Method for constructing vitamin E production strain by synchronously editing and recombining three sites of yeast genome and application

Abstract

The invention discloses a method for constructing a vitamin E production strain by synchronously editing and recombining three sites of a yeast genome and application, and relates to the technical field of synthetic biology and metabolic engineering. According to the invention, a helper plasmid for expressing CRISPR-Cas9 protein and three targeted specific site guide RNA (sgRNA) is constructed, and the helper plasmid and three vitamin E pathway gene donor fragments which are assembled and cloned in escherichia coli in advance are co-transformed into saccharomyces cerevisiae, so that efficient editing and large-scale gene fragment integration can be simultaneously carried out on three chromosome sites of HO, GAL80 and ARO10. The three-site synchronous editing and recombination efficiency of the method exceeds 80%. By utilizing the method, an engineering strain of a complete vitamin E synthesis route can be rapidly constructed at one time, and fermentation verifies that the yield of the vitamin E can reach 5.9 g / L. The invention provides an efficient and universal tool for quickly constructing complex metabolic pathways in yeast.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and metabolic engineering, and more specifically to a method and application for constructing a vitamin E-producing strain by synchronous three-point editing and recombination of the yeast genome. Background Technology

[0002] Currently, using gene editing technology to modify the genomes of microorganisms at multiple sites on a large scale is a core strategy for building efficient cell factories and producing high-value-added natural products. Vitamin E, as an important fat-soluble vitamin, has a long and complex biosynthetic pathway involving the coordinated expression of multiple heterologous genes. Traditional methods typically employ multi-round, sequential gene editing, which is cumbersome, time-consuming, and prone to affecting the physiological state of strains under the pressure of multiple rounds of selection, resulting in low final efficiency.

[0003] The CRISPR-Cas system has been widely used in yeast genome editing. However, current technologies mostly focus on editing or knocking out single sites. Although some studies have attempted to integrate multiple gene fragments into yeast to produce products such as lycopene, these methods are essentially still based on sequential integration of homologous recombination or the integration of multiple gene expression cassettes at a single site. This makes it difficult to achieve the synchronous and efficient integration of different large gene fragment modules at multiple chromosomal sites. Especially for long pathways like vitamin E, it is necessary to rationally allocate and synchronously integrate pathway modules into different safe sites in the genome to balance metabolic flux and reduce the risk of genomic instability. Technical methods that can achieve the synchronous and efficient precise integration of large gene fragments (each fragment containing multiple gene expression cassettes) at three or more independent sites in *Saccharomyces cerevisiae* have not yet been reported.

[0004] Therefore, providing a method for constructing vitamin E-producing strains through simultaneous three-point editing and recombination of the yeast genome, and its application, is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a method for simultaneously and efficiently performing gene editing and large gene fragment integration at multiple genomic sites in Saccharomyces cerevisiae and its application in constructing a long vitamin E synthesis pathway.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A method for constructing a vitamin E-producing strain through simultaneous three-point editing and recombination of the yeast genome includes the following steps: Helper plasmids expressing CRISPR-Cas9 protein and three sgRNAs, along with three independent donor DNA fragments, were co-transformed into Saccharomyces cerevisiae cells; The three sgRNAs target the HO site, GAL80 site, and ARO10 site on the Saccharomyces cerevisiae genome, respectively. The sgRNA sequence targeting the HO site is: CATATACAGTACTCTCACCC, as shown in SEQ ID NO: 1; The sgRNA sequence targeting the GAL80 site is: ACGATAGTTGCAGTATGGCG, as shown in SEQ ID NO: 2; The sgRNA sequence targeting the ARO10 site is: AGAGTAACGGGAATATCCGT, as shown in SEQ ID NO: 3; The three independent donor DNA fragments each contain gene sequences of the vitamin E synthesis pathway for integration into the HO site, GAL80 site, and ARO10 site; Each of the donor DNA fragments contains homologous arms at both ends that are homologous to the target genomic site.

