Lipid nanoparticle wrapping specific miRNA and application of lipid nanoparticle in nerve injury treatment medicine

Abstract

The invention relates to lipid nanoparticles wrapping specific miRNA and application of the lipid nanoparticles in nerve injury treatment medicines, and belongs to the technical field of biological medicines. The invention provides a lipid nanoparticle delivery specific miRNA system for treating nerve injury by directly utilizing a molecular simulant miRNA mimics of an effective component miRNA in the exosome, which not only overcomes the heterogeneity problem of treatment by directly utilizing the exosome, but also solves the problems of low exosome output rate, difficulty in large-scale production and purification and the like, and has a wide application prospect. The application of the LNP-miRNA-mimics in nerve injury treatment is realized in an LNP delivery mode, a pure component treatment strategy is realized, and the application value of LNP in nerve injury treatment is further developed. Compared with direct application of the umbilical cord mesenchymal stem cell exosome to treatment of nerve injury, the LNP-miRNA-mimics treatment system is more uniform and good in repeatability, and is a good delivery treatment scheme.

Description

Technical Field

[0001] The present invention relates to a lipid nanoparticle encapsulating a specific miRNA and its application in a medicament for treating nerve injury, belonging to the technical field of biomedicine. Background Art

[0002] Nerve regeneration and repair is a key area for restoring function after injury. Especially in spinal cord injury (SCI), its research is of great significance. SCI is a severe central nervous system (CNS) injury, usually resulting in the loss of motor, sensory, or autonomic functions below the injury level. According to the WHO report in 2024, more than 15 million people worldwide currently suffer from SCI, and the incidence and mortality rates are increasing year by year. Effective prevention, treatment, rehabilitation, and continuous healthcare are crucial for reducing the global burden of SCI. Different from nerve injuries in the peripheral nervous system (PNS), after Wallerian degeneration occurs in the PNS, the severed axons may regrow into the distal nerve sheath and reinnervate the surrounding targets. However, the plasticity of the adult CNS is low, neuron regeneration is limited, and the regeneration after injury is extremely weak. After years of research, it is currently believed that traumatic SCI can be achieved through long-distance axon regeneration and the construction of new local relay nerve circuits (by using exogenous neural stem / progenitor cells (NSCs) or using endogenous NSCs). However, the complexity of various strategies has led to extremely low clinical feasibility. Therefore, developing safe and effective clinical treatment methods to promote neuroplasticity, neurogenesis, and reconstruct damaged nerve circuits is necessary for improving nerve healing after SCI.

[0003] In recent years, the research on the regeneration and repair of nerve injuries has gradually focused on multiple aspects, including promoting the regeneration of nerve cells, repairing the nerve connections in the damaged area, and reconstructing nerve functions. The application of biomaterials, cell therapy, gene editing technology and other cutting-edge means have provided new possibilities for nerve regeneration treatment. In the nervous system, the activities of various transcription factors, epigenetic modifiers of DNA methylation and chromatin structure, and microRNA (miRNA) are related to the activation of pro-regenerative transcriptional programs. The expression of miRNA depends on tissues and environments. Specific miRNAs play key roles in nerve development and are expressed in a specific manner according to the corresponding time and space of these roles. In the representative disease of nerve injury, spinal cord injury (SCI), after the trauma occurs, several seemingly independent biological processes (such as axonal degeneration / regeneration, inflammation, cell death, myelin loss) are intertwined. In this case, miRNAs are like a perfectly coordinated network. Each miRNA can act on different mRNAs, and a molecule can also be targeted by multiple miRNAs. Therefore, as an internal regulatory system, miRNAs can precisely control different nerve processes, coordinate their actions to regulate complex gene expression networks. Therefore, finding specific miRNA molecules for in vivo regulation after SCI can promote the functional integration of axonal regeneration to improve nerve healing after SCI. Mesenchymal stem cell exosomes have been proven to play an active role in nerve repair treatment after SCI, and exosomes are a stable source of miRNAs. Then, whether there are nucleic acid molecules with universal functional therapy in exosomes is worthy of further research, and if the therapeutic effect can be achieved, it can be further developed and applied.

