Use of Siglec7 in promoting cell production and / or release of exosomes

By stably expressing Siglec7 in tumor cells, lentiviral vectors are used to increase exosome production, the problem of insufficient exosomes in tumor cells is solved, and the effect of tumor immunotherapy is enhanced.

CN119506221BActive Publication Date: 2025-08-19INST OF HEALTH & MEDICINE HEFEI COMPREHENSIVE NAT SCI CENT
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411682274.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-22
Publication Date
2025-08-19
Estimated Expiration
2044-11-22

AI Technical Summary

Technical Problem

The production and release of exosomes in tumor cells is small, resulting in insignificant effects on tumor immunotherapy and immunomodulation.

Method used

Lentiviral vector overexpressing the Siglec7 gene was constructed and tumor cells were transfected to stably express Siglec7, increasing exosome yield.

Benefits of technology

The exosome yield of unit cells and unit culture medium volume has been significantly improved, and the immunotherapy and immunomodulation effects of tumors have been enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005148646760000011
    Figure HDA0005148646760000011
  • Figure HDA0005148646760000012
    Figure HDA0005148646760000012
  • Figure HDA0005148646760000021
    Figure HDA0005148646760000021
Patent Text Reader

Abstract

The present invention relates to the field of cell engineering, and more specifically to the use of Siglec7 in the production and / or release of exosomes by tumor cells. The present invention constructs a lentiviral vector overexpressing the Siglec7 gene and transfects it into tumor cells, ultimately obtaining a tumor cell line stably expressing Siglec7. Extraction and testing demonstrate that this cell line significantly increases the exosome yield per cell and per culture medium volume, significantly improving exosome production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of cell engineering, and specifically relates to the use of Siglec7 in promoting cell production and / or release of exosomes. More specifically, it relates to the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cell production and / or release of exosomes. Background Art

[0002] Cancer is a life-threatening disease worldwide. It is the second leading cause of death globally, after cardiovascular disease. Cancer cells possess unique characteristics, including high proliferation rates, self-renewal abilities, and the ability to switch between different molecular pathways to develop drug resistance. Based on these properties, novel therapeutic approaches, including nucleic acid drugs and anticancer drugs, have been developed to target cancer cells and inhibit their progression.

[0003] Exosomes (EVs) are now widely present in all body fluids and tissues, including blood, urine, breast milk, amniotic fluid / synovium / ascites, saliva, and adipose tissue. As more types of extracellular vesicles are discovered, the definition of exosomes is constantly evolving. Exosomes can transfer exogenous substances such as proteins, mRNA, microRNAs (miRNAs), and lipids from donor cells to recipient cells. Therefore, these naturally occurring nanocarriers have been used for drug delivery. Compared with synthetic drug carriers, exosomes isolated from a patient's own cells have higher biocompatibility and lower toxicity. Exosomes can also penetrate tissues, diffuse into the blood, and even cross the blood-brain barrier (BBB). Exosome-mediated delivery bypasses the p-glycoprotein drug efflux system, potentially reducing drug resistance. Exosomes are also highly engineerable, with surface protein engineering conferring cell and tissue specificity. Summary of the Invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, the present invention provides the use of Siglec7 in the production and / or release of exosomes by tumor cells.

[0005] The present invention is accomplished based on the following findings of the inventors:

[0006] Currently, the number of exosomes produced and / or released by tumor cells is relatively small, and these small numbers of exosomes have little effect on tumor immunotherapy and immunoregulation. To overcome this problem, the inventors constructed a lentiviral vector that overexpresses the Siglec7 gene and transfected it into tumor cells, ultimately generating a tumor cell line that stably expresses Siglec7. This increased the expression of exosomes in tumor cells, thereby enhancing the efficacy of tumor immunotherapy and immunoregulation.

[0007] In a first aspect of the present invention, the present invention provides the use of Siglec7 in promoting cell production and / or release of exosomes. According to an embodiment of the present invention, stable expression of Siglec7 in cells can increase the exosome yield per unit cell and per unit culture medium volume, thereby increasing the production of exosomes.

[0008] In a second aspect of the present invention, the present invention provides a use of a reagent in preparing a kit. According to the use of an embodiment of the present invention, the reagent is used to regulate the expression or activity of Siglec7, and the kit is used to regulate the production and / or release of exosomes in cells.

