellicola, Pichia kudriavzevii, Torulaspora delbrueckii, Kazachstania exigua and Cyberlindnera rhodanensis) as specific evaluation objects ( Figure 1 ). Using the genomic DNA of the target yeast as a positive control and the genomic DNAs of 19 non-target yeasts as negative controls, perform qPCR reactions using the same reaction system to prove the specificity of the synthesized primers. The genomic DNA concentration is <100 ng / uL. Among them, for Saccharomyces cerevisiae, special attention should be paid to Saccharomyces pastorianus, Candida paradoxa and Saccharomyces bayanus with similar genetic relationships; for Wickerhamomyces anomalus, special attention should be paid to C. rhodanensis with similar genetic relationships; for Zygosaccharomyces bailii, special attention should be paid to Zygosaccharomyces bisporus with similar genetic relationships.

[0088] The initial conditions for qPCR (with an initial primer concentration of 400 nM at this time) were: 94°C for 5 min, followed by 94°C for 5 s, 60°C for 30 s, for 35 cycles. First, qPCR primers for screening abnormal Wickerhamomyces were selected. The results showed that under the initial conditions, very obvious non-specific amplification occurred in non-target yeasts for all three pairs of qPCR primers. The primer with the highest fluorescence signal was accompanied by the most non-specific amplification, while the non-specific amplification of non-target yeasts was the least for the primer with a lower fluorescence signal, making it difficult to screen out the best primer. To improve the specificity and accuracy of the experiment, the qPCR reaction system was first optimized. Annealing temperature optimization conditions of 60°C, 62°C, 64°C, 66°C, and 68°C were set.

[0089] The results are shown in Figures 2 - 6 . The results showed that when the annealing temperature gradually increased (60°C - 66°C), the non-specific amplification produced by non-target yeasts gradually decreased, and the fluorescence intensity signal of target yeasts gradually increased. However, when the temperature was 68°C, although the non-specific amplification produced by non-target yeasts was almost absent, the fluorescence intensity signal of target yeasts was also very low and the Ct value was large. Therefore, 66°C was selected as the optimal annealing temperature.

[0090] 2. Optimization of primer concentration

[0091] Based on the optimal annealing temperature, the qPCR primer concentration was further optimized. Taking the initial primer concentration of 400 nM as a benchmark, two concentration gradients of 200 nM and 800 nM were set respectively to evaluate the effects of different primer concentrations on the qPCR reaction of abnormal Wickerhamomyces.

[0092] The results are shown in Figures 7 - 8 . The results showed that when the primer concentration was 800 nM, the fluorescence intensity of target yeasts increased, but it was also accompanied by more non-specific amplification; when the primer concentration was 200 nM, it was similar to that at 400 nM, and the non-specific amplification was significantly less than that at 800 nM, but the fluorescence intensity of target yeasts was lower and the time required for amplification to reach the threshold was longer. All three pairs of qPCR primers conformed to this rule. Therefore, 400 nM was determined as the optimal primer working concentration. In addition, since a small amount of non-specific amplification still occurred after 30 cycles for the optimal qPCR primers, the number of cycles in the present invention was reduced from 35 to 30. The optimal qPCR reaction conditions were: 94°C for 5 min, followed by 94°C for 5 s, 66°C for 30 s, for 30 cycles; the optimal primer working concentration was 400 nM.

[0093] 3. Screening of qPCR primers

[0094] As Figures 2 - 13As shown, considering comprehensively the amplification curves and melting curves of the three yeasts at an annealing temperature of 66 °C and a primer concentration of 400 nM, the primer pair WA-F1 / R1 was selected as the specific primer for Wickerhamomyces anomalus, SC-F2 / R2 as the specific primer for Saccharomyces cerevisiae, and ZB-F1 / R1 as the specific primer for Zygosaccharomyces bailii.

[0095] All three pairs of specific primers amplified typical S-shaped amplification curves only in the corresponding target yeast channels, with Ct values < 25. The non-target yeasts had the least non-specific amplification, and the melting curves also showed a single amplification product. These results indicate that the designed primers are highly specific. The optimal specific primers screened are shown in Table 2.

