Engineered varicella zoster virus herpes zoster mRNA vaccine

Abstract

Provided herein is a herpes zoster vaccine composition comprising a messenger ribonucleic acid (mRNA) comprising an open reading frame (ORF) encoding a varicella zoster virus (VZV) glycoprotein E (gE), which is soluble VZV gE or full-length VZV gE, and a composition for inducing an immune response against herpes zoster comprising the herpes zoster vaccine composition.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 423,759, filed on November 8, 2022, the entire disclosure of which is incorporated herein by reference.

[0003] Incorporation of Sequence Listing by Reference

[0004] The content of the Sequence Listing submitted electronically together with this application is incorporated herein by reference in its entirety, the file name of the Sequence Listing: F292635_sequence listing as filed; size: 25,789 bytes; and creation date: November 6, 2023. Technical Field

[0005] Provided herein is a herpes zoster vaccine composition comprising messenger ribonucleic acid (mRNA) that contains an open reading frame (ORF) encoding varicella zoster virus (VZV) glycoprotein E (gE), which is either soluble VZV gE or full-length VZV gE, and a method of inducing an immune response against herpes zoster by administering an effective amount of the herpes zoster vaccine composition to a subject in need thereof. Background Art

[0006] Herpes zoster, also known as zona or herpes zoster, is a viral disease caused by varicella zoster virus (VZV). There is currently no approved mRNA vaccine for herpes zoster, and there has been a continuing need for an mRNA vaccine for herpes zoster. Summary of the Invention

[0007] The present disclosure provides a herpes zoster vaccine composition comprising messenger ribonucleic acid (mRNA), the mRNA comprising an open reading frame (ORF) encoding varicella-zoster virus (VZV) glycoprotein E (gE). In one embodiment, VZV gE has the amino acid sequence of SEQ ID NO:1 (soluble VZV gE). In another embodiment, VZV gE has the amino acid sequence of SEQ ID NO:2 (full-length VZV gE). In one embodiment, the ORF encoding VZV gE has the nucleotide sequence of SEQ ID NO:3 (ORF encoding soluble VZV gE). In another embodiment, the ORF encoding VZV gE has the nucleotide sequence of SEQ ID NO:4 (ORF encoding full-length VZV gE). In some embodiments, the mRNA comprising the ORF encoding VZV gE further comprises a 5' untranslated region (UTR), a 3' UTR, and a poly(A) tail, thereby having a structure of 5' UTR - ORF encoding VZV gE - 3' UTR - poly(A) tail, wherein the ORF encoding VZV gE has the nucleotide sequence of SEQ ID NO:3 (ORF encoding soluble VZV gE). In another embodiment, the mRNA comprising the ORF encoding VZV gE further comprises a 5' untranslated region (UTR), a 3' UTR, and a poly(A) tail, thereby having a structure of 5' UTR - ORF encoding VZV gE - 3' UTR - poly(A) tail, wherein the ORF encoding VZV gE has the nucleotide sequence of SEQ ID NO:4 (ORF encoding full-length VZV gE). In one embodiment, the poly(A) tail has a length of 50 - 250 nucleotides. In some embodiments, the mRNA having a structure of 5' UTR - ORF encoding VZV gE - 3' UTR - poly(A) tail has the nucleotide sequence of SEQ ID NO:5 (5' UTR - ORF encoding soluble VZV gE - 3' UTR - poly(A) tail). In another embodiment, the mRNA having a structure of 5' UTR - ORF encoding VZV gE - 3' UTR - poly(A) tail has the nucleotide sequence of SEQ ID NO:6 (5' UTR - ORF encoding full-length VZV gE - 3' UTR - poly(A) tail). In some embodiments, the mRNA having a structure of 5' UTR - ORF encoding VZV gE - 3' UTR - poly(A) tail has a nucleotide sequence having at least 80% identity with SEQ ID NO:5 (5' UTR - ORF encoding soluble VZV gE - 3' UTR - poly(A) tail).In another embodiment, the mRNA having a structure of 5’UTR-ORF encoding VZV gE-3’UTR-poly(A) tail has a nucleotide sequence having at least 80% identity with SEQ ID NO:6 (5’UTR-ORF encoding full-length VZV gE-3’UTR-poly(A) tail). In one embodiment, the varicella zoster vaccine composition of the present disclosure further comprises a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutically acceptable carrier is a lipid nanoparticle encapsulating the mRNA.

[0008] The present disclosure also provides a composition for inducing an immune response against varicella zoster, which comprises the varicella zoster vaccine composition of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 In vitro transcription of two VZV gE mRNAs is shown.

[0010] Figure 2 VZV gE protein levels in gE mRNA-transfected 293FT cells and the culture medium are shown.

[0011] Figure 3 The schedule of immunization and serum collection is described.

[0012] Figure 4 Mouse anti-VZV-gE titer results are shown.

[0013] Figure 5 VZV neutralization results are shown.

[0014] TERM DEFINITIONS

[0015] Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the embodiments described herein, some preferred methods, compositions, devices, and materials are described herein. However, before describing the materials and methods of the present invention, it should be understood that the present disclosure is not limited to the specific molecules, compositions, methods, or protocols described herein, as these can vary according to routine experiments and optimizations. It should also be understood that the terms used in the specification are for the purpose of describing specific versions or embodiments only and are not intended to limit the scope of the embodiments described herein.

[0016] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this disclosure pertains. However, in case of conflict, the present specification (including definitions) shall prevail. Thus, in the context of the embodiments described herein, the following definitions apply.

[0017] Unless the context clearly indicates otherwise, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents.

[0018] As used herein, the term "comprising" and its linguistic variants denote the presence of the recited features, elements, method steps, etc., without excluding the presence of additional features, elements, method steps, etc. In contrast, the term "consisting of" and its linguistic variants denote the presence of the recited features, elements, method steps, etc., and exclude any unrecited features, elements, method steps, etc., except for ordinarily associated impurities. The phrase "consisting essentially of" denotes the presence of the recited features, elements, method steps, etc., and any additional features, elements, method steps, etc. that do not materially affect the basic properties of the composition, system, or method. Many embodiments herein are described using the open "comprising" language. Such embodiments encompass multiple closed "consisting of" and / or "consisting essentially of" embodiments, which may alternatively be claimed or described using such language.

[0019] As used herein, the term "varicella zoster vaccine composition" refers to a substance for stimulating the production of antibodies and providing immunity against varicella zoster.

[0020] As used herein, the term "messenger ribonucleic acid (mRNA)" refers to a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene and is read by ribosomes during the process of synthesizing proteins.

[0021] Natural amino acids include alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).