[0004] Nucleic acid drugs such as miRNA, mRNA, and plasmid DNA provide therapeutic potential for gene therapy. However, naked nucleic acid drugs are unstable and easily degraded in circulation, and the negative charges carried by biological materials such as RNA and DNA limit their penetration through the negatively charged cell membrane. Based on this, it is necessary to use a safe and effective delivery vector to deliver therapeutic miRNA molecules in SCI. Lipid nanoparticles (LNPs) are an extraordinary vector. Since the approval of the mRNA vaccine for COVID-19 infection, LNPs have accelerated the application of mRNA in the human body. Compared with other vectors, LNPs have advantages such as high encapsulation efficiency, stable structure, and simple preparation. Ionizable lipid molecules are designed as the main components of LNPs. LNPs release their nucleic acid contents through phase transformation at a specific pH to play a regulatory and therapeutic role. Currently, the FDA has only approved three ionizable cationic lipids for RNA delivery. SM-102 and ALC-0315 are the first monoamine lipids to be put into clinical practice for delivering mRNA. The therapeutic applications of LNPs mainly focus on the delivery of mRNA for vaccine development and tumor treatment research. Using the delivery properties of LNPs to deliver miRNA therapeutic molecules is worthy of exploration in the research on nerve injury regeneration and repair treatment. Summary of the Invention

[0005] In view of the deficiencies of the prior art, the present invention provides a lipid nanoparticle encapsulating a specific miRNA and its application in drugs for treating nerve injuries, and takes a nerve injury model - SCI as an example to verify its efficacy. It has been proven that exosomes of umbilical cord mesenchymal stem cells play a positive role in promoting nerve injury repair. Therefore, the primary object of the present invention is to utilize the active and effective therapeutic component - miRNA in exosomes, use LNP as a delivery carrier, and treat nerve injuries in the form of LNP-miRNA-mimics, providing a new method for treating nerve injuries.

[0006] The object of the present invention is achieved by the following technical solutions:

[0007] A lipid nanoparticle encapsulating a specific miRNA, wherein the specific miRNA is a molecular mimic of miRNA, namely miRNA mimics, including has-miR939-5p mimics, has-miR665 mimics, and has-miR185-3p mimics.

[0008] Preferably, the nucleic acid sequence of the sense strand of the has-miR939-5p mimics is as shown in SEQ ID NO.1, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.2; the nucleic acid sequence of the sense strand of the has-miR665 mimics is as shown in SEQ ID NO.3, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.4; the nucleic acid sequence of the sense strand of the has-miR185-3p mimics is as shown in SEQ ID NO.5, and the nucleotide sequence of the antisense strand is as shown in SEQ ID NO.6.

[0009] Preferably, the lipid components of the lipid nanoparticle include: ALC-0315, DSPC, cholesterol, and ALC-0159.

[0010] More preferably, the molar ratio of ALC-0315, DSPC, cholesterol, and ALC-0159 is 46.3:9.4:42.7:1.6.

[0011] In the present invention, the particle size range of the lipid nanoparticle LNP-miRNA-mimics encapsulating a specific miRNA is 50 - 125 nm, the dispersity index (PDI) is less than 0.2, and the Zeta potential range is -15 - +15 mV.

[0012] The preparation method of the above-mentioned lipid nanoparticle encapsulating a specific miRNA includes the following steps:

[0013] 1) Prepare lipid stock solutions of ALC-0315, DSPC, cholesterol, and ALC-0159 respectively with ethanol as the solvent, and mix them in proportion to prepare a compound-ethanol solution;

[0014] 2) Dilute miRNA mimics to the working concentration with sodium citrate buffer to obtain an aqueous solution;

[0015] 3) Mix the compound-ethanol solution and the aqueous solution to form LNP-miRNA-mimics complexes spontaneously, and dilute them with PBS buffer;

[0016] 4) Replace the LNP-miRNA-mimics complexes with PBS buffer by ultrafiltration to reduce the ethanol content to less than 0.5%, and then concentrate;

[0017] 5) Add sucrose as a cryoprotectant to the concentrated LNP-miRNA-mimics complexes, and filter through a 0.22 μm filter to obtain lipid nanoparticles encapsulating specific miRNAs, namely LNP-miRNA-mimics.

[0018] Preferably, the concentration of the lipid stock solution described in step 1) is 5 - 12.5 mg / mL.

[0019] More preferably, the concentration of the lipid stock solution described in step 1) is 10 mg / mL.

[0020] Preferably, the mass ratio of has-miR939-5p mimics, has-miR665 mimics, and has-miR185-3p mimics in the aqueous solution described in step 2) is 1:1:1, and the working concentration of the total miRNA mimics in the aqueous solution is prepared by calculating based on the LNP-miRNA-mimics in the LNP-miRNA-mimics complexes described in step 3) containing 0.4 - 1 mg / mL.

[0021] More preferably, the working concentration of the total miRNA mimics in the aqueous solution is prepared by calculating based on the LNP-miRNA-mimics in the LNP-miRNA-mimics complexes described in step 3) containing 0.5 mg / mL.

[0022] Preferably, the dilution with PBS buffer described in step 3) is to add 2 - 3 volumes of PBS buffer to the LNP-miRNA-mimics complexes for dilution to maintain the stability of the LNP-miRNA-mimics complexes, otherwise high-concentration ethanol will cause lipid nanoparticle fusion; the pH of the PBS buffer is 6.9 - 7.9.