[0096] The specific gene of the selected Saccharomyces cerevisiae in the present invention is SC-2811 (Genbank accession number: NM_001270751.1) (SEQ ID NO:19: CAGGGTCAAAAGAAAGAGAACAAAAGCAATATTGTAATTGTCTCAG TCCACGGCAATGACATGGCATGGCCCCGAAGGCTTTTTTTGTCTGTCTTCCTTGGGTCTTACCCCGCCACGCGTTAATAGTGAGACAAGCAGGAAATCCGTATCATTTTCTCGCATACACGAACCCGCGTGCGCCTGGTAAATTGCAGGATTCTCATTGTCCGGTTTTCTTTATGGGAATAATCATCATCACCATTATCACTGTTACTCTTGCGATCATCATCATTAACATAATTTTTTTAACGCTGTTTGATGATGGTATGTGCTTTTATTGTTCCTTACTCACCTTTTCCTTTGTGTCTTTTAATTTTGACCATTTTGACCATTTTGACCTTTGA), and the specific gene of Wickerhamomyces anomalus is WA-280 (Genbank accession number: XM_019182897.1) (SEQ ID NO:20: GTCAGGCAAACAAGCTGCA ATATCACTAAGATACTCAAATTTTTATGAAATTTTGTTATCAAAGTTGCATTATTTTGTTTTGTTGAAAGAGCTTTCTCACCAGACAACAAAAAAACTTATTATAAAAAGACCATGATCTTCCCTTCCTTGATCGTACTTCCTCCTGATTTTTCTTCATTATCAATCACTTACACTGCGGTGAATAAAGAATTGATATTTATTCTGAGACTACTATATTTACACTTCAAAATGGACAGTGCTGCTAATGCTGCAATGAATGCCAAAATGGCTGCCAACAATGCTGCTAACAGAGCTATGCATGGTGCTATGGCTGCTAACAAAGCTGCCAACAGGGAGATGTTCTCTGCAATGCAAGGGGCTGGTCAAAGTAGTGGAGGTGGAGGTCTTGGTTCAATTGGTGTTCCAGTTGCTGGTGCTGCCTTGGGGTTTATGTTTCCTGGTAGTTCTTTAGTCTATTATGGGTGTATGGCTGCTACTGCCTATTCTTTTGCTGGTTGGTTTTTCTGATTGATTGATTGGCTTTACAATATGATTTGGTTTTTATGAGATTGATATGATATCTATTACCGTGAATAACCTGGCTACATTGTAGATTAATTAATTCGA ACTACTCAAGACGGTTGTCATCGGTGCAACAGCTACTAGTG), the specific gene of Saccharomyces bailii is ZB-3518 (Genbank accession number: HG316462.1) (SEQ ID NO:21: ACTTGCCAAGAAAGGTGTGTCCACCCTCTCTATTGGCGAGGCCCGTTACGGTACAAGCGACAACCGTCGTAGTCTGACCACCTTTGCTAAATGTCTCGAAAGCCGTTCCTCCATATATGGNCCAGGCATAGGTGCTTCTAGAAACGATTTGATTTACACTGCAATCACCCCGCGCCACAGAAAACCCCGTGGAGAGGCCGGTGATCCAATTACCGAGACTCAAATGCCCTACGAGGTATAATACGCTATGATAAACGTTGATAGCCATGCGATAGACATTTGTGCAAAGCGCAACGAGCCGGTACTGAAATGGTCTGTCAGGTGCATCCCCAGATGTTAAAAGCGTGCTTTGTCGTTTCGAGCATGCCAAACCAATAGCATGTGTTTTTATTAAACCGTACACACTGCAAATCATATACTTTTAGGACGAAACAGACCCCATGTGGTCAACGTTCTCGC). These three gene sequences have not been reported in the existing literature and are not described as known genes or sequences related to specific biological processes in relevant gene databases.

[0097] Table 2 Optimal PCR Specific Primer Sequence Table

[0098]

[0099] Example 3: Establishment of Standard Curve

[0100] To evaluate the linear range of the qPCR method, the PCR products of the target gene were purified using the SanPrep Column PCR Product Purification Kit and used as standard fragments. The primers for preparing the PCR products are shown in Table 3. After quantifying the PCR products using a NanoDrop8000 nucleic acid quantifier and confirming the concentration, serial dilutions were prepared as DNA templates for establishing the standard curve. The mass concentration was converted to copy number using a bacterial copy number conversion software, and a gradient range of 10 1 ~10 10 copies / μL of standard samples was set.