[0008] Furthermore, the three independent donor DNA fragments consist of the following sequences, and all were pre-assembled in E. coli and cloned into a vector: (1) The fragment targeting the HO site has the sequence shown in SEQ ID NO: 4; Its sequence structure is as follows: HO upstream homologous arm: LEU screening marker - Ppgk1 - HPPD - Tpgk1 - Ptef1 - syHPT - Ttef1 - Ptpi1 - tTC - Ttpi1 - Ptdh1 - tHMG1 - Ttdh2 - Ppef2 - CRTE - Tpdx1: HO downstream homologous arm; (2) The fragment targeting the GAL80 site has the sequence shown in SEQ ID NO: 5; Its sequence structure is as follows: upstream homologous arm of GAL80: HIS screening marker - Tgpm1 - SAGGPP - Pgal10 - Pgal1 - YHPDR1 - Tfba1: downstream homologous arm of GAL80; (3) The fragment targeting the ARO10 site, the sequence of which is shown in SEQ ID NO: 6; Its sequence structure is as follows: upstream homologous arm of ARO10: URA screening marker - Tadh1 - AtIPK - Pgap - Pfba1 - SmDAGK - Tcyc1 - Pgpm1 - tHMG1 - Teno2 - Ppcd1 - IDI1 - Thxt7 - Peno2 - ERG20 - Tgpd: downstream homologous arm of ARO10.

[0009] Furthermore, the helper plasmid includes the following components: a Cas9 protein expression cassette, a multi-sgRNA array driven by the PolIII promoter, and a selection marker gene; The multiple sgRNA array consists of three tandem sgRNAs, each sgRNA being a specific target sequence targeting the HO, GAL80, and ARO10 sites sequentially. The sgRNA array is separated by tRNA spacer sequences.

[0010] Furthermore, the method for co-transforming CRISPR-Cas9 protein and three sgRNA helper plasmids, along with three independent donor DNA fragments, into Saccharomyces cerevisiae cells is a specially optimized yeast protoplast transformation method, including the following steps: Fresh yeast single clones were picked and cultured overnight in YAPD liquid medium; the next day, they were transferred to 50 mL of YPAD medium with an initial OD600 of 0.2 and cultured at 30 °C for 5-6 h until the OD600 reached 1.5-2, thus obtaining yeast cell culture medium. Centrifuge the yeast cell culture medium at 1600g for 3 min at 4°C and remove the supernatant; add 50 mL of sterile water to resuspend the cells, centrifuge at 1600g for 3 min at 4°C and remove the supernatant; then add 20 mL of 1M sorbitol solution to resuspend the cells and place them on ice or at 4°C for 4 h to 20 h to obtain the yeast cell resuspension. Centrifuge the yeast cell resuspension at 1600g for 3 min at 4℃ and remove the supernatant; add 20 mL of LPE solution, 30 μL of Zymolyase-20T and 40 μL of mercaptoethanol in sequence, and place in a shaker at 30℃ and shake slowly for 35 min to obtain a mixed solution. Take 200 μL of the mixed solution and add it to 1800 μL of 1M sorbitol (containing 2% SDS), and calculate the OD600 ratio. When the OD600 ratio is between 3 and 4, collect the protoplasts by centrifuging at 570g for 10 min at 5℃, and gently discard the supernatant. Resuspend the protoplasts by adding 50 mL of 1M sorbitol solution again, centrifuge at 300-600g for 10 min at 5℃, and wash the protoplasts twice. Add 2 mL of LSC solution, mix thoroughly, and resuspend. Aliquot 200 μL of the protoplast resuspension into EP tubes. Add three linearized donor DNA fragments and the complete pCAS9-3g plasmid to 200 μL of protoplasts, mix gently, with a final concentration of 2 mg / L for each of the three linearized donor DNA fragments and 1 mg / L for the complete pCAS9-3g plasmid, and incubate at room temperature for 10 min; then add 800 μL of [the remaining protoplast]. Mix 20% PEG8000 thoroughly and incubate at room temperature for 10 min. Centrifuge at 300-500g for 5 min at 5℃ and remove the supernatant. Add 800 μL LOS solution and resuspend the protoplasts using a pipette tip. Incubate at 30℃ for 40 min. Finally, transfer the protoplast transformation system to 7 mL of SORB-TOP selection medium that has been melted and cooled to 50-60℃. Mix gently and spread evenly on a 50℃ preheated SORB-DOWN-Leu-His-Ura (triple-deficient) selection medium plate for selection. This applies the selection pressure of LEU, HIS, and URA carried by the three site integration fragments simultaneously. Incubate at 30℃ for 4-7 days.