[0023] Preferably, the ultrafiltration described in step 4) is centrifugation at 3000 - 4000×g for 10 - 15 min using a 100 kDa ultrafiltration centrifuge tube; the pH of the PBS buffer is 6.9 - 7.9.

[0024] Preferably, the sucrose concentration described in step 5) is 8% - 10% sucrose in the final solution, and it is gently mixed and stored.

[0025] More preferably, the sucrose concentration described in step 5) is 10% sucrose in the final solution.

[0026] Use of the above lipid nanoparticles encapsulating specific miRNA in the preparation of a medicament for treating nerve injury.

[0027] Preferably, the lipid nanoparticles encapsulating specific miRNA can promote the regeneration and repair of nerve injury;

[0028] More preferably, the lipid nanoparticles encapsulating specific miRNA can promote the behavioral recovery, muscle recovery and neuronal recovery at the injury site after spinal cord injury.

[0029] Beneficial effects:

[0030] (1) Mesenchymal stem cell exosomes have been proven to play an active role in the treatment of nerve injury. In previous studies of the present invention, it was found that specific miRNAs in mesenchymal stem cell exosomes can be used as effective therapeutic components for nerve injury, and the miRNAs include has - miR939 - 5p, has - miR665, and has - miR185 - 3p. Based on this, the present invention directly uses the molecular mimics (miRNA mimics) of the effective component miRNA in exosomes to provide a lipid nanoparticle delivery system for specific miRNA (LNP - miRNA - mimics) for treating nerve injury. It not only overcomes the heterogeneity problem of directly using exosomes for treatment, but also solves the problems of low exosome production rate and difficulty in large - scale production and purification. Through the LNP delivery method, the application of LNP - miRNA - mimics in the treatment of nerve injury is realized, achieving a simple - component treatment strategy and further developing the application value of LNP in treating nerve injury.

[0031] (2) The present invention prepares an LNP-miRNA-mimics therapeutic system using ionizable lipid ALC-0315, auxiliary lipid DSPC, structural lipid cholesterol, and polyethylene glycol lipid ALC-0159 as carriers. miRNA mimics are molecular mimics of miRNAs derived from umbilical cord mesenchymal stem cell exosomes, including three types of mimics: has-miR939-5p mimics, has-miR665 mimics, and has-miR185-3p mimics. Compared with directly applying umbilical cord mesenchymal stem cell exosomes to treat nerve injuries, the LNP-miRNA-mimics therapeutic system is more uniform and has good repeatability, making it an excellent delivery treatment plan. Description of the Drawings

[0032] Figure 1 Schematic diagram of the components of lipid nanoparticles loaded with specific miRNAs.

[0033] Figure 2 Graph for detecting and analyzing the characteristics of lipid nanoparticles loaded with specific miRNAs; where A is the particle size distribution diagram of LNP-NC; A1 is the peak Zeta potential diagram of LNP-NC; B is the particle size distribution diagram of LNP-miRNA-mimics; B1 is the peak Zeta potential diagram of LNP-miRNA-mimics.

[0034] Figure 3 Graph for analyzing the regulatory effect of lipid nanoparticles loaded with specific miRNAs on neuron cells; where A is the bar graph of the expression level of has-miR185-3p in neuron cells; A1 is the bar graph of the expression level of has-miR665 in neuron cells; A2 is the bar graph of the expression level of has-miR939-5p in neuron cells; B is the bar graph of the expression level of neuron marker Tuj1 in neuron cells; B1 is the bar graph of the expression level of growth-associated protein (GAP43) in neuron cells; C is the bar graph of the expression level of antioxidant marker NQO1 in neuron cells; C1 is the bar graph of the expression level of antioxidant marker SOD1 in neuron cells; C2 is the bar graph of the expression level of antioxidant marker HO1 in neuron cells.

[0035] Figure 4 Graph for analyzing the in vivo expression time of lipid nanoparticles loaded with specific miRNAs in the spinal cord of mice; where A is the in vivo fluorescence imaging graph of the injected LNP system; A1 is the line graph of the change in fluorescence intensity of the LNP system in vivo over time; B is the line graph of the change in the body weight of mice during the 21-day treatment with the LNP system.

[0036] Figure 5Results of lipid nanoparticles loaded with specific miRNAs promoting the recovery of hindlimb behavior in spinal cord injury mice; among them, A is the dynamic footprint map of SCI mice; B is the line graph of the hindlimb step length of SCI mice changing with time; C is the line graph of the BMS score of SCI mice changing with time; where * / ** / *** indicate significant differences between each treatment group and the Sham (sham operation) group, and # / ## indicate significant differences between the LNP-miRNA-mimics group and the LNP-NC group (negative control group).