[0101] The conditions for preparing the PCR products of the target yeast using the sequences in Table 3 are as follows:

[0102] Saccharomyces cerevisiae: 94°C for 5 min, then 94°C for 30 s, 50°C for 30 s, 72°C for 45 s, 40 cycles, and finally 72°C for 10 min; Wickerhamomyces anomalus: 94°C for 5 min, then 94°C for 30 s, 54.5°C for 30 s, 72°C for 45 s, 40 cycles, and finally 72°C for 10 min; Zygosaccharomyces bailii: 94°C for 5 min, then 94°C for 30 s, 55°C for 30 s, 72°C for 45 s, 40 cycles, and finally 72°C for 10 min.

[0103] Table 3 Primer sequences for preparing the DNA standard curve template used in the present invention

[0104]

[0105] Each sample with a gradient concentration was reacted under the optimal conditions of qPCR. The results are shown in Figure 14 and Figure 15 , and the results showed that the linear ranges of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii were all 10 3 -10 8 copies / μL (the linearity was poor at 10 1 copies / μL, 10 2 copies / μL, and 10 10 copies / μL, so they were not adopted). The slope and intercept were calculated by linear regression analysis. The standard curves of the three target yeasts had good linearity within the concentration range (R 2 were 0.999, 0.999, and 0.996 respectively), and the amplification efficiencies were 98.44%, 104.89%, and 102.65% respectively.

[0106] Example 4: Analysis of the limit of quantification

[0107] The limit of quantification is the lowest level at which the concentration of the target DNA in the sample can be accurately quantified. The DNA standard (10 3 copies / μL) at the lower limit of the linear range of the standard curve was used for qPCR detection to evaluate the limit of quantification of the qPCR method.

[0108] As shown in the experimental results in Tables 4 - 6: For the DNA sample of Saccharomyces cerevisiae at a concentration of 10 3 copies / μL, the coefficient of variation (%CV) of the Ct values of eight replicates was 0.44%, and the %CV of the calculated concentration obtained from the standard curve was 7.69%; for the DNA sample of Wickerhamomyces anomalus at a concentration of 10 3 copies / μL, the %CV of the Ct values of eight replicates was 1.62%, and the %CV of the calculated concentration obtained from the standard curve was 21.23%; for the DNA sample of Zygosaccharomyces bailii at a concentration of 10 4The %CV of the Ct values of the DNA samples at 8 replicates of copies / μL was 0.46%, and the %CV of the calculated concentrations obtained from the standard curve was 8.16%; the %RE of the calculated concentration results for each independent experiment was within ±43.14%, all within the acceptable range (%CV of Ct value ≤ 2%, %CV of the calculated concentration obtained from the standard curve ≤ 25%, relative error (%RE) of the independent experiment test results within ±45%), indicating that this method can stably quantify samples with concentrations of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii of 10 3 copies / μL. Therefore, the present invention determines the quantification limit of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii to be 10 3 copies / μL.

[0109] Table 4 Results of the quantification limit of qPCR detection of Saccharomyces cerevisiae

[0110]

[0111] Table 5 Results of the quantification limit of qPCR detection of Wickerhamomyces anomalus

[0112]

[0113] Table 6 Results of the quantification limit of qPCR detection of Zygosaccharomyces bailii

[0114]

[0115] Example 5: Detection limit evaluation

[0116] Many studies use the 3σ method (3 times the standard deviation of the noise divided by the slope) to calculate the detection limit. This method is applicable to cases with clear background noise. In this study, the background noise is the Ct value measured without adding a DNA template. However, there is no Ct value for the blank sample without adding a DNA template, and the 3 times the standard deviation of the background noise cannot be calculated. Therefore, the present invention uses the regression analysis of the standard curve to calculate the predicted value of the detection limit, that is, by dividing the standard deviation of 3 times the regression residual by the absolute value of the slope of the standard curve. The detection limits of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii calculated according to the standard curve are 1.42 copies / μL, 1.75 copies / μL, and 2.51 copies / μL, respectively.