[0011] Furthermore, the donor DNA fragment is amplified by PCR and used as a linearized fragment for transformation.

[0012] A method for constructing a vitamin E-producing strain of Saccharomyces cerevisiae via simultaneous three-site editing and recombination of the yeast genome, wherein the strain integrates the vitamin E synthesis pathway gene fragment as described in claim 2 at the HO, GAL80 and ARO10 sites of its genome.

[0013] Application of engineered strains of Saccharomyces cerevisiae in the fermentation production of vitamin E.

[0014] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows: 1. High efficiency and synchronization: This invention is the first to achieve the integration of large gene fragments (>10 kb) at three independent chromosomal loci in a single transformation in Saccharomyces cerevisiae. The average efficiency of simultaneous editing and recombination at the three loci can reach more than 82.5%, which greatly shortens the construction cycle of complex metabolic pathways.

[0015] 2. Modular design: The long biosynthetic pathway of vitamin E is rationally divided into three functional modules, which are integrated into different sites. This is conducive to the balance and optimization of metabolic flux and avoids the excessive metabolic burden on a single genomic site.

[0016] 3. Clear application: The method was successfully applied to construct a vitamin E synthesizing strain, and its production performance was verified at the fermenter level, with a yield of up to 5.9 g / L, proving the practicality and efficiency of the method. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0018] Figure 1 This is a schematic diagram illustrating the working principle of the three-point synchronous editing and recombining system of the present invention; Figure 2 This is an electrophoresis image of colonies after ARO10 site editing and recombination in Example 2, used for PCR verification. Figure 3 This is an electrophoresis image of colonies after HO site editing and recombination in Example 2, used for PCR verification. Figure 4 This is an electrophoresis image of colonies after GAL80 site editing and recombination in Example 2, used for PCR verification. Figure 5 The positive rate results of colony PCR verification after three-point synchronous editing and recombination in Example 3; Figure 6 This is a graph showing the vitamin E production of the engineered strain in the fermenter in Example 4. Detailed Implementation

[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] Source of experimental materials: Saccharomyces cerevisiae CEN.PK2-1C: Derived from the American Type Culture Collection (ATCC), number MYA-1108; YAPD liquid culture medium: Yeast extract (Solarbio, Cat#Y8020, Beijing Solarbio Technology Co., Ltd.): 10 g / L, Peptone (Solarbio, Cat#P8450, Beijing Solarbio Technology Co., Ltd.): 20 g / L, Glucose: 20 g / L (concentration range 10-20 g / L, commonly 20 g / L), solvent: deionized water to a final volume of 1 L. After preparation and mixing, autoclave at 115℃ for 15 min, and use after cooling to room temperature. SORB-DOWN-Leu-His-Ura (three-deficiency) screening medium: Yeast nitrogen source base (YNB, amino acid-free, Solarbio, Cat#Y8040, Beijing Solarbio Technology Co., Ltd.): 1.7g (Note: This dosage is one of the formulations; concentrations vary between brands, but a common dosage is 3.33g / L), Ammonium Sulfate: 5g, Tri-Leu / -His / -Ura DO Supplement: 1.3g, Glucose: 20g, Solvent: Deionized water to a final volume of 1L. If preparing solid culture medium, add an additional 20g / L of agar to the above system. For mixing liquid or solid media, autoclave at 115℃ for 15 minutes after mixing. Allow to cool to room temperature before using the liquid, or cool to 50-60℃ before pouring into solid plates for later use.

[0021] All other experimental materials are commercially available products commonly used in this field.