[0037] Figure 6 Results of the expression of spinal cord in-situ neurons and astrocytes in spinal cord injury mice promoted by lipid nanoparticles loaded with specific miRNAs; among them, A is the expression of neurons Tuj1 (green) and astrocytes GFAP (red) at the spinal cord injury site; A1 is the statistical graph of the fluorescence intensity of GFAP; A2 is the statistical graph of the fluorescence intensity of Tuj1.

[0038] Figure 7 Results of lipid nanoparticles loaded with specific miRNAs promoting the recovery of bilateral hindlimb muscles and neuromuscular junctions in spinal cord injury mice; among them, A is the laminin (green) staining of the cross-section of the hindlimb muscle bundle; A1 is the statistical graph of the cross-sectional area of the hindlimb muscle bundle; B is the staining result graph of the hindlimb muscle neuromuscular junction, where SV2 / NF (green) shows the nerve condition of the innervated muscle, and α-Bungarotoxin (red) staining shows the nicotinic acetylcholine receptor at the neuromuscular junction; B1 is the statistical graph of the area of the nicotinic acetylcholine receptor in the bilateral tibialis anterior muscles. Detailed implementation manners

[0039] The technical solution of the present invention will be further described below through specific implementation manners and accompanying drawings. Those skilled in the art should understand that the embodiments are only for helping to understand the present invention and should not be regarded as specific limitations on the present invention.

[0040] In the following experimental methods of the embodiments, unless otherwise specified, they are all conventional methods; the experimental materials used, unless otherwise specified, are all purchased from conventional biochemical reagent manufacturers.

[0041] Among the materials described in the following embodiments: the variety of mice is C57BL / 6J mice.

[0042] Example 1

[0043] Preparation of lipid nanoparticles (LNP system) loaded with specific miRNAs (key components are as Figure 1 shown)

[0044] (1) Prepare lipid nanoparticles (LNPs) using the FDA-approved ALC-0315 carrier. Ionizable lipid ALC-0315 (Sinobang) , co-lipid DSPC (Sinobang), structural lipid cholesterol (Sinobang), and polyethylene glycol lipid ALC-0159 (Avertop) were separately formulated into lipid stock solutions at 10 mg / mL using ethanol as a solvent. Then, the lipid stock solutions were mixed according to the molar ratio of ALC-0315:DSPC:cholesterol:ALC-0159 = 46.3:9.4:42.7:1.6 to prepare a compound-ethanol solution.

[0045] (2) Dilute miRNA mimics (GenScript) to the working concentration using acidic RNase-free sodium citrate buffer (Yuanye Bio). The miRNA mimics include has-miR185-3p mimics, has-miR665 mimics, and has-miR939-5p mimics (calculate the input mass of miRNA mimics according to 0.5 mg / mL of LNP-miRNA-mimics in the LNP-miRNA-mimics complex. The miRNA mimics aqueous solution is input according to the mass ratio of has-miR185-3p mimics, has-miR665 mimics, and has-miR939-5p mimics of 1:1:1. The 5' ends of the antisense strands of the three miRNA-mimics are modified with the cy5 fluorescent group) to obtain an aqueous solution;

[0046] The sequences of the above miRNA mimics are as follows:

[0047] has-miR939-5p mimics:

[0048] Sense strand (5'-3'): UGGGGAGCUGAGGCUCUGGGGGUG (SEQ ID NO.1)

[0049] Antisense strand (5'-3'): Cy5-CCCCCAGAGCCUCAGCUCCCCAUU (SEQ ID NO.2)

[0050] has-miR665 mimics:

[0051] Sense strand (5'-3'): ACCAGGAGGCUGAGGCCCCU (SEQ ID NO.3)

[0052] Antisense strand (5'-3'): Cy5-GGGCCUCAGCCUCCUGGUUU (SEQ ID NO.4)

[0053] has-miR185-3p mimics:

[0054] Sense strand (5'-3'): AGGGGCUGGCUUUCCUCUGGUC (SEQ ID NO.5)

[0055] Antisense strand (5'-3'): Cy5-CCAGAGGAAAGCCAGCCCCUUU (SEQ ID NO.6)

[0056] (3) Load the microfluidic chip into a nano-drug manufacturing instrument (MingTai, Microflow S). Load the compound-ethanol solution and the aqueous solution into a disposable sterilized syringe at a volume ratio of 1:3. After exhausting the air, load it into the nano-drug manufacturing instrument. Through the nano-drug manufacturing instrument, the lipids in the compound-ethanol solution and the miRNA mimics in the aqueous solution spontaneously form LNP-miRNA-mimics complexes (LNP-miRNA-mimics + ethanol + sodium citrate buffer system), and add 3 volumes of sterile PBS buffer (pH 7.4, Thermo Fisher) for dilution to maintain the stability of the LNP-miRNA-mimics complexes.