[0022] Non-natural amino acids include, but are not limited to, azetidinecarboxylic acid, 2-aminoadipic acid, 3-aminoadipic acid, β-alanine, naphthylalanine ("naph"), aminopropionic acid, 2-aminobutyric acid, 4-aminobutyric acid, 6-aminohexanoic acid, 2-aminoheptanoic acid, 2-aminoisobutyric acid, 3-aminoisobutyric acid, 2-aminoheptanedioic acid, tert-butylglycine ("tBuG"), 2,4-diaminoisobutyric acid, desmosine, 2,2'-diaminopimelic acid, 2,3-diaminopropionic acid, N-ethylglycine, N-ethylasparagine, homoproline ("hPro" or "homoP"), hydroxylysine, allo-hydroxylysine, 3-hydroxyproline ("3Hyp"), 4-hydroxyproline ("4Hyp"), isodesmosine, alloisoleucine, N-methylalanine ("MeAla" or "Nime"), N-alkylglycine ("NAG") (including N-methylglycine), N-methylisoleucine, N-alkylpentylglycine ("NAPG") (including N-methylpentylglycine). N-methylvaline, naphthylalanine, norvaline ("Norval"), norleucine ("Norleu"), octylglycine ("OctG"), ornithine ("Orn"), pentylglycine ("pG" or "PGly"), pipecolic acid, thioproline ("ThioP" or "tPro"), homolysine ("hLys") and homoarginine ("hArg").

[0023] As used herein, the term "open reading frame (ORF)" refers to the nucleotide sequence between a start codon and a stop codon.

[0024] As used herein, the term "open reading frame (ORF) encoding" refers to a nucleotide coding sequence that encodes a polypeptide. The coding sequence may further include start and stop signals operably linked to regulatory elements, including a promoter and a polyadenylation signal, capable of directing expression in cells of an individual or mammal to which the nucleic acid is administered. The coding sequence may further include a sequence encoding a signal peptide.

[0025] As used herein, the term "T7 promoter" refers to a promoter derived from bacteriophage T7.

[0026] As used herein, the term "5' untranslated region (UTR)" refers to the region of an mRNA that is located immediately upstream (i.e., 5') of the start codon (the first codon of the mRNA transcript that is translated by a ribosome) and does not encode a polypeptide.

[0027] As used herein, the term "3' untranslated region (UTR)" refers to the region of an mRNA that is located immediately downstream (i.e., 3') of the stop codon (the codon of the mRNA transcript that signals the termination of translation) and does not encode a polypeptide.

[0028] As used herein, the term "poly(A) tail" refers to a long stretch of adenine nucleotides added to the "tail" or 3' end of an mRNA.

[0029] As used herein, the term "pharmaceutically acceptable carrier" refers to any substance or vehicle suitable for delivering an mRNA vaccine to a suitable in vivo or ex vivo site. Such carriers may include, but are not limited to, adjuvants, excipients, lipid particles, and the like.

[0030] As used herein, the term "lipid nanoparticle" refers to a particle having at least one dimension in the nanometer scale (e.g., 1 - 1,000 nm). In some embodiments, lipid nanoparticles are included in formulations that can be used to deliver an mRNA vaccine to a target site (e.g., a cell, tissue, organ, tumor, etc.). In some embodiments, the mRNA vaccine can be encapsulated in the lipid portion of the lipid nanoparticle, or in an aqueous space surrounded by some or all of the lipid portions of the lipid nanoparticle, thereby protecting it from enzymatic degradation or other undesirable effects induced by the mechanisms of the host organism or cell, such as an adverse immune response. In some embodiments, the lipid nanoparticles have an average diameter of 50 - 200 nm. In some embodiments, the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. In some embodiments, the lipid nanoparticles comprise a molar ratio of about 20 - 60% cationic lipid, 0.5 - 15% PEG-modified lipid, 25 - 55% sterol, and 25% non-cationic lipid. In some embodiments, the cationic lipid is an ionizable cationic lipid and the non-cationic lipid is a neutral lipid, and the sterol is cholesterol. In some embodiments, the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0031] As used herein, the term "inducing an immune response against herpes zoster" refers to providing protective immunity for prophylactic purposes and / or vaccinating a subject against herpes zoster, and to eliciting a desired immune response or effect against herpes zoster in a subject in need thereof for therapeutic purposes. As used herein, the term "protective immunity" or "protective immune response" refers to a vaccinated subject being able to control an infection by the pathogen against which the vaccine is directed. Generally, a subject that has generated a "protective immune response" only develops mild to moderate clinical symptoms or no symptoms at all.

[0032] Providing an "effective amount" of a herpes zoster vaccine composition (e.g., mRNA) is at least partially based on target tissue, target cell type, mode of administration, physical properties of the polynucleotide (e.g., size and degree of modified nucleosides), and other components of the vaccine, as well as other determinants. Generally, an effective amount of a herpes zoster vaccine (e.g., mRNA) provides an induced or enhanced immune response as a result of antigen production in cells, preferably more effectively than a composition comprising an unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production can be demonstrated by increased cell transfection (percentage of cells transfected with an RNA (e.g., mRNA) vaccine), increased protein translation from the polynucleotide, decreased nucleic acid degradation (e.g., demonstrated by increased protein translation duration from a modified polynucleotide), or an altered antigen-specific immune response of the host cell.

[0033] As used herein, the term "X% identity to SEQ ID NO:Y" or "sequence identity" refers to the degree to which two polymer sequences (e.g., peptides, polypeptides, nucleic acids, etc.) have the same order of monomeric subunit composition. The term "sequence similarity" refers to the degree to which two polymer sequences (e.g., peptides, polypeptides, nucleic acids, etc.) differ only by conservative and / or semi-conservative amino acid substitutions. The "percent sequence identity" (or "percent sequence similarity") is calculated by: (1) comparing two optimally aligned sequences over a comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window, etc.), (2) determining the number of positions containing the same (or similar) monomers (e.g., the same amino acid appears in both sequences, a similar amino acid appears in both sequences) to yield the number of matching positions, (3) dividing the number of matching positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window), and (4) multiplying the result by 100 to yield the percent sequence identity or percent sequence similarity. For example, if peptides A and B are both 20 amino acids in length and have the same amino acids at all positions except 1 position, then peptides A and B have 95% sequence identity. If the amino acids at the non-identical positions share the same biophysical characteristics (e.g., both are acidic), then peptides A and B will have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length, peptide D is 15 amino acids in length, and 14 of the 15 amino acids in peptide D are the same as the amino acids of a portion of peptide C, then peptides C and D have 70% sequence identity, but peptide D has 93.3% sequence identity with the optimal comparison window of peptide C. To calculate the "percent sequence identity" (or "percent sequence similarity") herein, any gaps in the aligned sequences are considered mismatches at that position.

[0034] As used herein, the term "nucleotide sequence having at least X% identity to SEQ ID NO:Y and encoding a Z protein" means that the nucleotide sequence meets two different requirements of having at least X% identity to SEQ ID NO:Y and encoding a Z protein.

[0035] As used herein, the terms "about", "approximately", "equal to or about", and "substantially" mean that the quantity or value being discussed can be an exact value or a value that provides an equivalent result or effect as described in the claims or taught herein. That is, it should be understood that quantities, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but can be approximate and / or larger or smaller as needed, reflecting tolerances, conversion factors, rounding, measurement errors, etc., and other factors known to those of skill in the art, so as to obtain equivalent results or effects. In some cases, it is not possible to reasonably determine a value that provides an equivalent result or effect. In such cases, unless otherwise stated or inferred, it should generally be understood that, as used herein, "about" and "equal to or about" mean a ±10% variation from the indicated nominal value. Generally, a quantity, size, formulation, parameter, or other quantity or characteristic is "about", "approximately", or "equal to or about", whether or not explicitly stated as such. It should be understood that when "about", "approximately", or "equal to or about" is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless otherwise specifically stated.