[0022] Example 1 Construction of plasmids and donor fragments for multi-site editing CRISPR system (see working principle) Figure 1 ) 1. Construction of CRISPR helper plasmid pCAS9-3g: Using the existing Saccharomyces cerevisiae CRISPR plasmid (pCAS plasmid) as the backbone, its Cas9 expression cassette (TEF1 promoter-Cas9-CYC1 terminator) and hygromycin resistance marker (HygR) were retained. Through overlap-extension PCR, the coding sequences of three sgRNAs targeting the HO site (target sequence SEQ ID NO: 1), GAL80 site (target sequence SEQ ID NO: 2), and ARO10 site (target sequence SEQ ID NO: 3) in the Saccharomyces cerevisiae genome were tandemly cloned downstream of the SNR52 promoter of the backbone plasmid, constructing an array expressing the three sgRNAs. The helper plasmid pCAS9-3g was finally obtained.

[0023] The target sequence for the HO site is TGG, and the PAM site is TGG. CATATACAGTACTCTCACCC, as shown in SEQ ID NO: 1; The target sequence for GAL80 is GGG at the PAM site. ACGATAGTTGCAGTATGGCG, as shown in SEQ ID NO: 2; The target sequence for ARO10 is CGG at the PAM site. AGAGTAACGGGAATATCCGT, as shown in SEQ ID NO: 3.

[0024] 2. Preparation of donor DNA fragments: (1) The fragment targeting the HO site has the sequence shown in SEQ ID NO: 4; Its sequence structure is as follows: HO upstream homologous arm: LEU screening marker - Ppgk1 - HPPD - Tpgk1 - Ptef1 - syHPT - Ttef1 - Ptpi1 - tTC - Ttpi1 - Ptdh1 - tHMG1 - Ttdh2 - Ppef2 - CRTE - Tpdx1: HO downstream homologous arm; (2) The fragment targeting the GAL80 site has the sequence shown in SEQ ID NO: 5; Its sequence structure is as follows: upstream homologous arm of GAL80: HIS screening marker - Tgpm1 - SAGGPP - Pgal10 - Pgal1 - YHPDR1 - Tfba1: downstream homologous arm of GAL80; (3) The fragment targeting the ARO10 site, the sequence of which is shown in SEQ ID NO: 6; Its sequence structure is as follows: upstream homologous arm of ARO10: URA screening marker - Tadh1 - AtIPK - Pgap - Pfb a1-SmDAGK-Tcyc1-Pgpm1-tHMG1-Teno2-Ppcd1-IDI1-Thxt7-Peno2-ERG20-Tgpd::ARO10 downstream homologous arm.

[0025] The three integrated fragment sequences were synthesized in their entirety by a biotechnology company and cloned into the *E. coli* cloning vector (pCC1) to obtain plasmids pDonor-HO, pDonor-GAL80, and pDonor-ARO10. High-fidelity DNA polymerase was used to digest the fragments at the reserved NotI sites (GCGGCCGC) located on the outer side of each homologous arm, yielding linearized donor DNA fragments with homologous arms at both ends. These fragments were then purified and ready for use.

[0026] The CRISPR plasmid of the brewer's yeast has the sequence shown in SEQ ID NO: 7; The Escherichia coli cloning vector described herein has the sequence shown in SEQ ID NO: 8.

[0027] Example 2: Yeast genome single-point editing recombination efficiency verification To verify the effectiveness of each component of the system, a unit point editing test was first conducted.

[0028] 1. ARO10 site Experimental group: plasmid pCAS9-3g (whose sgRNA array at this time only contains the ARO10 site targeting sequence) and linearized ARO10 site donor DNA fragment were co-transformed into Saccharomyces cerevisiae CEN.PK2-1C competent cells.

[0029] Control group 1: Only pCAS9-3g plasmid was transformed.

[0030] Control group 2: Only the donor DNA fragment at the ARO10 site was transformed.