[0009] In a third aspect, the present invention provides a use of an agent in the preparation of a medicament. According to an embodiment of the present invention, the agent is used to promote the expression or activity of Siglec7 in tumor cells, and the medicament is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0010] In a fourth aspect, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting the cells to be treated with an agent, wherein the agent is used to regulate the expression or activity of Siglec7. The method according to an embodiment of the present invention can increase the production and / or release of exosomes by tumor cells.

[0011] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0013] Figure 1 This is a schematic diagram of the structure of the basic carrier LV3 in Example 1 of the present invention.

[0014] Figure 2 Schematic diagram of the structure of the recombinant lentiviral vector in Example 1 of the present invention.

[0015] Figure 3 This is a light microscopic image (10X) of mouse colon cancer cells in Example 2 of the present invention.

[0016] Figure 4 This is a flow cytometry fluorescence image of LV3 lentivirus 293T cells in Example 2 of the present invention.

[0017] Figure 5 Schematic diagram of the exosome extraction process in Example 3 of the present invention.

[0018] Figure 6 This is the electron microscope image of Siglec7 EVs in Example 3 of the present invention.

[0019] Figure 7 This is the particle size analysis of Siglec7 EVs in Example 3 of the present invention.

[0020] Figure 8 This is a test of the number of exosome particles extracted in Example 3 of the present invention. A is the number of particles in the Control group at a 10-fold dilution, and B is the number of particles in the Siglec7 EVs group at a 20-fold dilution.

[0021] Figure 9 This is the number of particles in the Control group and Siglec7 EVs group in Example 3 of the present invention.

[0022] Figure 10 This is a Western blot analysis of the expression of exosomal Siglec7 protein in Example 3 of the present invention.

[0023] Figure 11 This is a fluorescence image of two types of exosomes taken up by mouse colon cancer cells in Example 3 of the present invention.

[0024] Figure 12 This is the effect of the two exosomes in Example 3 of the present invention on the proliferation of mouse colon cancer cells. DETAILED DESCRIPTION

[0025] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0026] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0027] In this document, the terms “contain”, “include” or “include” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.

[0028] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0029] The present invention proposes the use of Siglec7 in promoting cell production and / or release of exosomes, the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cell production and / or release of exosomes, which will be described in detail below.

[0030] Use of Siglec7 in promoting cell production and / or release of exosomes

[0031] In a first aspect of the present invention, the present invention provides the use of Siglec7 in promoting cell production and / or release of exosomes. According to an embodiment of the present invention, stable expression of Siglec7 in cells can increase the exosome yield per unit cell and per unit culture medium volume, thereby increasing the production of exosomes.

[0032] According to an embodiment of the present invention, the nucleotide sequence of Siglec7 is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and misplacing one or more bases in the sequence shown in SEQ ID NO: 1.

[0033] (SEQ ID NO: 1).

[0034] According to an embodiment of the present invention, the cells are tumor cells.

[0035] Use of reagents in preparing kits

[0036] In a second aspect of the present invention, the present invention provides a use of a reagent in preparing a kit. According to an embodiment of the present invention, the reagent is used to regulate the expression or activity of Siglec7, and the kit is used to regulate the production and / or release of exosomes in cells.

[0037] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of Siglec7, and the kit is used to promote the production and / or release of exosomes in cells.

[0038] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

[0039] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of Siglec7, and the kit is used to inhibit the production and / or release of exosomes in cells.

[0040] According to an embodiment of the present invention, the reagent includes siRNA for inhibiting Siglec7 expression.

[0041] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO: 2.

[0042] CAGAAGAGTAACCGGAAGGATTA (SEQ ID NO: 2).

[0043] Use of reagents in the preparation of drugs

[0044] In a third aspect, the present invention provides a use of an agent in the preparation of a medicament. According to an embodiment of the present invention, the agent is used to promote the expression or activity of Siglec7 in tumor cells, and the medicament is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

[0045] According to an embodiment of the present invention, the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

[0046] Methods for regulating cell production and / or release of exosomes

[0047] In a fourth aspect, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting the cells to be treated with an agent, wherein the agent is used to regulate the expression or activity of Siglec7. The method according to an embodiment of the present invention can increase the yield of exosomes produced and / or released by cells.