[0117] To verify the reliability of the theoretically calculated detection limit, the present invention selects three DNA standards of different orders of magnitude near it (100 copies / μL, 10 copies / μL, and 1 copy / μL) to evaluate the detection ability of the qPCR method for DNA standards in the low concentration range in practical applications. Eight independent replicates are set for each concentration, and the minimum concentration at which all the measurement results can be detected is the actual detection limit of the qPCR method. The results are shown in Tables 7, 8, and 9.

[0118] These data show that for samples with a concentration of 1 copy / μL of Saccharomyces bayanus DNA, 5 out of 8 replicates were positive; for samples with a concentration of 1 copy / μL of Saccharomyces cerevisiae and Wickerhamomyces anomalus DNA, none of the 8 replicates could be detected; while for samples with a concentration of 10 copies / μL of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Saccharomyces bayanus DNA, all 8 replicates of qPCR detection were positive results, indicating that the detection limit of qPCR for Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Saccharomyces bayanus is 10 copies / μL.

[0119] Table 7 Results of the detection limit of qPCR for Saccharomyces cerevisiae

[0120]

[0121] Table 8 Results of the detection limit of qPCR for Wickerhamomyces anomalus

[0122]

[0123] Table 9 Results of the detection limit of qPCR for Saccharomyces bayanus

[0124]

[0125] Example 6: Repeatability verification

[0126] To evaluate the repeatability of the qPCR test, Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Saccharomyces bayanus at 10 4 copies / μL, 10 6 copies / μL, 10 8DNA standards at copies / μL were used as the objects for repeatability testing. For each concentration of DNA standards, three independent between-batch experiments were conducted separately (repeated experiments were carried out every other day, for a total of three times). In the same batch of experiments, 3 replicates were set for each concentration of DNA standards. The qPCR repeatability test was completed using the optimized qPCR detection conditions to examine the stability of the qPCR detection method at different times. The results were analyzed statistically, and the average Ct value, average measured concentration ( copies), standard deviation (SD), %CV, and %RE of the independent experiment detection results were calculated for the same standard in parallel. If the %CV of the Ct value in each within-batch experiment ≤ 2%, the %CV of the actual quantity calculated from the standard curve ≤ 25%, the %RE within ± 25%, and there were no significant differences among the batches of experiments, it was considered to have good repeatability and stability.

[0127] Tables 10 - 12 show the results of repeatability experiments for each batch of the qPCR method established in the present invention for detecting Saccharomyces cerevisiae , Wickerhamomyces anomalus , and Zygoascus bailii . The %CV of the Ct values obtained from the repeatability experiments for each batch of Saccharomyces cerevisiae were all ≤ 1.77%, the %CV of the calculated concentrations obtained from the standard curve were all ≤ 9.75%, and the %RE of the calculated concentration results for each independent experiment were within ± 43.14%; the %CV of the Ct values obtained from the repeatability experiments for each batch of Wickerhamomyces anomalus were all ≤ 1.66%, the %CV of the calculated concentrations obtained from the standard curve were all ≤ 12.58%, and the %RE of the calculated concentration results for each independent experiment were all within ± 18.44%; the %CV of the Ct values obtained from the repeatability experiments for each batch of Zygoascus bailii were all ≤ 1.87%, the %CV of the calculated concentrations obtained from the standard curve were all ≤ 15.94%, and the %RE of the calculated concentration results for each independent experiment were all within ± 16.03%, all within the acceptable range, further confirming the consistency and repeatability of the detection results. These results show that in multiple repetitions of DNA samples at the same concentration, the fluctuation ranges of the Ct value and the calculated concentration obtained from the standard curve are small, and the amplification efficiency of this method has extremely high stability within each batch.

[0128] In addition, the present invention conducted a significant difference analysis on the experimental results of each batch of DNA standards at each concentration. The repeatability experimental results of different batches are as Figures 16 - 18 shown. The results show that there were no significant differences among the repeatability experimental results of different batches (p > 0.05), indicating that this method has good repeatability.