[0057] (4) Centrifuge through a 100 kDa ultrafiltration centrifugal tube (MERCK MILLIPORE) at 4000×g for 10 min. After centrifugation, add PBS buffer to the original volume, and repeat ultrafiltration until the ethanol content drops below 0.5%.

[0058] (5) Concentrate the LNP-miRNA-mimics complexes and add PBS buffer containing sucrose (Avertop). The final concentration of sucrose added is 10% as a cryoprotectant, and filter through a 0.22 μm filter to obtain lipid nanoparticles loaded with specific miRNA (LNP-miRNA-mimics).

[0059] (6) The negative control group lipid nanoparticles (LNP-NC) are obtained by encapsulating the negative control sequence in the same way (the 5' end of the antisense strand is modified with a cy5 fluorescent group).

[0060] The above negative control sequence is as follows:

[0061] Sense strand (5'-3'): UUCUCCGAACGUGUCACGUdTdT (SEQ ID NO.7)

[0062] Antisense strand (5'-3'): Cy5-ACGUGACACGUUCGGAGAAdTdT (SEQ ID NO.8)

[0063] The encapsulation of the above lipid nanoparticles was commissioned to Nanjing Genscript Biotech Co., Ltd. The concentration of LNP-miRNA-mimics or LNP-NC in each group of lipid nanoparticle solutions obtained was 0.5 mg / mL, and they were stored at -80 °C to avoid repeated freezing and thawing.

[0064] Example 2

[0065] Characterization of Lipid Nanoparticles Loaded with Specific miRNA

[0066] Take 3 μL of the LNP system prepared in Example 1, add 1 mL of RNase-free water, dilute and mix well, then use dynamic light scattering to detect the particle size distribution of the lipid nanoparticles and calculate their polydispersity index (PDI), use laser Doppler electrophoresis to detect their Zeta potential, use pH test paper to detect the pH range, and use the nucleic acid green reagent method (Quant-iT RiboGreen RNA kit) to quantify the final effective load miRNA concentration of the LNP and calculate the encapsulation efficiency. Encapsulation efficiency = detected concentration × loaded mass / input mass × 100%. The detection results are as Figure 2 shown. A - A1 shows the nanoparticle size and Zeta potential peak diagram of LNP-NC. A shows the average particle size of 70.62 nm, and A1 shows the Zeta potential of -2.7470 mV. Table 1 shows the detection results of the basic properties of LNP-NC. Among them, the pH is 7.4 ± 0.5, and the polydispersity index (PDI) of dynamic light scattering is 0.08. Figure B shows the detection results of LNP-miRNA-mimics. B - B1 shows the nanoparticle size and Zeta potential peak diagram of LNP-miRNA-mimics. The average particle size is 70.70 nm, and the Zeta potential is -3.1910 mV. Table 2 shows the detection results of the basic properties of LNP-miRNA-mimics. Among them, the pH is 7.4 ± 0.5, and the polydispersity index (PDI) of dynamic light scattering is 0.07, meeting the basic physicochemical parameters required for the LNP system.

[0067] Table 1. Detection Results of the Basic Properties of LNP-NC

[0068]

[0069] Table 2. Detection Results of the Basic Properties of LNP-miRNA-mimics

[0070]

[0071]

[0072] Example 3

[0073] Analysis of the regulatory effect of lipid nanoparticles loaded with specific miRNAs on nerve cells

[0074] A general cell model of nerve injury - the mouse neuron cell model was used to detect the regulatory effect on neuron cells after transfection with LNP - miRNA - mimics.

[0075] (1) Construction of in vitro neuron cell model: The brains of C57BL / 6J neonatal mice within 24 h after birth were taken, the hippocampal region was dissected, and the meninges and blood vessels in the obtained hippocampal region were completely dissected. Using a sterilized ophthalmic scissors, it was completely broken into tissue pieces that were not visibly obvious to the naked eye, and transferred to a 25 cm 2 cell culture flask, and 3 mL of neuron cell culture medium (Gbico, 2186946) was added and cultured for 7 - 10 days at 37 °C and 5% CO2 to obtain neuron cell cultures for subsequent experiments.

[0076] (2) 2 μL of the LNP system prepared in Example 1 was added to 2 mL of the neuron cell culture obtained in step (1) so that the final concentration of LNP - NC or LNP - miRNA - mimics in the neuron cell culture was 500 ng / mL, and cultured for 48 h.

[0077] (3) After the culture was completed, the total RNA was extracted from the transfected cells respectively, and qPCR was used to detect whether the miRNA was successfully transfected and the expression of markers such as cell differentiation and oxidative stress.