[0048] According to an embodiment of the present invention, the cells are tumor cells.

[0049] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of Siglec7, and the reagent includes at least one of a viral vector and a virus for overexpressing Siglec7.

[0050] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of Siglec7, and the reagent includes siRNA for inhibiting the expression of Siglec7.

[0051] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO: 2.

[0052] According to an embodiment of the present invention, the culture medium used for culturing the cells is serum-free 1640 culture medium.

[0053] According to an embodiment of the present invention, the method for producing and / or releasing exosomes is as follows: selecting P3 generation logarithmic growth phase mouse colon cancer cells transfected with a recombinant lentiviral vector, and when the cells grow to 70%-80%, continuing to culture in serum-free 1640 medium, ultracentrifuging, and obtaining exosomes.

[0054] The present invention uses the LV3 vector as a base vector to construct a lentiviral vector that overexpresses the Siglec7 gene, which is then transfected into tumor cells to obtain a cell line that stably expresses Siglec7. Exosome extraction and testing showed that this cell line significantly increased the exosome yield per unit cell and per unit culture medium volume, and thus increased exosome production. Furthermore, the present invention uses the GFP tag carried by the lentivirus to purify and isolate exosomes, which to some extent overcomes the shortcomings of traditional methods and promotes the scientific research and clinical level of tumor cell exosomes.

[0055] tumor cells

[0056] In a fifth aspect, the present invention provides a tumor cell. According to an embodiment of the present invention, the tumor cell overexpresses Siglec7. The tumor cell according to the embodiment of the present invention can increase the production of exosomes.

[0057] Among them, it needs to be explained that the Siglec7 protein was identified as a putative adhesion molecule that acts as a mediator of sialic acid-dependent cell binding. It preferentially binds to α-2,3- and α-2,6-linked sialic acids and interacts with disialogangliosides such as disialylgalactosyl globuloside, disialyllactotetraosylceramide, and disialylGalNAclactotetraosylceramide. The sialic acid recognition site of Siglec7 may be masked due to cis interactions with sialic acid on the same cell surface. In the immune response, it acts as an inhibitory receptor, inducing tyrosine phosphorylation upon ligand binding, and recruiting cytoplasmic phosphatases through its SH2 domain, thereby blocking signal transduction and inhibiting the cytotoxicity of natural killer cells. Siglec-7 may also play a role in hematopoiesis, inhibiting CD34 + It promotes the differentiation of myelomonocytic cell precursors toward the myelomonocytic lineage and blocks the proliferation of leukemic myeloid cells in vitro. Additionally, it interacts with PTPN6 / SHP-1 upon phosphorylation.

[0058] According to an embodiment of the present invention, the tumor cells are selected from at least one of colon cancer cells, breast cancer cells, luminal B breast malignant tumor cells and melanoma cells.

[0059] According to an embodiment of the present invention, the tumor cells are at least one of mouse colon cancer cells, mouse breast cancer cells, and mouse luminal B-type breast malignant tumor cells.

[0060] According to an embodiment of the present invention, the tumor cells are mouse colon cancer cells.

[0061] According to an embodiment of the present invention, the mouse colon cancer cells overexpressing Siglec7 are prepared by the following method: constructing a recombinant lentivirus overexpressing Siglec7 and transfecting the mouse colon cancer cells.

[0062] Specifically, the tumor cells overexpressing the Siglec7 gene of the present invention are prepared by the following method:

[0063] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-Siglec7 that overexpresses the Siglec7 gene was constructed. The recombinant lentivirus pLV3-Siglec7 was packaged by transfecting the 293T cell line and named LV3-Siglec7. The recombinant lentivirus LV3-Siglec7 was transfected into tumor cells to obtain a tumor cell line stably expressing Siglec7.

[0064] The present invention also provides a method for preparing the above-mentioned tumor cells overexpressing the Siglec7 gene, which is prepared by the following method:

[0065] Using the pLV3 vector as the basic vector, a recombinant plasmid pLV3-Siglec7 that overexpresses the Siglec7 gene was constructed. The recombinant lentivirus pLV3-Siglec7 was packaged by transfecting the 293T cell line and named LV3-Siglec7. The recombinant lentivirus LV3-Siglec7 was transfected into tumor cells to obtain a cell line stably expressing Siglec7.