[0031] Transformation buffer was plated on SC-Ura+hygromycin (a marker targeting the URA3 tag in the ARO10 integration site and a hygromycin resistance marker targeting the pCAS plasmid) and incubated at 30°C for 2-3 days. Twenty single clones were randomly selected from the experimental group plates for colony PCR validation (using validation primers located outside the genomic integration site and inside the donor fragment).

[0032] The results showed that all 20 randomly selected clones displayed correct PCR bands, with a unit-point editing recombination efficiency of 100% (20 / 20). In contrast, control group 1 showed no colony growth on the corresponding selection plates, and control group 2 showed a colony PCR verification recombination efficiency of 70% (14 / 20) on the corresponding selection plates.

[0033] like Figure 2 The gel electrophoresis results show 808 bp obtained by PCR verification at the integration site 500 bp upstream of ARO10 and 733 bp obtained by PCR verification at the integration site 500 bp downstream of ARO10 in the experimental group of cloned bacteria. This result demonstrates that the CRISPR cleavage targeting a single site and the donor DNA-mediated homologous recombination repair system are highly efficient.

[0034] 2. HO site Experimental group: plasmid pCAS9-3g (whose sgRNA array at this time only contains the HO site targeting sequence) and linearized HO site donor DNA fragment were co-transformed into Saccharomyces cerevisiae CEN.PK2-1C competent cells.

[0035] Control group 1: Only pCAS9-3g plasmid was transformed.

[0036] Control group 2: Only the HO site donor DNA fragment was transformed.

[0037] Transformation buffer was plated on SC-Leu + hygromycin (LEU2 marker targeting the HO site integration fragment and hygromycin resistance marker targeting the pCAS plasmid) plates and incubated at 30°C for 2-3 days. Twenty single clones were randomly selected from the experimental group plates for colony PCR verification (using verification primers located outside the genomic integration site and inside the donor fragment).

[0038] The results showed that all 20 randomly selected clones displayed correct PCR bands, with a unit-point editing recombination efficiency of 100% (20 / 20). In contrast, control group 1 showed no colony growth on the corresponding selection plates, and control group 2 showed a colony PCR recombination efficiency of 75% (15 / 20) on the corresponding selection plates.

[0039] like Figure 3 The gel electrophoresis results show the 1050bp result obtained by PCR verification at the integration site 500bp upstream of the HO site and the 1072bp result obtained by PCR verification at the integration site 500bp downstream of the HO site in the experimental group of cloned bacteria. This result demonstrates that the CRISPR cleavage targeting a single site and the donor DNA-mediated homologous recombination repair system are highly efficient.

[0040] 3. GAL80 site Experimental group: plasmid pCAS9-3g (whose sgRNA array at this time only contains the GAL80 site target sequence) and linearized GAL80 site donor DNA fragment were co-transformed into Saccharomyces cerevisiae CEN.PK2-1C competent cells.

[0041] Control group 1: Only pCAS9-3g plasmid was transformed.

[0042] Control group 2: Only the donor DNA fragment at the GAL80 site was transformed.

[0043] Transformation buffer was plated on SC-His+hygromycin (HIS3 marker targeting the GAL80 site integration fragment and hygromycin resistance marker targeting the pCAS plasmid) plates and incubated at 30°C for 2-3 days. Twenty single clones were randomly selected from the experimental group plates for colony PCR verification (using verification primers located outside the genomic integration site and inside the donor fragment).

[0044] The results showed that all 20 randomly selected clones displayed correct PCR bands, with a unit-point editing recombination efficiency of 100% (20 / 20). In contrast, control group 1 showed no colony growth on the corresponding selection plates, and control group 2 showed a colony PCR recombination efficiency of 75% (15 / 20) on the corresponding selection plates.

[0045] like Figure 4 The gel electrophoresis results show the 1222bp result obtained by PCR verification at the integration site 500bp upstream of GAL80 in the experimental group of cloned bacteria, and the 1235bp result obtained by PCR verification at the integration site 500bp downstream of GAL80. These results demonstrate that the CRISPR cleavage targeting a single site, combined with the donor DNA-mediated homologous recombination repair system, is highly efficient.