[0036] The terms "subject", "patient", "individual", etc. are used interchangeably herein and refer to any animal, any mammalian subject, or its cells suitable for the methods described herein, whether in vitro or in situ. In certain non-limiting embodiments, the patient, subject, or individual is a human. Detailed Description

[0037] 1. Herpes zoster vaccine composition

[0038] The present disclosure provides a varicella zoster vaccine composition comprising an open reading frame (ORF) encoding varicella zoster virus (VZV) glycoprotein E (gE).

[0039] In one embodiment, VZV gE has the amino acid sequence of SEQ ID NO:1 (soluble VZV gE). In another embodiment, VZV gE has the amino acid sequence of SEQ ID NO:2 (full-length VZV gE).

[0040] In one embodiment, VZV gE has an amino acid sequence that is at least 80% identical to SEQ ID NO:1 (soluble VZV gE). In another embodiment, VZV gE has an amino acid sequence that is at least 85% identical to SEQ ID NO:1 (soluble VZV gE). In some embodiments, VZV gE has an amino acid sequence that is at least 90% identical to SEQ ID NO:1 (soluble VZV gE). In another embodiment, VZV gE has an amino acid sequence that is at least 95% identical to SEQ ID NO:1 (soluble VZV gE). In one embodiment, VZV gE has an amino acid sequence that is at least 96% identical to SEQ ID NO:1 (soluble VZV gE). In some embodiments, VZV gE has an amino acid sequence that is at least 97% identical to SEQ ID NO:1 (soluble VZV gE). In another embodiment, VZV gE has an amino acid sequence that is at least 98% identical to SEQ ID NO:1 (soluble VZV gE). In some embodiments, VZV gE has an amino acid sequence that is at least 99% identical to SEQ ID NO:1 (soluble VZV gE).

[0041] In another embodiment, VZV gE has an amino acid sequence that is at least 80% identical to SEQ ID NO:2 (full-length VZV gE). In some embodiments, VZV gE has an amino acid sequence that is at least 85% identical to SEQ ID NO:2 (full-length VZV gE). In one embodiment, VZV gE has an amino acid sequence that is at least 90% identical to SEQ ID NO:2 (full-length VZV gE). In some embodiments, VZV gE has an amino acid sequence that is at least 95% identical to SEQ ID NO:2 (full-length VZV gE). In another embodiment, VZV gE has an amino acid sequence that is at least 96% identical to SEQ ID NO:2 (full-length VZV gE). In some embodiments, VZV gE has an amino acid sequence that is at least 97% identical to SEQ ID NO:2 (full-length VZV gE). In another embodiment, VZV gE has an amino acid sequence that is at least 98% identical to SEQ ID NO:2 (full-length VZV gE). In some embodiments, VZV gE has an amino acid sequence that is at least 99% identical to SEQ ID NO:2 (full-length VZV gE).

[0042] The present disclosure provides the following two different types of herpes zoster vaccine compositions.

[0043] · Herpes zoster vaccine composition (1): A herpes zoster vaccine composition comprising mRNA containing an open reading frame (ORF) encoding VZV gE (soluble).

[0044] · Herpes zoster vaccine composition (2): A herpes zoster vaccine composition comprising mRNA containing an open reading frame (ORF) encoding VZV gE (full-length).

[0045] In the above two types of herpes zoster vaccine compositions, VZV gE (soluble) may have the amino acid sequence of SEQ ID NO: 1 (or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 1). In another embodiment, VZV gE (full-length) may have the amino acid sequence of SEQ ID NO: 2 (or an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 2).

[0046] In the above two types of herpes zoster vaccine compositions, the ORF encoding VZV gE (soluble) may have the nucleotide sequence of SEQ ID NO: 3 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 3). In another embodiment, the ORF encoding VZV gE (full-length) may have the nucleotide sequence of SEQ ID NO: 4 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 4).

[0047] In the herpes zoster vaccine composition (1), the mRNA containing the ORF encoding VZV gE (soluble) may further comprise a 5' untranslated region (UTR), a 3' UTR and a poly(A) tail, thereby having a structure of 5' UTR - ORF encoding VZV gE (soluble) - 3' UTR - poly(A) tail, and the ORF encoding VZV gE (soluble) may have the nucleotide sequence of SEQ ID NO: 3 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 3).

[0048] In the varicella zoster vaccine composition (2), the mRNA containing the ORF encoding VZV gE (full-length) may further contain a 5' untranslated region (UTR), a 3' UTR, and a poly(A) tail, thus having a structure of 5'UTR - ORF encoding VZV gE (full-length) - 3'UTR - poly(A) tail, and the ORF encoding VZV gE (full-length) may have the nucleotide sequence of SEQ ID NO:4 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99% identity with SEQ ID NO:4).

[0049] In the varicella zoster vaccine composition (1), the mRNA having a structure of 5'UTR - ORF encoding VZV gE (soluble) - 3'UTR - poly(A) tail may have the nucleotide sequence of SEQ ID NO:5 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99% identity with SEQ ID NO:5).

[0050] In the varicella zoster vaccine composition (2), the mRNA having a structure of 5'UTR - ORF encoding VZV gE (full-length) - 3'UTR - poly(A) tail may have the nucleotide sequence of SEQ ID NO:6 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99% identity with SEQ ID NO:6).

[0051] In one embodiment, the poly(A) tail has a length of 50 - 250 nucleotides. In another embodiment, the poly(A) tail has a length of 100 - 200 nucleotides. In another embodiment, the poly(A) tail has a length of 110 - 150 nucleotides. In another embodiment, the poly(A) tail has a length of 115 - 125 nucleotides. In another embodiment, the poly(A) tail has a length of 116 - 124 nucleotides. In another embodiment, the poly(A) tail has a length of 117 - 123 nucleotides. In another embodiment, the poly(A) tail has a length of 118 - 122 nucleotides. In another embodiment, the poly(A) tail has a length of 119 - 122 nucleotides. In another embodiment, the poly(A) tail has a length of 115 nucleotides. In another embodiment, the poly(A) tail has a length of 116 nucleotides. In another embodiment, the poly(A) tail has a length of 117 nucleotides. In another embodiment, the poly(A) tail has a length of 118 nucleotides. In another embodiment, the poly(A) tail has a length of 119 nucleotides. In another embodiment, the poly(A) tail has a length of 120 nucleotides. In another embodiment, the poly(A) tail has a length of 121 nucleotides. In another embodiment, the poly(A) tail has a length of 122 nucleotides. In another embodiment, the poly(A) tail has a length of 123 nucleotides. In another embodiment, the poly(A) tail has a length of 124 nucleotides. In another embodiment, the poly(A) tail has a length of 125 nucleotides.