[0129] Table 10 Repeatability results of qPCR detection of Saccharomyces cerevisiae

[0130]

[0131]

[0132] Table 11 Repeatability results of qPCR detection of *Wickerhamomyces anomalus*

[0133]

[0134]

[0135] Table 12 Repeatability results of qPCR detection of *Zygosaccharomyces bailii*

[0136]

[0137]

[0138] Example 7: Application of qPCR method in pure bacterial system

[0139] The pure bacterial samples were quantitatively detected by the method of consistency detection. The corresponding gene fragments of *Saccharomyces cerevisiae*, *Wickerhamomyces anomalus* and *Zygosaccharomyces bailii* in Example 4 were used, and their concentrations were measured after purification using a purification kit. Then they were diluted to several known concentrations, that is, the theoretical concentrations. The above samples were detected by the qPCR method, and the Ct values were converted to the actual numbers through the standard curve. Finally, the %CV between the Ct values and the actual numbers in parallel and the %RE with the theoretical concentration were calculated. If the detection results meet %CV of Ct values ≤ 2%, %CV of actual numbers ≤ 25% and %RE within ±25%, it means that the detection results meet the accuracy requirements.

[0140] The results obtained are shown in Table 13. The samples at each concentration meet the accuracy standards, and the recovery rate ranges from 88.45% to 124.34%, indicating that the qPCR method established in the present invention can accurately quantify pure bacterial samples of *Saccharomyces cerevisiae*, *Wickerhamomyces anomalus* and *Zygosaccharomyces bailii* within the linear range.

[0141] Table 13 Application of qPCR detection method in pure bacterial samples

[0142]

[0143]

[0144] Example 8: Application of qPCR method in simulated fermentation sample system

[0145] The simulated fermentation samples were prepared by mixing and culturing 19 non-target yeasts corresponding to each target yeast and extracting DNA, and then adding known concentrations of target yeast DNA (the corresponding gene fragments of Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii in Example 4). The above samples were detected by qPCR method, and the Ct values were converted to the actual quantity through the standard curve. The %CV between parallel Ct values and actual quantities and the %RE between the actual quantity and the theoretical concentration were also calculated. If the test results meet the requirements of %CV of Ct value ≤ 2%, %CV of actual quantity ≤ 25%, and %RE within ±25%, it indicates that the test results meet the accuracy requirements.

[0146] The results are shown in Table 14. The samples at each concentration were detected by qPCR technology, and the test results all met the accuracy standards. The spiked recovery rate ranged from 88.31% to 108.85%, indicating that the qPCR method established in the present invention can accurately quantify the simulated fermentation samples containing Saccharomyces cerevisiae, Wickerhamomyces anomalus, and Zygosaccharomyces bailii within the linear range.

[0147] Table 14 Application of qPCR Detection Method in Simulated Fermentation Samples

[0148]

[0149]

[0150] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Specific primers for detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus and / or Zygosaccharomyces bailii, characterized in that: The specific primer sequences of Saccharomyces cerevisiae are shown in SEQ ID NO: 3 and SEQ ID NO: 4, the specific primer sequences of Wickhamella anomala are shown in SEQ ID NO: 7 and SEQ ID NO: 8, and the specific primer sequences of Zygosaccharomyces bailii are shown in SEQ ID NO: 13 and SEQ ID NO:

14.