[0046] Example 3: Validation of recombination efficiency at three points in the yeast genome Conduct core three-dimensional synchronous editing experiments Transformation: The complete pCAS9-3g plasmid (expressing three sgRNAs) constructed in Example 1 was mixed with linearized donor DNA fragments at the HO, GAL80, and ARO10 sites in an equimolar ratio and co-transformed into the CEN.PK2-1C Saccharomyces cerevisiae strain.

[0047] Specifically, a specially optimized yeast protoplast transformation method is used to adapt to the efficient transformation of multiple large linear DNA fragments.

[0048] The optimized yeast protoplast transformation method is as follows: Fresh yeast clones were picked and cultured overnight in YAPD liquid medium; the next day, they were transferred to 50 mL of YPAD medium with an initial OD600 of 0.2 and cultured at 30°C for 5-6 hours until the OD600 reached approximately 1.5-2 (approximately 2 × 10⁻⁶). 7 Cells / mL); centrifuge at 1600g for 3 min at 4℃, remove supernatant; resuspend in 50 mL sterile water, centrifuge at 1600g for 3 min at 4℃, remove supernatant; then resuspend cells in 20 mL 1M sorbitol solution, place on ice or at 4℃ for 4 to 20 h; centrifuge at 1600g for 3 min at 4℃, remove supernatant; add 20 mL L SPE solution, 30 μL Zymolyase-20T, and 40 μL mercaptoethanol sequentially, and place in a shaker at 30℃ for 35 min; take 200 μL of the mixed solution and add it to 1800 μL 1M sorbitol (containing 2% SDS), calculate the OD600 ratio; when the OD600 ratio is between 3 and 4, collect protoplasts by centrifugation at 570g for 10 min at 5℃, and gently pour off the supernatant; add 50 mL of 1M sorbitol solution again. Resuspend protoplasts in 1M sorbitol solution, centrifuge at 300-600g for 10 min at 5℃, wash protoplasts twice; add 2 mL L STC solution, mix thoroughly and resuspend, and dispense 200 μL of protoplasts into EP tubes. Add three linearized donor DNA fragments and the complete pCAS9-3g plasmid to 200 μL of protoplasts, mix gently, with a final concentration of 2 mg / L for each of the three linearized donor DNA fragments and 1 mg / L for the complete pCAS9-3g plasmid, and incubate at room temperature for 10 min; then add 800 μL of [the remaining protoplast]. Mix 20% PEG8000 thoroughly and incubate at room temperature for 10 min. Centrifuge at 300-500g for 5 min at 5℃ and remove the supernatant. Add 800 μL LOS solution and resuspend the protoplasts using a pipette tip. Incubate at 30℃ for 40 min. Finally, transfer the protoplast transformation system to 7 mL of SORB-TOP selection medium that has been melted and cooled to 50-60℃. Mix gently and spread evenly on a 50℃ preheated SORB-DOWN-Leu-His-Ura (triple-site missing) selection medium plate for selection. Apply selection pressure (LEU, HIS, URA) carried by the integration fragments of the three sites simultaneously. Incubate at 30℃ for 4-7 days.

[0049] Screening and Validation: After the yeast transformation plate has grown colonies, 40 single clones that grew on the three-deficiency plate are randomly selected.

[0050] PCR verification: For each clone, three rounds of colony PCR were performed using specific validation primer pairs targeting the integration events at the HO, GAL80, and ARO10 sites. Electrophoresis results showed that 33 out of 40 clones exhibited the correct integration bands at all three sites.

[0051] Efficiency calculation: The efficiency of simultaneous and correct integration at three sites was 82.5% (33 / 40). Of the remaining 7 clones, 4 had correct integration at two sites, 3 had correct integration at only one site, and no clones were found that failed to integrate at all three sites (e.g., Figure 5 (As shown). This result conclusively proves that the method of the present invention can achieve efficient synchronous editing and integration of three points.

[0052] Example 4: Fermentation performance verification of vitamin E synthesizing strains The positive clone (strain number VT01) that was verified by PCR to be correctly integrated at three sites in Example 3 was inoculated for fermenter-level verification.