[0052] In one embodiment, the mRNA of the present disclosure may comprise at least one chemical modification selected from the following: pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxypseudouridine, 4-thio-1-methyl-pseudouridine, 4-thiopseudouridine, 5-azauridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine. In another embodiment, the chemical modification is at the 5-position of uracil. In another embodiment, the chemical modification is N1-methylpseudouridine. In another embodiment, the chemical modification is N1-ethylpseudouridine.

[0053] In one embodiment, the herpes zoster vaccine composition further comprises a pharmaceutically acceptable carrier. In another embodiment, the pharmaceutically acceptable carrier may include any substance or vehicle suitable for delivering the mRNA vaccine to a suitable in vivo or ex vivo site. Such carriers may include, but are not limited to, adjuvants, excipients, lipid particles, etc. Lipid nanoparticles may be particles having at least one dimension in the nanometer scale (e.g., 1 - 1,000 nm). In some embodiments, the lipid nanoparticles are included in a formulation that can be used to deliver the mRNA vaccine to a target site (e.g., cells, tissues, organs, tumors, etc.). In some embodiments, the mRNA vaccine may be encapsulated in the lipid portion of the lipid nanoparticles or in an aqueous space surrounded by some or all of the lipid portions of the lipid nanoparticles, thereby protecting it from enzymatic degradation or other undesirable effects induced by the mechanisms of the host organism or cells, such as an adverse immune response. In some embodiments, the lipid nanoparticles have an average diameter of 50 - 200 nm. In some embodiments, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols, and non-cationic lipids. In some embodiments, the lipid nanoparticles comprise a molar ratio of approximately 20 - 60% cationic lipids, 0.5 - 15% PEG-modified lipids, 25 - 55% sterols, and 25% non-cationic lipids. In some embodiments, the cationic lipid is an ionizable cationic lipid and the non-cationic lipid is a neutral lipid, and the sterol is cholesterol. In some embodiments, the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0054] In one embodiment, the lipid nanoparticles comprise (i) at least one lipid selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE, and SM; (iii) a sterol, such as cholesterol; and (iv) a PEG-lipid, such as PEG-DMG or PEG-cDMA, in a molar ratio of approximately 20 - 60% cationic lipid: 5 - 25% neutral lipid: 25 - 55% sterol: 0.5 - 15% PEG-lipid.

[0055] In one embodiment, the lipid nanoparticle comprises from about 25% to about 75% by mole of a cationic lipid, such as from about 35 to about 65%, about 45 to about 65%, about 60%, about 57.5%, about 50% or about 40% by mole, and the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0056] In one embodiment, the lipid nanoparticle comprises from about 0.5% to about 15% by mole of a neutral lipid, such as from about 3 to about 12%, about 5 to about 10%, or about 15%, about 10%, or about 7.5% by mole. Examples of neutral lipids include, but are not limited to, DSPC, POPC, DPPC, DOPE, and SM. In some embodiments, the formulation comprises from about 5% to about 50% by mole of a sterol (e.g., from about 15 to about 45%, about 20 to about 40%, about 40%, about 38.5%, about 35% or about 31% by mole). An exemplary sterol is cholesterol. In some embodiments, the formulation comprises from about 0.5% to about 20% by mole of PEG or a PEGylated lipid (e.g., from about 0.5 to about 10%, about 0.5 to about 5%, about 1.5%, about 0.5%, about 1.5%, about 3.5% or about 5% by mole). In some embodiments, the PEG or PEGylated lipid comprises a PEG molecule having an average molecular weight of 2,000 Da. In other embodiments, the PEG or PEGylated lipid comprises a PEG molecule having an average molecular weight less than 2,000, such as about 1,500 Da, about 1,000 Da or about 500 Da. Examples of PEGylated lipids include, but are not limited to, PEG-distearylglycerol (PEG-DMG) (also referred to herein as PEG-C14 or C14-PEG) and PEG-cDMA.

[0057] In one embodiment, the lipid nanoparticle comprises 25 - 75% by mole of a cationic lipid, 0.5 - 15% by mole of a neutral lipid, 5 - 50% by mole of a sterol, and 0.5 - 20% by mole of PEG or a PEGylated lipid, and the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0058] In one embodiment, the lipid nanoparticle comprises 35 - 65% by mole of a cationic lipid, 3 - 12% by mole of a neutral lipid, 15 - 45% by mole of a sterol, and 0.5 - 10% by mole of a PEG or PEG-modified lipid, wherein the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0059] In one embodiment, the lipid nanoparticle comprises 45 - 65% by mole of a cationic lipid, 5 - 10% by mole of a neutral lipid, 25 - 40% by mole of a sterol, and 0.5 - 10% by mole of a PEG or PEG-modified lipid, wherein the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0060] In one embodiment, the lipid nanoparticle comprises approximately 60% by mole of a cationic lipid, approximately 7.5% by mole of a neutral lipid, approximately 31% by mole of a sterol, and approximately 1.5% by mole of a PEG or PEG-modified lipid, wherein the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0061] In one embodiment, the lipid nanoparticle comprises approximately 50% by mole of a cationic lipid, approximately 10% by mole of a neutral lipid, approximately 38.5% by mole of a sterol, and approximately 1.5% by mole of a PEG or PEG-modified lipid, wherein the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0062] In one embodiment, the lipid nanoparticle comprises about 50% cationic lipid, about 10% neutral lipid, about 35% sterol, about 4.5% or about 5% PEG or PEG-modified lipid, and about 0.5% targeting lipid, wherein the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0063] In one embodiment, the lipid nanoparticle comprises about 40% cationic lipid, about 15% neutral lipid, about 40% sterol, and about 5% PEG or PEG-modified lipid, wherein the cationic lipid is selected from 2,2-dilinoleoyl-4-dimethylaminoethyl [1,3]-dioxolane (DLin-KC2-DMA), dilinoleoyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and bis((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0064] In one embodiment, the herpes zoster vaccine composition of the present disclosure can be delivered, positioned, and / or concentrated at a specific location using the delivery methods described below. As a non-limiting example, empty polymer particles can be administered to a subject before, simultaneously with, or after administering the herpes zoster vaccine composition of the present disclosure. Once in contact with the subject, the empty polymer particles undergo a volume change and become retained, entrapped, fixed, or intercepted at a specific location in the subject.

[0065] In another embodiment, the herpes zoster vaccine composition of the present disclosure can be formulated in an active substance release system. For example, the active substance release system can comprise at least one nanoparticle bound to an oligonucleotide inhibitory strand that hybridizes to a catalytically active nucleic acid, and a compound bound to at least one substrate molecule that binds to a therapeutic active substance (e.g., the polynucleotide described herein), wherein the therapeutic active substance is released by cleavage of the substrate molecule by the catalytically active nucleic acid.

[0066] In another embodiment, the herpes zoster vaccine composition of the present disclosure can be formulated in a nanoparticle comprising a core and an outer surface, wherein the core comprises non-cellular material and the outer surface comprises a cell membrane. The cell membrane can be derived from a cell or a membrane obtained from a virus.

[0067] In another embodiment, the herpes zoster vaccine composition of the present disclosure can be formulated in a porous nanoparticle-supported lipid bilayer (protocell).