[0066] According to an embodiment of the present invention, the Siglec7 gene is the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence obtained by deleting, replacing, inserting, inverting and misplacing one or more bases of the sequence shown in SEQ ID NO: 1.

[0067] According to an embodiment of the present invention, the lentivirus is LV3.

[0068] In the present invention, a recombinant lentivirus overexpressing the Siglec7 gene is constructed, named pLV3-Siglec7, and is transfected into tumor cells to screen and obtain tumor cell lines that highly express Siglec7.

[0069] The present invention uses the pLV3 vector as the base vector to construct a recombinant plasmid overexpressing the Siglec7 gene, pLV3-Siglec7, which was transfected into a 293T cell line to package a recombinant lentivirus, named LV3-Siglec7. The recombinant lentivirus LV3-Siglec7 was then transfected into tumor cells to obtain a cell line stably expressing Siglec7. Testing showed that this cell line significantly increased the exosome yield per unit cell and unit culture medium volume, significantly improving exosome production.

[0070] According to an embodiment of the present invention, the Siglec7 overexpression is achieved by at least one of the following methods: viral / non-viral vector-mediated gene / mRNA transfection technology, transposase or recombinase-mediated gene integration, and gene editing or transcriptional activation based on the CRISPR / CAS system.

[0071] According to an embodiment of the present invention, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection reagent-mediated transfection, virus-like particle VLP-mediated transfection, electroporation transfection, lentiviral vector gene delivery, adeno-associated virus vector gene delivery, adenoviral vector gene delivery and Sendai virus vector gene delivery.

[0072] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.

[0073] Example 1: Construction of Siglec7 lentivirus

[0074] According to the sequence information of Siglec7 gene (Gene ID: 999), the Siglec7 gene shown in SEQ ID NO: 2 was cloned and the expression of the gene was confirmed. Figure 1 The pLV3 shown was used as the basic vector to construct the recombinant vector pLV3-Siglec7 containing the Siglec7 gene, and the recombinant vector pLV3-Siglec7 was packaged by transfecting 293T cell lines to produce Figure 2 LV3-Siglec7 lentivirus as indicated.

[0075] Example 2: Tumor cells stably expressing Siglec7

[0076] The lentivirus LV3-Siglec7 constructed in Example 1 was transfected into mouse colon cancer cells (Cat. No. CL-0071 of Wuhan Punosai Life Science Technology Co., Ltd.) (virus infection multiplicity MOI value: 20-100) to obtain tumor cells overexpressing the Siglec7 gene. The cells were cultured in 1640 medium and their growth and Siglec7 expression were observed. The results are as follows: Figure 3 and Figure 4 As shown, the results show that the cell viability cultured in the present invention is greater than 90%, and the Siglec7 fluorescence expression is normal when detected by flow cytometry.

[0077] Example 3: Extraction and identification of tumor cell-derived exosomes

[0078] (1) Extraction of exosomes from tumor cells:

[0079] Tumor cells in the logarithmic growth phase of P3 (Control group) and tumor cells overexpressing Siglec7 constructed in Example 2 (Siglec7 EVs group) were selected for culture and exosomes were extracted.

[0080] The specific method is as follows: When the cell confluence reaches 70%-80%, wash the cells with PBS, select serum-free 1640 medium for 48 hours, and then extract exosomes by ultracentrifugation. Take 100mL of cell culture medium and centrifuge it at 1000g for 10 minutes to remove cell debris, then centrifuge it at 10000g for 30 minutes to remove apoptotic bodies, then collect all the supernatants through a 0.22μm filter membrane, and finally centrifuge it at 100000g for 70 minutes to discard the supernatant, resuspend the precipitate with 1mL PBS, and then centrifuge it at 100000g for 70 minutes to discard the supernatant, resuspend the PBS to obtain exosomes, and store them at -80℃ after aliquoting. The process diagram is as follows Figure 5 shown.

[0081] (2) Electron microscopy detection of tumor cell-derived exosomes:

[0082] The extracted exosomes were resuspended in 20-30 μL PBS, 10 μm was added to the transmission electron microscope copper grid and precipitated for 5 minutes, the floating liquid was aspirated with filter paper, 10 μm of phosphotungstic acid counterstain was added to the transmission electron microscope copper grid and precipitated for 5 minutes, the floating liquid was aspirated with filter paper, and the mixture was dried at room temperature and observed by the microscope. Figure 6 shown.