[0053] Fermentation Process: A 5L fermenter was used with a fed-batch fermentation process. The initial culture medium consisted of 40g / L peptone, 20g / L yeast extract, and 40g / L glucose. Additional media included 60mM 2-HP-β-CD (2-hydroxypropyl-β-cyclodextrin), 2% olive oil, and 0.5% butylated hydroxytoluene (BHT), an antioxidant. The constitutive promoter pathway operated. After approximately 24 hours, glucose was depleted, and 10g / L galactose was added to induce the Gal pathway. 100% ethanol was continuously fed to maintain a concentration below 5g / L. Ammonia was used to maintain the pH above 5. Tyrosine was continuously fed (2.5g / total volume every 24 hours, totaling 15g) and isopentenol (5g / total volume every 24 hours, totaling 30g) until fermentation was complete. A turbine speed of 300rpm or higher, or 1vvm aeration, was used to maintain dissolved oxygen above 30%.

[0054] Product testing: Samples were taken at different fermentation times, and the content of vitamin E (tocotrienols) in the fermentation broth was determined by high performance liquid chromatography.

[0055] Result: As Figure 6 As shown, the engineered strain VT01 achieved a vitamin E yield of 5.9 g / L. This result fully demonstrates that the engineered strain with a complete vitamin E long synthetic pathway constructed by this invention possesses the ability to efficiently synthesize the target product.

[0056] in conclusion: This invention develops a highly efficient three-site simultaneous gene editing and large-scale pathway integration technology for Saccharomyces cerevisiae, and has been successfully applied to the rapid construction of vitamin E-synthetic strains. This method is highly efficient and has a short cycle time, providing a powerful and universal tool for constructing other complex metabolic pathways in yeast.

[0057] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for constructing a vitamin E-producing strain through simultaneous three-site editing and recombination of the yeast genome, characterized in that, Includes the following steps: Helper plasmids expressing CRISPR-Cas9 protein and three sgRNAs, along with three independent donor DNA fragments, were co-transformed into Saccharomyces cerevisiae cells; The three sgRNAs target the HO site, GAL80 site, and ARO10 site on the Saccharomyces cerevisiae genome, respectively. The sgRNA sequence targeting the HO site is: CATATACAGTACTCTCACCC, as shown in SEQ ID NO: 1; The sgRNA sequence targeting the GAL80 site is: ACGATAGTTGCAGTATGGCG, as shown in SEQ ID NO: 2; The sgRNA sequence targeting the ARO10 site is: AGAGTAACGGGAATATCCGT, as shown in SEQ ID NO: 3; The three independent donor DNA fragments each contain gene sequences of the vitamin E synthesis pathway for integration into the HO site, GAL80 site, and ARO10 site; Each of the donor DNA fragments contains homologous arms at both ends that are homologous to the target genomic site.

2. The method according to claim 1, characterized in that, The three independent donor DNA fragments consist of the following sequences, and all were pre-assembled in E. coli and cloned into a vector: (1) The fragment targeting the HO site has the sequence shown in SEQ ID NO: 4; Its sequence structure is as follows: HO upstream homologous arm: LEU screening marker - Ppgk1 - HPPD - Tpgk1 - Ptef1 - syHPT - Ttef1 - Ptpi1 - tTC - Ttpi1 - Ptdh1 - tHMG1 - Ttdh2 - Ppef2 - CRTE - Tpdx1: HO downstream homologous arm; (2) The fragment targeting the GAL80 site has the sequence shown in SEQ ID NO: 5; Its sequence structure is as follows: upstream homologous arm of GAL80: HIS screening marker - Tgpm1 - SAGGPP - Pgal10 - Pgal1 - YHPDR1 - Tfba1: downstream homologous arm of GAL80; (3) The fragment targeting the ARO10 site, the sequence of which is shown in SEQ ID NO: 6; Its sequence structure is as follows: upstream homologous arm of ARO10: URA screening marker - Tadh1 - AtIPK - Pgap - Pfba1 - SmDAGK - Tcyc1 - Pgpm1 - tHMG1 - Teno2 - Ppcd1 - IDI1 - Thxt7 - Peno2 - ERG20 - Tgpd: downstream homologous arm of ARO10.