[0078] The results are as Figure 3 shown. A - A2 show that successful transfection with LNP - miRNA - mimics simultaneously highly expressed has - miR185 - 3p (A), has - miR665 (A1), and has - miR939 - 5p (A2) in neuron cells; B - B1 show that transfection with LNP - miRNA - mimics can promote the expression levels of neuron - specific class III β - tubulin (Tuj1) and growth - associated protein (GAP43) in neuron cells; C - C2 indicate that after transfection with LNP - miRNA - mimics, the expression levels of antioxidant markers NQO1 (NAD(P)H quinone dehydrogenase 1) and SOD1 (superoxide dismutase 1) in neuron cells increased; indicating that LNP - miRNA - mimics can promote the differentiation and regeneration ability and oxidative stress defense function of neurons.

[0079] Example 4

[0080] Analysis of the in - vivo expression time of lipid nanoparticles loaded with specific miRNAs in the spinal cord of mice

[0081] (1) Eighteen mice were randomly selected and evenly divided into three groups for treatment, namely the LNP-NC group, the LNP-miRNA-mimics group, and the Sham group (sham operation group, that is, only laminectomy was performed, and the spinal cord was not compressed and then sutured).

[0082] (2) Construction of a spinal cord injury mouse model: A reproducible compressive (spinal cord compression) mouse SCI model was constructed to explore the in vivo expression time of the LNP system in the tissues of spinal cord injury mice in situ. After exposing the spine of the T10 part of the mouse, a pair of fine-tipped Dumont #5 forceps and Vana scissors were used to carefully remove the lamina, ensuring that the spinal cord was not resected or compressed; after exposing the spinal cord at the corresponding position, the calibrated Dumont #5 forceps were placed in the middle section of the exposed spinal cord, with the tip touching the bottom, and the forceps were closed until the spacer was connected, and the spinal cord was compressed in situ for 15 s to cause spinal cord compression injury. Immediately after the injury, 10 μL of the cy5-labeled LNP-NC solution or LNP-miRNA-mimics solution prepared in Example 1 (the concentration of lipid nanoparticles LNP-NC or LNP-miRNA-mimics in the solution was 0.5 mg / mL) was locally injected at the injury site with a syringe; the forceps were removed and the internal muscle layer was carefully sutured, taking care not to compress the spinal cord, and then the surface skin was sutured again. After taking out the forceps, carefully suture the internal muscle layer, taking care not to compress the spinal cord, and then suture the surface skin a second time.

[0083] (3) At 24 hours, 48 hours, 7 days, and 14 days after the intervention, the in vivo expression time of the LNP system in the LNP-NC and LNP-miRNA-mimics groups was detected using a full-spectrum animal in vivo imaging system, and the changes in animal body weight were recorded.

[0084] The results are as Figure 4 shown, where A-A1 is the continuous expression of the cy5-labeled LNP system in each group of mice. The fluorescence intensity showed high in vivo expression of the LNP system within 24 to 48 hours after treatment, and then the fluorescence intensity gradually decreased, and the in vivo fluorescence expression could hardly be detected by the 14th day; as shown in A1, the fluorescence intensity of the in vivo expression of the LNP system gradually decreased with time; at the same time, the results of B showed that the body weight of the SCI mice in the LNP-miRNA-mimics group began to show an upward trend from the 7th day, and by the 21st day, the body weight of the mice in the LNP-miRNA-mimics group had recovered to the level of the Sham group (compared with the mice in the Sham group, p = 0.9944, no statistical difference).

[0085] Example 5

[0086] Lipid nanoparticles loaded with specific miRNA promote the recovery of hind limb behavior in spinal cord injury mice

[0087] Spinal cord injury (SCI) pathologically includes three stages: acute phase (<48 h), subacute phase (48 h - 14 d), and chronic phase (>6 m); spinal cord compression or transection caused by various reasons will trigger a rapid secondary injury cascade reaction, such as bleeding, inflammation, etc., neuron cells and glial cells are damaged, and the vascular system is damaged and the blood-spinal cord barrier is impaired, thus causing serious consequences. In this experiment, a reproducible compressive (spinal cord compression) mouse SCI model was constructed to explore the role of LNP-miRNA-mimics in promoting the recovery of hindlimb behavior in mice with spinal cord injury. The specific steps are as follows:

[0088] (1) Randomly select 18 mice and divide them into three groups on average, namely the Sham group, the LNP-NC group, and the LNP-miRNA-mimics group; among them, the Sham group is the sham operation group, that is, only laminectomy is performed, and the spinal cord is not compressed and then sutured.

[0089] (2) Construct a mouse model of spinal cord injury according to the steps of Example 4 (2). Among them, the LNP-NC group is to inject 10 μL of the LNP-NC solution prepared in Example 1 into the lesion of the mouse during the acute phase of spinal cord injury; the LNP-miRNA-mimics group is to inject 10 μL of the LNP-miRNA-mimics solution prepared in Example 1 into the lesion of the mouse during the acute phase of spinal cord injury.