2. A qPCR method for quantitatively detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus and / or Zygosaccharomyces bailii, characterized in that: The following steps are involved: A. preparing a PCR product of Saccharomyces cerevisiae using the primers shown in SEQ ID NO: 22 and SEQ ID NO: 23, and configuring the PCR product into a series of Saccharomyces cerevisiae DNA templates with different concentrations and known concentrations; and / or, preparing a PCR product of Wickham's yeast using the primers shown in SEQ ID NO: 24 and SEQ ID NO: 25, and configuring the PCR product into a series of Wickham's yeast DNA templates with different and known concentrations; and / or, preparing a PCR product of Zygosaccharomyces bailii using the primers shown in SEQ ID NO: 26 and SEQ ID NO: 27, and configuring the PCR product into a series of Zygosaccharomyces bailii DNA templates of different and known concentrations; B. Perform qPCR on a series of concentrations of Saccharomyces cerevisiae DNA templates using the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and draw a standard curve of Saccharomyces cerevisiae with the DNA concentration Lg value as the horizontal axis and the Ct value as the vertical axis; and / or, using the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 to perform qPCR on a series of concentrations of abnormal Wickham yeast DNA templates, and plotting a standard curve of abnormal Wickham yeast with the DNA concentration Lg value as the horizontal axis and the Ct value as the vertical axis; and / or, using the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 to perform qPCR on a series of concentrations of Zygosaccharomyces bailii DNA templates, and plotting a standard curve of Zygosaccharomyces bailii with the DNA concentration Lg value as the horizontal axis and the Ct value as the vertical axis; In step B, qPCR was performed using a two-step qPCR amplification procedure with the following reaction conditions: 94°C for 5 min, followed by 94°C for 5 s, 64-68°C for 30 s, for 30 cycles; In step B, the concentration of the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 is 200-600 nM; In step B, the concentration of the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 is 200-500 nM; In step B, the concentration of the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 is 200-600 nM; C. Extract the genome of the sample to be tested, and perform qPCR on the genome of the sample to be tested using the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 under the same reaction conditions and primer concentrations as in step B, and substitute the Ct value of qPCR into the standard curve of Saccharomyces cerevisiae to convert and obtain the amount of Saccharomyces cerevisiae in the sample to be tested; and / or, using the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 to perform qPCR on the genome of the sample to be tested, substituting the Ct value of qPCR into the standard curve of abnormal Wickham yeast, and converting to obtain the number of abnormal Wickham yeast in the sample to be tested; And / or, using the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 to perform qPCR on the genome of the sample to be tested, substituting the Ct value of qPCR into the standard curve of Zygosaccharomyces bailii to convert the number of Zygosaccharomyces bailii in the sample to be tested.

3. The qPCR method according to claim 2, characterized in that: In steps B and C, the reaction conditions are: 94°C for 5 min, followed by 94°C for 5 s, 65-67°C for 30 s, for 30 cycles; preferably, the reaction conditions are: 94°C for 5 min, followed by 94°C for 5 s, 66°C for 30 s, for 30 cycles.

4. The qPCR method according to claim 2, characterized in that: At least one of the following is met: In steps B and C, the concentration of the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 is 300-500 nM, preferably 400 nM; In steps B and C, the concentration of the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 is 300-500 nM, preferably 400 nM; In steps B and C, the concentration of the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 is 300-500 nM, preferably 400 nM.

5. The qPCR method according to claim 2, characterized in that: In step B, the reaction system includes: 12.5 μL SYBRGreen qPCR Master Mix, 1 μL 5.0-15.0 μM upstream and downstream primers, 1 μL DNA template, supplemented with ddH2O to 25 μL; the melting curve program is set as follows: initial temperature is 60°C, end temperature is 95°C, heating rate is 5°C / s, a total of 36 cycles, the temperature change of each cycle is 1°C, and it lasts for 15 seconds.

6. The qPCR method according to claim 2, characterized in that: In step B, the linear range of the standard curve of Saccharomyces cerevisiae, Saccharomyces anomala and / or Zygosaccharomyces bailii was 10 3 -10 8 copies / μL, R 2 ≥0.996; wherein, the standard curve of Saccharomyces cerevisiae is y=-3.36x+35.25, the standard curve of Anomalous Wickham's yeast is y=-3.21x+34.60, and the standard curve of Zygosaccharomyces bailii is y=-3.26x+35.96; y represents the Ct value, x represents the DNA concentration Lg value, and the unit of DNA concentration is copies / μL.