[0068] In another embodiment, the herpes zoster vaccine composition of the present disclosure can be formulated in polymer nanoparticles having a high glass transition temperature.

[0069] In another embodiment, the herpes zoster vaccine composition of the present disclosure can be formulated in nanoparticles for imaging. As a non-limiting example, the liposome can contain gadolinium(III) 2-{4,7-bis-carboxymethyl-10-[(N,N-distearylamidomethyl-N'-amidomethyl]-1,4,7,10-tetra-azacyclododec-1-yl}-acetate and a neutral, fully saturated phospholipid component.

[0070] The nanoparticles of the present disclosure can also include nutrients, such as but not limited to nutrients whose deficiency can cause health hazards ranging from anemia to neural tube defects. As a non-limiting example, the nutrient can be iron in the form of ferrous, iron salts or elemental iron, iodine, folic acid, vitamins or micronutrients.

[0071] In another embodiment, the herpes zoster vaccine composition of the present disclosure can be formulated in swellable nanoparticles.

[0072] In another embodiment, the herpes zoster vaccine composition of the present disclosure can be formulated in polyanhydride nanoparticles.

[0073] The nanoparticles and microparticles of the present disclosure can be geometrically engineered to modulate macrophages and / or immune responses. In some embodiments, the geometrically engineered particles can have different shapes, sizes, and / or surface charges in order to incorporate the polynucleotides of the present disclosure for targeted delivery, such as but not limited to pulmonary delivery. Other physical characteristics that the geometrically engineered particles can have include but are not limited to pores, angled arms, asymmetry, and surface roughness, charges that can alter interactions with cells and tissues.

[0074] In another embodiment, the nanoparticles of the present disclosure can be water-soluble nanoparticles. The nanoparticles can be inorganic nanoparticles having dense zwitterionic ligands to exhibit good water solubility. The nanoparticles can also have a small hydrodynamic diameter (HD), stability with respect to time, pH, and salinity, and a low level of non-specific protein binding.

[0075] In some embodiments, the nanoparticles of the present disclosure are stealth nanoparticles or target - specific stealth nanoparticles. In some embodiments, the stealth nanoparticles or target - specific stealth nanoparticles may comprise a polymer matrix. The polymer matrix may comprise two or more polymers, such as but not limited to polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumarate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polyester, polyanhydride, polyether, polyurethane, polymethacrylate, polyacrylate, polycyanoacrylate, or combinations thereof.

[0076] In one embodiment, the nanoparticles of the present disclosure may be nanoparticle - nucleic acid hybrid structures having a high - density nucleic acid layer. The nanoparticles of the present disclosure may comprise nucleic acids, such as but not limited to polynucleotides described herein and / or known in the art.

[0077] In one embodiment, at least one of the nanoparticles of the present disclosure may be embedded in the core of a nanostructure or coated with a low - density porous 3 - D structure or coating that is capable of carrying or associating at least one payload on the inside or surface of the nanostructure.

[0078] In one embodiment, the pharmaceutically acceptable carrier is a lipid nanoparticle encapsulating the mRNA of the present disclosure. In another embodiment, the lipid nanoparticle comprises a first lipid nanoparticle encapsulating mRNA encoding VZV gE (soluble) and a second lipid nanoparticle encapsulating mRNA encoding VZV gE (full - length).

[0079] 2. Composition for inducing an immune response against herpes zoster

[0080] The present disclosure also provides a composition for inducing an immune response against herpes zoster, which comprises administering an effective amount of the herpes zoster vaccine composition of the present disclosure. In one embodiment, providing an effective amount of the herpes zoster vaccine composition (e.g., mRNA) is at least partially based on target tissue, target cell type, mode of administration, physical characteristics of the polynucleotide (e.g., size and degree of modified nucleosides), and other components of the vaccine, as well as other determinants. Generally, an effective amount of the herpes zoster vaccine (e.g., mRNA) provides an induced or enhanced immune response as a result of antigen production in cells, preferably more effectively than a composition comprising an unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production can be demonstrated by increased cell transfection (percentage of cells transfected with an RNA (e.g., mRNA) vaccine), increased protein translation from the polynucleotide, decreased nucleic acid degradation (as demonstrated, for example, by increased protein translation duration from a modified polynucleotide), or altered antigen-specific immune response of the host cell.

[0081] Administration of an effective amount (immunogenic effective amount) of the herpes zoster vaccine composition (e.g., herpes zoster vaccine compositions (1) and (2)) is typically intramuscular or subcutaneous administration. Accordingly, the herpes zoster vaccine composition is typically formulated for intramuscular or subcutaneous injection and, for the purposes of the present invention, is formulated without the use of an adjuvant, preferably without any adjuvant. However, other modes of administration are also contemplated, such as intravenous, dermal, intradermal, or intranasal. For intravenous, dermal, or subcutaneous injection, the adenoviral vector will take the form of a parenterally acceptable aqueous solution that is pyrogen-free and has a suitable pH, isotonicity, and stability. Similarly, the isolated envelope polypeptide will take the form of a parenterally acceptable solution having a suitable pH, isotonicity, and stability. Those of ordinary skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as sodium chloride injection, Ringer's injection, lactated Ringer's injection. As needed, preservatives, stabilizers, buffers, antioxidants, and / or other additives may be included.

[0082] In one specific embodiment, an effective amount (immunogenic effective amount) of the herpes zoster vaccine composition (e.g., herpes zoster vaccine compositions (1) and (2)) is administered by intramuscular administration. Intramuscular administration can be achieved by injecting a suspension of the adenoviral vector and / or envelope polypeptide using a needle. An alternative is to use a needle-free injection device to administer the composition (using, for example, a Biojector TM ) or a lyophilized powder containing the vaccine.

[0083] In one embodiment, the primary immunization and / or booster administration, preferably both the primary and booster administrations, further comprises administering one or more adenoviral vectors encoding one or more additional herpes zoster antigens.

[0084] There is no particular limitation on the timing of administration of the primary immunization and the booster immunization. For example, a vaccine composition can be administered for the primary immunization and administered again before administering the vaccine composition for the booster immunization. Further administration of the vaccine composition for further booster immunization is also contemplated. In certain embodiments, the booster vaccine is first administered about 1 - 12 weeks, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks after the initial administration of the primary vaccine. In other embodiments, the booster vaccine is first administered about 12 - 52 weeks after the initial administration of the primary vaccine, such as about 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, or 52 weeks. Based on the teachings herein and common general knowledge in the art, those of ordinary skill in the art will be able to vary the exact timing of the primary and booster vaccines, their frequency of administration, their dosage, etc.

[0085] In one embodiment, the herpes zoster vaccine composition can comprise the first and second mRNAs described herein, formulated in lipid nanoparticles comprising MC3, cholesterol, DSPC, and PEG2000 - DMG, and the buffer trisodium citrate, sucrose, and water for injection. As a non - limiting example, the composition can comprise 2.0 mg / mL of the drug substance (such as herpes zoster vaccine compositions (1) and (2)), 21.8 mg / mL of MC3, 10.1 mg / mL of cholesterol, 5.4 mg / mL of DSPC, 2.7 mg / mL of PEG2000 - DMG, 5.16 mg / mL of trisodium citrate, 71 mg / mL of sucrose, and 1.0 mL of water for injection.