[0083] Figure 6 The electron microscopy image shows that the size of exosomes is about 50-150nm, and the exosomes are spherical in shape, indicating that there is no difference between the overexpressed Siglec7 exosomes and the control group, which is consistent with the structure of exosomes.

[0084] (3) Particle size analysis of tumor cell-derived exosomes:

[0085] The extracted exosomes were resuspended in 2 mL of PBS and placed in a Nano ZS90 Plus (Malvern, UK) for exosome size analysis. Figure 7 As shown, the particle size of exosomes detected is between 100-150nm, which corresponds to the size of exosomes detected by TEM and is consistent with the particle size range of exosomes.

[0086] (4) Detection of the number of exosome particles derived from tumor cells:

[0087] The extracted exosomes were resuspended in 2 mL of PBS and diluted 10-fold and 20-fold for the control and Siglec7 EVs groups, respectively, for nanoflow cytometry testing. The test showed that the particle count of the control group at a 10-fold dilution was 2.28E+9 particles / mL; the particle count of the Siglec7 EVs group at a 20-fold dilution could reach 3.34E+9 particles / mL. Figure 8 、 Figure 9 The results showed that the number of exosome particles extracted from tumor cells in the Siglec7 EVs group was significantly higher than that in the Control group.

[0088] (5) Western blot detection of tumor cell-derived exosomes:

[0089] Add protein lysis buffer to the extracted exosome precipitate and place on ice for 10-20 minutes, shaking 4-6 times for 20-30 seconds each time. Then centrifuge at 11000 rpm at 4°C for 3-5 minutes, transfer the supernatant to a new centrifuge tube, and perform Western blot to detect Siglec7 protein expression. The results are as follows: Figure 10 The results showed that the expression of Siglec7 protein could be detected in the Siglec7 EVs group extracted by ultracentrifugation.

[0090] (6) Cellular uptake of exosomes:

[0091] Prepare the exosome fluorescent material Dil (Biyuntian Biotechnology Co., Ltd., catalog number: C1036) and mix it with the exosomes extracted above to allow the exosomes to be dyed. Then wash away the excess dye. Add a small amount of exosomes containing Dil fluorescent dye to the cultured tumor cells and continue to culture for 1-4 hours. Aspirate the supernatant and wash with PBS 2-3 times. Detect under an inverted fluorescence microscope. The results are as follows: Figure 11 As shown, obvious red fluorescence signals of Dil can be observed in exosomes overexpressing Siglec7 compared with the control group.

[0092] (7) Effects of exosomes on tumor cell proliferation:

[0093] Control and Siglec7 EVs were used to culture mouse colon cancer cells, and the proliferation of mouse colon cancer cells was detected by CCK8 (Biyuntian Biotechnology Co., Ltd., C0037). The results are as follows Figure 12 The results showed that Siglec7EVs had an inhibitory effect on cancer cells. After 96 hours of co-culture, the survival rate of cancer cells in the Siglec7EVs group was only about 60%.

[0094] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0095] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. Use of overexpression of Siglec7 in promoting the production and / or release of exosomes by tumor cells.

2. The use according to claim 1, characterized in that The nucleotide sequence of Siglec7 is shown in SEQ ID NO:

1.

3. Use of a reagent in preparing a kit, wherein the reagent is used to promote the expression or activity of Siglec7, and the kit is used to promote the production and / or release of exosomes in cells.

4. The use according to claim 3, wherein the reagent comprises a viral vector for overexpressing Siglec7.

5. Use of the reagent in the preparation of a drug, wherein the reagent is used to promote the expression or activity of Siglec7 in tumor cells, and the drug is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.

6. The use according to claim 5, characterized in that The reagents include a viral vector for overexpressing Siglec7.

7. A method for promoting the production and / or release of exosomes by tumor cells, characterized in that: include: The tumor cells to be treated are contacted with an agent, wherein the agent is used to promote the expression or activity of Siglec7. The method according to claim 7 , wherein the reagent comprises a viral vector for overexpressing Siglec7.

Citation Information

Patent Citations

  • Nucleic acid modified biological cells with amplification dependent gene expression

    CN119317714A