7. The qPCR method according to any one of claims 2 to 6, characterized in that: The characteristic primers SEQ ID NO: 3 and SEQ ID NO: 4 of Saccharomyces cerevisiae, the characteristic primers SEQ ID NO: 7 and SEQ ID NO: 8 of Anomalous Wickham's yeast, and the characteristic primers SEQ ID NO: 13 and SEQ ID NO: 14 of Zygosaccharomyces bailii were screened by the following method: a. Data acquisition and processing: download the genome coding sequence of the target yeast species, and simultaneously obtain the protein sequences of non-target yeast species with similar affinity, and merge the protein sequences of all non-target yeast species to construct a protein sequence data set for specific gene sequence screening; the target yeast is Saccharomyces cerevisiae, Wickham's yeast and / or Zygosaccharomyces bailii; b. Specific gene sequence screening: compare the target yeast genome coding sequence with the constructed non-target yeast protein sequence dataset, filter all the common sequences that have been successfully aligned, and retain the unaligned sequences as specific gene sequences; c. Specific primer design: According to the specific gene sequence obtained in step b, batch design qPCR primers, set the amplification length ≤ 300bp, exclude primers with multiple binding sites and inconsistent product lengths through genome alignment, and select the three pairs of primers with the best parameter scores for Saccharomyces cerevisiae, Wickham's yeast and Zygosaccharomyces bailii; d. Specific primer screening: Under the qPCR reaction conditions of 94°C for 5 min, followed by 94°C for 5 s, 66°C for 30 s, 30 cycles, and a primer working concentration of 400 nM, the primer pairs obtained in step C were screened to obtain specific primers for Saccharomyces cerevisiae, Wickham's yeast and / or Zygosaccharomyces bailii.

8. The qPCR method according to claim 7, characterized in that: At least one of the following is met: The non-target yeast species are Pichia kudriavzevii, Schizosaccharomyces pombe, Saccharomyces pastorianus, Debaryomyces hansenii, Meyer yeast, Pichia pastoris, Zygosaccharomyces bisporus, Saccharomyces paradoxus, Candida mellifera, Lindnerella rhodendron, Candida tropicalis, Torula delbelli, Saccharomyces bayanus, K. exigua, Saccharomyces fusobacteria, Pichia capsulata and Pichia kluyveri; The specific gene of Saccharomyces cerevisiae is SC-2811, Genbank accession number: NM_001270751.1; The specific gene of Wickham's yeast is WA-280, Genbank accession number: XM_019182897.1; The specific gene of Zygosaccharomyces bailii is ZB-3518, and its Genbank accession number is HG316462.

1.

9. A method for qualitatively detecting Saccharomyces cerevisiae, Wickerhamomyces anomalus and / or Zygosaccharomyces bailii, characterized in that: The following steps are involved: Extract the genome of the sample to be tested, perform qPCR on the genome of the sample to be tested using the primers shown in SEQ ID NO: 3 and SEQ ID NO: 4, and set a blank control. After deducting the blank control, if the difference in the Ct value of Saccharomyces cerevisiae is ≡0, it means that the sample to be tested does not contain Saccharomyces cerevisiae. If the difference in the Ct value of Saccharomyces cerevisiae is greater than 0, it means that the sample to be tested contains Saccharomyces cerevisiae. and / or, using the primers shown in SEQ ID NO: 7 and SEQ ID NO: 8 to perform qPCR on the genome of the sample to be tested, and setting a blank control, after deducting the blank control, if the difference in the Ct values ​​of the abnormal Wickham yeast is ≡0, it means that the sample to be tested does not contain abnormal Wickham yeast, and if the difference in the Ct values ​​of the abnormal Wickham yeast is >0, it means that the sample to be tested contains abnormal Wickham yeast; and / or, using the primers shown in SEQ ID NO: 13 and SEQ ID NO: 14 to perform qPCR on the genome of the sample to be tested, and setting a blank control, after deducting the blank control, if the difference in the Ct value of Zygosaccharomyces bailii is ≡0, it means that the sample to be tested does not contain Zygosaccharomyces bailii, and if the difference in the Ct value of Zygosaccharomyces bailii is ≡>0, it means that the sample to be tested contains Zygosaccharomyces bailii; The qPCR reaction system was: 12.5 μL SYBR Green qPCR Master Mix, 1 μL each of 10.0 μM upstream and downstream primers, 1 μL of the genome of the sample to be tested, supplemented with ddH2O to 25 μL; the qPCR program was: 94°C for 5 min, followed by 94°C for 5 s, 66°C for 30 s, and 30 cycles; the melting curve program was set as: initial temperature of 60°C, end temperature of 95°C, heating rate of 5°C / s, for a total of 36 cycles, with a temperature change of 1°C for each cycle, lasting 15 s.

10. Use of the qPCR method according to any one of claims 2 to 8 or the method according to claim 9 in the field of brewed food.

Images