[0086] In one embodiment, a method of inducing an immune response against herpes zoster comprises administering to a subject in need thereof an effective amount of the herpes zoster vaccine composition (1) of the present disclosure. In the herpes zoster vaccine composition (1), the mRNA having the structure of 5’UTR - ORF encoding VZV gE (soluble) - 3’UTR - poly(A) tail can have the nucleotide sequence of SEQ ID NO:5 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99% identity to SEQ ID NO:5).

[0087] In another embodiment, a method of inducing an immune response against herpes zoster comprises administering to a subject in need thereof an effective amount of the herpes zoster vaccine composition (2) of the present disclosure. In the herpes zoster vaccine composition (2), the mRNA having a structure of 5’UTR-ORF encoding VZV gE (full length)-3’UTR-poly(A) tail may have the nucleotide sequence of SEQ ID NO:6 (or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 99% identity to SEQ ID NO:6).

[0088] 3. Sequence Information

[0089] The specific sequence information of SEQ ID NOs: 1 to 8 cited in the present disclosure is as follows.

[0090] SEQIDNO:1

[0091] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAA

[0092] 2) Protein sequence of the ORF encoded in full-length VZV gE

[0093] SEQID NO:2

[0094] MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYYAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR

[0095] 3) Soluble VZV gE mRNA sequence (ORF)

[0096] SEQID NO:3

[0097] AUGGGCACCGUGAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGGAACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUG

[0098] AUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUAC

[0099] CAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGC

[0100] GUACGAUCAUAACUCACCUUAUAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAG

[0101] AGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGG

[0102] GAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUAC

[0103] GGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUG

[0104] UGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAA

[0105] GGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGC

[0106] ACCGAUUCAGCGGAUUUAUGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGU

[0107] CAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAU

[0108] ACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGA

[0109] GGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAAC

[0110] CGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCC

[0111] GAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGU

[0112] GUACAUUUGGAACAUGCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGG

[0113] UCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAA

[0114] CCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGG

[0115] UGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUG

[0116] AUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGG

[0117] UUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAA

[0118] UUCCGGUUGUACAUUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGU

[0119] AUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAU

[0120] AUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGU

[0121] AGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGC

[0122] AUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCA

[0123] AUUGAGGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCC

[0124] AAGGAAAUUACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGG

[0125] ACCGGAGGGCUUGCAGCA

[0126] 4) Full-length VZV gE mRNA sequence (ORF)

[0127] SEQIDNO:4

[0128] AUGGGCACCGUGAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGGAACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUG

[0129] AUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUAC

[0130] CAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGC

[0131] GUACGAUCAUAACUCACCUUAUAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAG

[0132] AGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGG

[0133] GAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUAC

[0134] GGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUG

[0135] UGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAA

[0136] GGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGC

[0137] ACCGAUUCAGCGGAUUUAUGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGU

[0138] CAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAU

[0139] ACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGA

[0140] GGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAAC

[0141] CGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCC

[0142] GAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGU

[0143] GUACAUUUGGAACAUGCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGG

[0144] UCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAA

[0145] CCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGG

[0146] UGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUG

[0147] AUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGG

[0148] UUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAA

[0149] UUCCGGUUGUACAUUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGU

[0150] AUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAU

[0151] AUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGU

[0152] AGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGC

[0153] AUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCA

[0154] AUUGAGGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCC

[0155] AAGGAAAUUACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGG

[0156] ACCGGAGGGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUAC

[0157] GGCUAAACGAAUGAGGGUUAAAGCCUAUAGGGUAGACAAGUCCCCGUAUAACCAAA

[0158] GCAUGUAUUACGCUGGCCUUCCAGUGGACGAUUUCGAGGACUCGGAAUCUACGGAU

[0159] ACGGAAGAAGAGUUUGGUAACGCGAUUGGAGGGAGUCACGGGGGUUCGAGUUACAC

[0160] GGUGUAUAUAGAUAAGACCCGG

[0161] 5) Soluble VZV gE mRNA sequence (5’UTR-ORF-3’UTR-poly(A) tail)

[0162] SEQID NO:5

[0163] AGGCCGGCACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCGCCACCAUGGGCACCGUGAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGG

[0164] AACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUGAUUUUC

[0165] ACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCA

[0166] GAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGA

[0167] UCAUAACUCACCUUAUAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAGAGAACG

[0168] CACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGG

[0169] UUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAU

[0170] CCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACC

[0171] AACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAA

[0172] AGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAU

[0173] UCAGCGGAUUUAUGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGUCAUUAA

[0174] CCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACA

[0175] UGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCA

[0176] GUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGA

[0177] UUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUU

[0178] GAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAU

[0179] UUGGAACAUGCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGGUCACCU

[0180] GGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGA

[0181] GGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUAC

[0182] GUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGC

[0183] UGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAU

[0184] UCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGU

[0185] UGUACAUUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGUAUCAAAA

[0186] UUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGC

[0187] CUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACA

[0188] CCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGA

[0189] AGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAGG

[0190] AGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAA

[0191] UUACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGGACCGGAG

[0192] GGCUUGCAGCAUGAUAAAGCUGGAGCCUCGGUGGCCUUGCUUCUUGCCCCUUGGGC

[0193] CUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAA

[0194] GUCUGAGUGGGCGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0195] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0196] AAAAAAAAAAAAAAAAAAAAAAAAA

[0197] 6) Full-length VZV gE mRNA sequence (5’UTR-ORF-3’UTR-poly(A) tail)

[0198] SEQID NO:6

[0199] AGGCCGGCACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCGCCACCAUGGGCACCGUGAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGG

[0200] AACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUGAUUUUC

[0201] ACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCA

[0202] GAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGA

[0203] UCAUAACUCACCUUAUAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAGAGAACG

[0204] CACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGG

[0205] UUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAU

[0206] CCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACC

[0207] AACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAA

[0208] AGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAU

[0209] UCAGCGGAUUUAUGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGUCAUUAA

[0210] CCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACA

[0211] UGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCA

[0212] GUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGA

[0213] UUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUU

[0214] GAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAU

[0215] UUGGAACAUGCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGGUCACCU

[0216] GGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGA

[0217] GGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUAC

[0218] GUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGC

[0219] UGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAU

[0220] UCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGU

[0221] UGUACAUUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGUAUCAAAA

[0222] UUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGC

[0223] CUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACA

[0224] CCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGA

[0225] AGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAGG

[0226] AGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAA

[0227] UUACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGGACCGGAG

[0228] GGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUACGGCUAAA

[0229] CGAAUGAGGGUUAAAGCCUAUAGGGUAGACAAGUCCCCGUAUAACCAAAGCAUGUA

[0230] UUACGCUGGCCUUCCAGUGGACGAUUUCGAGGACUCGGAAUCUACGGAUACGGAAG

[0231] AAGAGUUUGGUAACGCGAUUGGAGGGAGUCACGGGGGUUCGAGUUACACGGUGUAU

[0232] AUAGAUAAGACCCGGUGAUAAAGCUGGAGCCUCGGUGGCCUUGCUUCUUGCCCCUU

[0233] GGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAA

[0234] UAAAGUCUGAGUGGGCGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0235] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0236] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0237] 7) pUC57-Kan plasmid encoding soluble VZV gE mRNA (soluble VZV gE mRNA sequence underlined)