[0090] (3) On the 1st, 7th, 14th, and 21st days after the intervention, perform BMS scoring on the above three groups of mice and analyze the hindlimb step length of the mice using footprint analysis.

[0091] The results are as Figure 5 shown. Among them, A and B are the recovery of the hindlimb step length of each group of mice. With the increase of the recovery time, the hindlimb step length of SCI mice in the LNP-miRNA-mimics group has been significantly improved. Specifically, compared with the LNP-NC group, the hindlimb motor function of SCI mice in the LNP-miRNA-mimics group began to recover from the 7th day, and the step length was better than that of SCI mice in the LNP-NC group from the 7th day to the 21st day. Specifically, on the 7th day, the step length of mice in the LNP-miRNA-mimics group was compared with that in the LNP-NC group, ##p = 0.0062, with statistical significance. On the 14th day, #p = 0.0135, and on the 21st day, ##p = 0.0079, still with statistical significance. And on the 14th day, the step length of mice in the LNP-miRNA-mimics group was compared with that in the Sham group, p = 0.2166, without statistical significance, indicating that there was no significant difference in the hindlimb step length of SCI mice in the LNP-miRNA-mimics group compared with the Sham group.

[0092] At the same time, byFigure 5 C in it shows that the BMS score indicates that the motor scores of SCI mice in the LNP-miRNA-mimics group have been significantly higher than those in the LNP-NC group since the 7th day. Specifically, on the 14th day, compared with the LNP-NC group, #p = 0.0134 in the LNP-miRNA-mimics group, showing a statistically significant difference, indicating that the hindlimb motor function of SCI mice in the LNP-miRNA-mimics group on the 14th day was already superior to that of SCI mice in the LNP-NC group, and the difference continued until the 21st day. On the 21st day, compared with the LNP-NC group, ##p = 0.0062 in the LNP-miRNA-mimics group, showing a significant statistical difference;

[0093] The above results indicate that timely administration of LNP-miRNA-mimics for treatment during the acute phase of spinal cord injury in mice can effectively promote the recovery of hindlimb motor function and the improvement of hindlimb step length in spinal cord injury mice.

[0094] Example 6

[0095] Lipid nanoparticles loaded with specific miRNA promote the recovery of neurons at the injury site after spinal cord injury in mice

[0096] The spinal cords of the mice on the 21st day after the treatment in Example 5 were taken for cryoembedding and then sectioned, and the section thickness was 8 - 10 μm. Immunofluorescence staining was used to label the expression of astrocytes (GFAP) and neuronal marker Tuj1 at the injury site. After the staining was completed, the in-situ expression of GFAP and Tuj1 in the spinal cord was observed using a dish microscope (OLYMPUS BX61). The results are as Figure 6 shown. A shows the expression of GFAP (red) and Tuj1 (green) in-situ at the spinal cord injury site, and A1 - A2 respectively show the quantitative statistics of the in-situ fluorescence intensity of GFAP and Tuj1; the results indicate that compared with the LNP-NC group, LNP-miRNA-mimics treatment significantly restricted the expression of GFAP to limit the excessive formation of glial scars, and the LNP-miRNA-mimics group could promote the expression of Tuj1 in-situ at the spinal cord injury site, suggesting that lipid nanoparticles loaded with specific miRNA can promote the recovery of neurons at the spinal cord injury site.

[0097] Example 7

[0098] Lipid nanoparticles loaded with specific miRNA promote the recovery of bilateral hindlimb muscles and neuromuscular junctions in spinal cord injury mice

[0099] On the 21st day after the treatment in Example 5, the tibialis anterior muscles of the double hindlimbs of the mice were frozen-embedded and sectioned, and the section thickness was 8 μm. Immunofluorescence staining was used to label the cross-section of the muscle bundle and the recovery of the neuromuscular junction. After the staining was completed, an inverted microscope (OLYMPUS BX61) was used for observation. The results are as Figure 7 shown. Among them, A to A1 show the changes in the cross-sectional area of the tibialis anterior muscle bundles of the double hindlimbs labeled with Laminin (green). The results show that the cross-sectional area of the tibialis anterior muscle bundles of the double hindlimbs was significantly improved after treatment with the LNP-miRNA-mimics group compared with the LNP-NC group, and there was a significant difference from the LNP-NC group, being closer to the Sham group. Figure B shows the expression of the neuromuscular junction in the tibialis anterior muscle tissue section labeled with a combination of the neuronal axon markers SV2\NF (green) and the nicotinic acetylcholine receptor (AchR) α-bungarotoxin (red). The co-expression of α-bungarotoxin (red) and SV2\NF (green) in the LNP-miRNA-mimics group was better than that in the LNP-NC group, indicating that the nerve innervation recovery of the tibialis anterior muscle of the double hindlimbs in the LNP-miRNA-mimics group was better than that in the LNP-NC group; the quantitative measurement of the area of the nicotinic acetylcholine receptor in the tibialis anterior muscle of the double hindlimbs in Figure B1 shows that the area of the nicotinic acetylcholine receptor in the muscles of the LNP-NC group and the LNP-miRNA-mimics group was significantly lower than that in the Sham group, but there was no significant difference between the two groups, indicating that the main effect of LNP-miRNA-mimics treatment was on nerve recovery.

