DNA nanosponges and their application in targeted therapy for ovarian cancer

Abstract

This invention discloses a DNA nanosponge system and its application in targeted therapy for ovarian cancer. The DNA nanosponge system loads zinc oxide nanoparticles with oxygen vacancies and doxorubicin onto DNA nanosponges. The DNA nanosponges include a DOX drug-carrying region, a MUC1 aptamer, and an HIF-1a DNAzyme. The DNA nanosponge system can achieve targeted delivery, metabolic reprogramming, and ferroptosis induction to enhance the chemosensitization of ovarian cancer and improve the efficacy of targeted therapy for ovarian cancer.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a DNA nanosponge system and its application in targeted therapy for ovarian cancer. Background Technology

[0002] Ovarian cancer chemotherapy faces two core challenges: insufficient targeting and multidrug resistance (MDR). Current technologies, particularly traditional chemotherapy drugs, lack specific targeting, leading to damage to normal tissues and severe side effects (such as myocardial damage, hepatotoxicity, and nephrotoxicity). Furthermore, the hypoxic characteristics of the tumor microenvironment (TME) exacerbate chemotherapy resistance by inducing glycolysis (the Warburg effect), upregulation of the HIF-1α signaling pathway, and the expression of drug efflux proteins (such as ABCB-1). Although nanomaterials based on metal nanoparticles (such as ZnO) and metal-organic frameworks (MOFs) can improve hypoxia by generating reactive oxygen species (ROS) through the Fenton reaction, their synthesis is complex, ROS generation depends on external stimuli (such as ultrasound or light), and they lack targeting, easily causing toxicity to normal cells. Existing nucleic acid therapies (such as siRNA and DNAzymes) can regulate gene expression, but single-stranded nucleic acids are easily degraded and rely on vector delivery, resulting in high costs.

[0003] Therefore, there is an urgent need for a novel chemotherapy sensitization system that is highly targeted, stable, and capable of multidimensionally regulating TME and metabolic signals. Summary of the Invention

[0004] This invention provides a DNA nanosponges system that enhances the chemosensitivity of ovarian cancer through targeted delivery, metabolic reprogramming, and ferroptosis induction, thereby improving the efficacy of targeted therapy for ovarian cancer.

[0005] In view of this, the solution of the present invention is as follows:

[0006] The first aspect of the present invention is to provide a DNA nanosponge system obtained by rolling circle amplification of a circular DNA substrate and loading doxorubicin and zinc oxide nanoparticles containing oxygen vacancies; wherein the circular DNA substrate is amplified using a single-stranded DNA template, the single-stranded DNA containing a drug-loaded region and nucleotide sequences targeting the MUC1 aptamer region and the DNAzyme region targeting HIF-1a.

[0007] Furthermore, the nucleotide sequence of the circular DNA substrate after rolling circle amplification is shown in SEQ ID NO: 3.

[0008] Furthermore, the nucleotide sequence of the single-stranded DNA includes a drug-carrying region of polyT, the nucleotide sequence of the DNAzyme region targeting HIF-1a is shown in SEQ ID NO: 4, and the nucleotide sequence of the MUC1 aptamer region is shown in SEQ ID NO: 5.

[0009] Furthermore, the nucleotide sequence of the single-stranded DNA is shown in SEQ ID NO: 1.

[0010] Further, the nucleotide sequences of the amplification primers for the single-stranded DNA and / or the primers for rolling circle amplification are shown in SEQ ID NO: 2.

[0011] Furthermore, the DOX loading process uses double-stranded DNA rich in GC sequences and contains a polyA region that is complementary to the drug-loading region of the polyT region of the single-stranded DNA.

[0012] Preferably, the double-stranded DNA is constructed based on the nucleotide sequence shown in SEQ ID NO: 6.

[0013] Furthermore, the zinc oxide nanoparticles containing oxygen vacancies are obtained by calcining two-dimensional zinc metal-organic framework materials to obtain zinc oxide, followed by reaction with thiourea at 300-500℃ for 1-3 hours and then cooling.

[0014] Preferably, during the loading process, the concentration of the zinc oxide nanoparticles containing oxygen vacancies is 50-400 ug / ml.

[0015] Furthermore, the rolling circle amplification time is 1-10 hours.

[0016] A second aspect of the invention is to provide a pharmaceutical composition comprising the DNA nanosponge system described in the first aspect, and a pharmaceutically acceptable carrier.