[0238] SEQID NO:7

[0239] TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGAGAATTCGAGCTCGGTACCTCGCGAATACATCTAGATTAATACGACTCACTATAAGGCCGGCACTCTTCTGGTC CCCACAGACTCAGAGAGAACCCGCCGCCACCATGGGCACCGTGAATAAACCTGTGG TGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCAT GCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCAC GTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAG CGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATC CCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAG ATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGC ACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGAC GCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGCG CGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGTG GATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAAA GTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACATGCGCGGCTCCGATGGTACGTCTACCTACG CCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAGG GGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCTT CAGTATA AGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAA CCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTA CATTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACAC CGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAG TTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAG CATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAGGAGCGTGGATTTCCGCCAACGGCCGGTCA GCCACCGGCGACTACTAAACCCAAGGAAATTACCCCCGTAAACCCCGGAACGTCACCACTTCTACGATATGCCGCA TGGACCGGAGGGCTTGCAGCATGATAAAGCTGGAGCCTCGGTGGCCTTGCTTCTTGCCCCTTGGGCCTCCCCCCAG CCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0240] 8) pUC57-Kan plasmid encoding full-length VZV gE mRNA (the full-length VZV gE mRNA sequence is underlined)

[0241] SEQ ID NO:8

[0242] TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGAGAATTCGAGCTCG GTACCTCGCGAATACATCTAGATTAATACGACTCACTATAAGGCCGGCACTCTTCTGGTC CCCACAGACTCAGAGAGAACCCGCCGCCACCATGGGCACCGTGAATAAACCTGTG GTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGC GATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCA TGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCA CGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATA GCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTAT CCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGA GATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCG CACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGA CGCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGC GCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGT GGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAA AGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACATGCGCGGCTCCGATGGTACGTCTACCTAC GCCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAG GGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCT TCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAA CCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTA CATTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACAC CGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAG TTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAG CATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAGGAGCGTGGATTTCCGCCAACGGCCGGTCA GCCACCGGCGACTACTAAACCCAAGGAAATTACCCCCGTAAACCCCGGAACGTCACCACTTCTACGATATGCCGCA TGGACCGGAGGGCTTGCAGCAGTAGTACTTTTATGTCTCGTAATATTTTTAATCTGTACGGCTAAACGAATGAGGG TTA AAGCCTATAGGGTAGACAAGTCCCCGTATAACCAAAGCATGTATTACGCTGGCCTTCCAGTGGACGATTTCG AGGACTCGGAATCTACGGATACGGAAGAAGAGTTTGGTAACGCGATTGGAGGGAGTCACGGGGGTTCGAGTTACAC GGTGTATATAGATAAGACCCGGTGATAAAGCTGGAGCCTCGGTGGCCTTGCTTCTTGCCCCTTGGGCCTCCCCCCA GCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0243] Example

[0244] Example 1 - DNA Template for In Vitro Transcription and Protein Expression

[0245] The DNA template sequence for in vitro transcription (IVT) of mRNA consists of a T7 promoter, a 5' untranslated region (UTR), an open reading frame (ORF) of the modified glycoprotein E (gE) from the DNA of the oka strain (GenBank: AH010548.2), a 3' UTR, and a 120-base polyadenine (polyA). The 5' UTR and 3' UTR are from human hemoglobin subunit alpha 1 (HBA1) mRNA (GenBank: NM_000558.5). For the soluble form of glycoprotein E (gE sol), the transmembrane domain and carboxyl terminus are removed from the full-length gE sequence to produce a secreted form (ΔTrp541-Arg623). All DNA fragments were synthesized by GenScript (Piscataway, NJ) and subcloned into the pUC57-Kan vector. The sequence of the pUC57-Kan plasmid encoding soluble VZV gE mRNA is shown in SEQ ID NO:7. The sequence of the pUC57-Kan plasmid encoding full-length VZV gE mRNA is shown in SEQ ID NO:8

[0246] Example 2 - In Vitro Transcription (IVT)

[0247] The plasmid vector was linearized for gE and its soluble form using the restriction enzyme BspQI (New England Biolabs). N1-Methylpseudouridine (m1Ψ) was purchased from BOC Sciences (Shirley, NY). The IVT conditions followed the manufacturer's recommendations (TranscriptAid T7 High Yield Transcription Kit, ThermoFisher) as follows:

[0248] ·ATP / CTP / GTP / m1ψTP: 5 mM each

[0249] ●SmartCap (SC101, ST Pharm): 4 mM

[0250] ·Linear template DNA: 1 μg plasmid

[0251] ·T7 RNA polymerase mixture: 2 μl

[0252] IVT was performed in a 20 μl reaction and incubated at 37 °C for 2 h. Template DNA was removed by treatment with 2 units of DNase I (Invitrogen) at 37 °C for 15 min and then subjected to column purification (Monarch RNA Cleanup Kit, New England Biolabs).

[0253] After IVT from the DNA template of VZV gE mRNA, 100 ng of mRNA was electrophoresed on 1% agarose of E-GEL EX in an E-Gel Power Snap electrophoresis system (ThermoFisher) (one of three independent IVT products). The IVT products of two VZV gE constructs were analyzed by agarose gel, and mRNAs of approximately 2 knt in length for both mRNAs were detected. See Figure 1 . The IVT was repeated three times.

[0254] Example 3 - Transfection

[0255] According to the manufacturer's protocol, 1 μg of mRNA (synthesized in triplicate) was transfected individually into 293FT cells (Invitrogen) in a 12-well plate at a ratio of 1:2 using 2 μl of Lipofectamine MessengerMax (Invitrogen). Samples were collected from both the medium and cells 24 h after transfection. Cell lysates were prepared in NP-40 lysis buffer (150 mM sodium chloride / 1% NP-40 / 50 mM Tris pH 8.0). As a transfection control, 0.1 μg of EGFP mRNA (L-7601, TriLink) was co-transfected.

[0256] Example 4 - Western Blot

[0257] Mouse anti-VZV gE monoclonal antibody (#9) was purchased from antibodies.com. Proteins were detected using an HRP-conjugated secondary antibody (Jackson ImmunoResearch, West Grove, PA) and SuperSignal West Pico Plus Chemiluminescent Substrate (Thermo Scientific). EGFP was detected by an HRP-conjugated mouse monoclonal antibody (sc-9996, Santa Cruz Biotechnology). The target protein levels were quantified from triplicates by analyzing the protein band intensities.