3. The method according to any one of claims 1-2, characterized in that, The auxiliary plasmid It includes the following components: a Cas9 protein expression cassette, a multi-sgRNA array driven by the PolIII promoter, and a selection marker gene; The multiple sgRNA array consists of three tandem sgRNAs, each sgRNA being a specific target sequence targeting the HO, GAL80, and ARO10 sites sequentially. The sgRNA array is separated by tRNA spacer sequences.

4. The method according to any one of claims 1-3, characterized in that, The method of co-transforming CRISPR-Cas9 protein and three sgRNA helper plasmids, along with three independent donor DNA fragments, into Saccharomyces cerevisiae cells is a specially optimized yeast protoplast transformation method, which includes the following steps: Fresh yeast single clones were picked and cultured overnight in YAPD liquid medium; the next day, they were transferred to 50 mL of YPAD medium with an initial OD600 of 0.2 and cultured at 30 °C for 5-6 h until the OD600 reached 1.5-2, thus obtaining yeast cell culture medium. Centrifuge the yeast cell culture medium at 1600g for 3 min at 4℃ and remove the supernatant; add 50mL of sterile water to resuspend the cells, centrifuge at 1600g for 3 min at 4℃ and remove the supernatant; then add 20mL of 1M sorbitol solution to resuspend the cells, place on ice or at 4℃ for 4 to 20 h to obtain yeast cell resuspension. Centrifuge the yeast cell resuspension at 1600g for 3 min at 4℃ and remove the supernatant; add 20 mL of L PE solution, 30 μL of Zymolyase-20T and 40 μL of mercaptoethanol in sequence, and place in a shaker at 30℃ and shake slowly for 35 min to obtain a mixed solution. Take 200 μL of the mixed solution and add it to 1800 μL of 1M sorbitol solution (containing 2% SDS), and calculate the OD600 ratio. When the OD600 ratio is between 3 and 4, collect the protoplasts by centrifuging at 570g for 10 min at 5℃, and gently discard the supernatant. Resuspend the protoplasts by adding 50 mL of 1M sorbitol solution again, centrifuge at 300-600g for 10 min at 5℃, and wash the protoplasts twice. Add 2 mL of LSC solution, mix thoroughly, and resuspend. Aliquot 200 μL of the protoplast resuspension into EP tubes. Add three linearized donor DNA fragments and the intact pCAS9-3g plasmid to 200 μL of protoplasts, mix gently, with the final concentration of each linearized donor DNA fragment being 2 mg / L and the final concentration of the intact pCAS9-3g plasmid being 1 mg / L. Incubate at room temperature for 10 min. Add 800 μL of 20% PEG8000, mix well, and incubate at room temperature for 10 min. Centrifuge at 300-500g for 5 min at 5°C and discard the supernatant. Add 800 μL of LOS solution. Resuspend the protoplasts using a pipette tip; incubate at 30°C for 40 min; finally, transfer the protoplast transformation system to 7 mL of SORB-TOP selection medium that has been melted and cooled to 50-60°C, mix gently, and spread evenly onto a 50°C preheated SORB-DOWN-Leu-His-Ura (triple-deficient) selection medium plate for selection, so as to simultaneously apply the selection pressure of LEU, HIS, and URA carried by the three site integration fragments, and incubate at 30°C for 4-7 days.

5. The method according to any one of claims 1-4, characterized in that, The donor DNA fragment was amplified by PCR and used as a linearized fragment for transformation.

6. An engineered strain of *Saccharomyces cerevisiae* constructed by the method according to any one of claims 2-5, characterized in that, The strain integrates the vitamin E synthesis pathway gene fragment as described in claim 2 at the HO, GAL80, and ARO10 sites of its genome.

7. The application of the engineered strain of Saccharomyces cerevisiae according to claim 6 in the fermentation production of vitamin E.

Images