Claims

1. A lipid nanoparticle encapsulating a specific miRNA, characterized in that: The specific miRNA is a molecular mimic of miRNA, namely miRNA mimics, including has-miR939-5p mimics, has-miR665 mimics, and has-miR185-3pmimics.

2. The lipid nanoparticle according to claim 1, wherein The nucleic acid sequence of the sense chain of the has-miR939-5p mimics is shown as SEQ ID NO.1, and the nucleotide sequence of the antisense chain is shown as SEQ ID NO.2; the nucleic acid sequence of the sense chain of the has-miR665mimics is shown as SEQ ID NO.3, and the nucleotide sequence of the antisense chain is shown as SEQ ID NO.4; the nucleic acid sequence of the sense chain of the has-miR185-3p mimics is shown as SEQ ID NO.5, and the nucleotide sequence of the antisense chain is shown as SEQ ID NO.

6.

3. The lipid nanoparticle according to claim 1, characterized in that The lipid components of the lipid nanoparticles include: ALC-0315, DSPC, cholesterol, and ALC-0159; Preferably, the molar ratio of ALC-0315, DSPC, cholesterol and ALC-0159 is 46.3:9.4:42.7:1.

6.

4. The method for preparing lipid nanoparticles according to claim 1, characterized in that: The steps include: 1) ALC-0315, DSPC, cholesterol, and ALC-0159 were prepared into lipid stock solutions using ethanol as solvent, and then mixed according to proportion to prepare a compound-ethanol solution; 2) Diluting miRNA mimics to a working concentration using sodium citrate buffer to obtain an aqueous solution; 3) mixing the compound-ethanol solution and the aqueous solution to autonomously form the LNP-miRNA-mimics complex, and diluting it with PBS buffer; 4) replacing the LNP-miRNA-mimics complex with PBS buffer by ultrafiltration to reduce the ethanol content to below 0.5%, and then concentrating; 5) Sucrose is added to the concentrated LNP-miRNA-mimics complex as a cryoprotectant, and the lipid nanoparticles encapsulating specific miRNA, namely LNP-miRNA-mimics, are obtained after 0.22 μm filtration.

5. The preparation method according to claim 4, characterized in that: The concentration of the lipid stock solution in step 1) is 5 to 12.5 mg / mL; Further preferably, the concentration of the lipid stock solution is 10 mg / mL.

6. The preparation method according to claim 4, characterized in that: The mass ratio of hs-miR939-5pmimics, hs-miR665 mimics, and hs-miR185-3p mimics in the aqueous solution described in step 2) is 1:1:1, and the working concentration of the total miRNA mimics in the aqueous solution is calculated based on the LNP-miRNA-mimics complex described in step 3) containing 0.4-1 mg / mL of LNP-miRNA-mimics; Further preferably, the working concentration of the total miRNA-mimics in the aqueous solution is calculated based on the LNP-miRNA-mimics complex described in step 3) containing 0.5 mg / mL of LNP-miRNA-mimics.

7. The preparation method according to claim 4, characterized in that: The PBS buffer dilution in step 3) is to dilute by adding 2 to 3 times the volume of the LNP-miRNA-mimics complex into the PBS buffer; the pH of the PBS buffer is 6.9 to 7.

9.

8. The preparation method according to claim 4, characterized in that: The ultrafiltration in step 4) is performed by centrifuging at 3000-4000×g for 10-15 min using a 100 kDa ultrafiltration centrifuge tube; the pH of the PBS buffer is 6.9-7.

9.

9. The preparation method according to claim 4, characterized in that: The sucrose concentration in step 5) is 8% to 10% sucrose in the final solution; Further preferably, the sucrose concentration is 10% sucrose in the final solution.

10. Use of the lipid nanoparticles encapsulating specific miRNA as claimed in claim 1 in preparing a drug for treating nerve damage; Preferably, the lipid nanoparticles encapsulating the specific miRNA can promote the regeneration and repair of nerve damage; Further preferably, the lipid nanoparticles encapsulating the specific miRNA can promote behavioral recovery, muscle recovery and neuronal recovery at the injured site after spinal cord injury.

Images