[0258] As Figure 2As shown, the gE protein levels were determined by Western blotting. 293FT cells were transfected separately with 1 μg of two gE mRNAs. Cell lysates and media were collected 24 hours after transfection and subjected to Western blotting with gE-specific antibodies. GFP mRNA was co-transfected for normalization, and untransfected 293FT cells were used as negative controls (lanes 1 and 3).

[0259] Samples collected from the media for detecting secreted "soluble" gE protein and cells (from three independent replicates) for detecting intracellular / unsecreted gE protein were subjected to Western blotting. As Figure 2 shown in lane 2, the full-length gE protein was detected in the cell lysates but not in the media (not shown). In contrast, the soluble gE protein was detected only in the media (lane 4) and not in the cell lysates (not shown).

[0260] Example 5 - Immunogenicity Study

[0261] This study aimed to test the immunogenicity of the disclosed varicella zoster vaccine compositions (e.g., varicella zoster vaccine compositions (1) and (2)) in mice.

[0262] Mice were immunized intramuscularly (IM) with the disclosed varicella zoster vaccine compositions, i.e., 1 μg, 5 μg, or 10 μg mRNA formulations of varicella zoster vaccine compositions (1) or (2) (5 mice per dose). The disclosed vaccine compositions were either chemically modified or unmodified. A total of two immunizations were given at 3-week intervals (i.e., at week 0 and week 3), and sera were collected after each immunization until week 8, as Figure 3 shown, on day 20, day 41, and day 56. Serum antibody titers against VZV gE (soluble) and VZV gE (full-length) were determined by ELISA (AcroBiosystems, RAS-T103). After the booster immunization, all immunized mice showed high IgG titers against VZV gE (D41 and D56 sera), as Figure 4 shown. The VZV gE-specific IgG titers of varicella zoster vaccine composition (1) (gE full-length) were higher at the low dose (1 μg) than those of varicella zoster vaccine composition (2) (gE soluble), but the two compositions showed similar titers at higher doses (5 μg and 10 μg).

[0263] Example 6 - In Vitro Neutralization Study

[0264] This study aimed to test the neutralizing ability of the varicella zoster vaccine compositions of the present disclosure (e.g., varicella zoster vaccine compositions (1) to (2)) against VZV infection in cultured human cell lines. A patient-isolated VZV strain (human herpesvirus 3; ATCC, VR-1367; Ellen strain) was propagated in the human epithelial cell line ARPE-19 (ATCC, CRL-2302). The infected cells were resuspended in PBS-sucrose-glutamate-serum (PSGC; 5% sucrose, 0.1% L-glutamate, and 10% FBS) buffer and sonicated to release cell-free virus particles, with sonication performed 3 times for 2 minutes each, with a 15-second interval (PC3 Ultrasonic Unit, L&R). The PSGC supernatant containing cell-free VZV was concentrated by combining 3 volumes with 1 volume of Lenti-X Concentrator (Takara), and then centrifuged at 1,500×g for 45 minutes at 4°C. The VZV pellet was resuspended in 1 / 50 of the initial volume. The viral titer of VZV was determined by infecting ARPE-19 cells with serial dilutions of VZV and measuring gE production using ELISA (AcroBiosystems, RAS-A135).

[0265] To evaluate the neutralization of VZV infection by mouse sera, ARPE-19 cells were infected with VZV together with serial dilutions of mouse sera from varicella zoster compositions (1) and (2). Five days after infection, the amount of gE protein produced by the infected cells was measured as the neutralization titer (NT50) in an ELISA assay (AcroBiosystems, RAS-A135). Figure 5 It was shown that at all three dose levels, gE full-length serum (VER-009) had higher neutralizing antibodies compared to gE soluble (VER-008). Even at the lowest dose (1 μg), the full-length serum was able to elicit strong neutralizing antibodies, while soluble gE required a higher dose to develop neutralizing ability.

Claims

1. A varicella zoster vaccine composition comprising messenger ribonucleic acid (mRNA), said mRNA comprising an open reading frame (ORF) encoding varicella zoster virus (VZV) glycoprotein E (gE).

2. The varicella zoster vaccine composition according to claim 1, wherein the VZV gE has the amino acid sequence of SEQ ID NO:

1.

3. The varicella zoster vaccine composition according to claim 1, wherein the VZV gE has the amino acid sequence of SEQ ID NO:

2.

4. The varicella zoster vaccine composition according to claim 2, wherein the ORF encoding VZV gE has SEQ ID NO:3 nucleotide sequence.

5. The varicella zoster vaccine composition according to claim 3, wherein the ORF encoding VZV gE has SEQ ID NO:4 nucleotide sequence.

6. The varicella zoster vaccine composition according to claim 2, wherein the mRNA comprising the ORF encoding VZV gE further comprises a 5' untranslated region (UTR), a 3' UTR, and a poly(A) tail, thus having the following structure: 5'UTR - ORF encoding VZV gE - 3'UTR - poly(A) tail, and wherein the ORF encoding VZV gE has the nucleotide sequence of SEQ ID NO:

3.

7. The varicella zoster vaccine composition according to claim 3, wherein the mRNA comprising the ORF encoding VZV gE further comprises a 5' untranslated region (UTR), a 3' UTR, and a poly(A) tail, thus having the following structure: 5'UTR - ORF encoding VZV gE - 3'UTR - poly(A) tail, and wherein the ORF encoding VZV gE has the nucleotide sequence of SEQ ID NO:

4.

8. The varicella zoster vaccine composition according to claim 6, wherein the poly(A) tail has a length of 50 - 250 nucleotides.

9. The varicella zoster vaccine composition according to claim 7, wherein the poly(A) tail has a length of 50 - 250 nucleotides.

10. The varicella zoster vaccine composition according to claim 6, wherein the mRNA having the structure of 5'UTR - ORF encoding VZV gE - 3'UTR - poly(A) tail has the nucleotide sequence of SEQ ID NO:

5.

11. The varicella zoster vaccine composition according to claim 7, wherein the mRNA having the structure of 5'UTR - ORF encoding VZV gE - 3'UTR - poly(A) tail has the nucleotide sequence of SEQ ID NO:

6.

12. The varicella zoster vaccine composition according to claim 6, wherein the mRNA having the structure of 5'UTR - ORF encoding VZV gE - 3'UTR - poly(A) tail has a nucleotide sequence having at least 80% identity with SEQ ID NO:

5.

13. The varicella zoster vaccine composition according to claim 7, wherein the mRNA having the structure of 5'-UTR - ORF encoding VZV gE - 3'-UTR - poly(A) tail has a nucleotide sequence having at least 80% identity with SEQ ID NO:

6.

14. The varicella zoster vaccine composition according to claim 1, further comprising a pharmaceutically acceptable carrier.

15. The varicella zoster vaccine composition according to claim 14, wherein the pharmaceutically acceptable carrier is a lipid nanoparticle encapsulating the mRNA.

16. A composition for inducing an immune response against varicella zoster, comprising the varicella zoster vaccine composition according to claim 1.

17. A composition for inducing an immune response against varicella zoster, comprising the varicella zoster vaccine composition according to claim 12.

18. A composition for inducing an immune response against varicella zoster, comprising the varicella zoster vaccine composition according to claim 13.

Images