[0017] A third aspect of the present invention is to propose the application of the DNA nanosponges system described in the first aspect in the preparation of drugs for treating ovarian cancer.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The DNA nanosponge system provided by this invention loads zinc oxide nanoparticles (ZnOov) with oxygen-containing vacancies and doxorubicin (DOX) onto DNA nanosponges. The DNA nanosponges include a MUC1 aptamer, an HIF-1a DNAzyme, and a DOX drug-loading region; it has the following effects through the following mechanism:

[0020] Targeted delivery: It can specifically recognize ovarian cancer cells through the MUC1 aptamer, thereby improving drug uptake efficiency;

[0021] Microenvironment regulation: Leveraging ZnOov to catalyze the production of O2 from H2O2, thus alleviating TME hypoxia; Zn 2+It releases and activates DNAzyme, inhibits the HIF-1a signaling pathway, and reduces VEGF and ABCB-1 expression;

[0022] Metabolic reprogramming and ferroptosis: Blocking the Warburg effect, enhancing mitochondrial respiration, and increasing ROS levels; combined with the catalytic effect of ZnOov, disrupting redox balance, and inducing lipid peroxidation and ferroptosis;

[0023] Controlled drug release: In the acidic environment of lysosomes, DNA nanosponges disintegrate and release doxorubicin and DNAzyme, achieving synergistic effects of chemotherapy and gene regulation. Attached Figure Description

[0024] Figure 1 This is a schematic diagram illustrating the construction and synthesis process of the DNA nanosponges system described in this invention.

[0025] Figure 2 This is a schematic diagram of the synthesis process of ZnOov as described in this invention.

[0026] Figure 3 This is a SEM image of ZnOov obtained in Example 1 of the present invention.

[0027] Figure 4 The X-ray diffraction pattern of ZnOov prepared in Example 1 of this invention is shown.

[0028] Figure 5 The results of electron paramagnetic resonance and X-ray photoelectron spectroscopy analysis of ZnOov prepared in Example 1 of this invention are shown.

[0029] Figure 6 This is the result of optimizing the system concentration parameters in Embodiment 2 of the present invention.

[0030] Figure 7 This is the analysis result of the response of SKOV3 and A2780 to DOX after system intervention in Embodiment 3 of the present invention.

[0031] Figure 8 The results show the relative expression levels of HIF-1a(a), VEGF(b), and ABCB-1(c) mRNA in cells after intervention with the system and its precursors in Example 3 of this invention.

[0032] Figure 9 This is the result of the decrease in the expression level of multiple genes after systematic intervention in Example 3 of the present invention.

[0033] Figure 10 This is a comparison of metabolite levels before and after cell intervention in Example 3 of the present invention.

[0034] Figure 11 This is a comparison of metabolite levels before and after cell intervention in Example 3 of the present invention.

[0035] Figure 12 This describes the changes in intracellular reactive oxygen species levels after the system and its intermediate products intervened in cells in Example 3 of the present invention. Detailed Implementation

[0036] The technical solution of the present invention will now be clearly and completely described in conjunction with preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0037] In one embodiment, a multifunctional DNA nanosponge system (ZnOov@DS-DOX) is proposed to achieve chemosensitization of ovarian cancer through targeted delivery, metabolic reprogramming, and ferroptosis induction. The DNA nanosponge system is obtained by rolling circle amplification of a circular DNA substrate and loading it with DOX and zinc oxide nanoparticles containing oxygen vacancies; the circular DNA substrate is amplified using single-stranded DNA as a template, and the single-stranded DNA contains nucleotide sequences targeting MUC1 and DNAzyme regions targeting HIF-1α. The specific technical solution is as follows:

[0038] 1. Structural Design:

[0039] Oxygen-Vacant Zinc Oxide Nanoparticles (ZnOov): A novel synthesis of 2D zinc oxide nanoparticles loaded with oxygen vacancies was achieved. Small-sized ZnO nanoparticles with oxygen vacancy defects were synthesized via thiourea treatment using 2D Zn-MOF. These nanoparticles can catalyze the production of O2 from H2O2 in the tumor microenvironment, alleviating hypoxia and releasing Zn. 2+ Activate DNAzyme.

[0040] DNA nanosponges (DS): constructed using rolling circle amplification (RCA) technology, containing the following functional modules:

[0041] MUC1 aptamer: specifically targets the ovarian cancer cell surface marker MUC1.

[0042] HIF-1a DNAzyme: in Zn 2+ It activates the cleavage of HIF-1a mRNA and inhibits downstream key glycolytic enzymes (PKM2, LDHA) and drug efflux protein ABCB-1.

[0043] DOX loading sites: By binding to DOX in GC sequence enriched regions, precise drug release can be achieved.

[0044] ZnOov nanoparticles combine with DNA nanosponges to form ZnOov@DS-DOX.

[0045] The construction and synthesis process of the DNA nanosponges is as follows: Figure 1 As shown.

[0046] 2. Working principle:

[0047] Targeted delivery: By specifically recognizing ovarian cancer cells through the MUCl aptamer, drug uptake efficiency is improved (the uptake rate in cancer cells is 14.9 times higher than that in normal cells).

[0048] Microenvironment regulation: ZnOov catalyzes the production of O2 from H2O2, alleviating TME hypoxia; Zn 2+ It releases and activates DNAzyme, inhibits the HIF-1a signaling pathway, and reduces the expression of VEGF and ABCB-1.

[0049] Metabolic reprogramming and ferroptosis: Blocking the Warburg effect, enhancing mitochondrial respiration, and increasing ROS levels; combined with the catalytic effect of ZnOov, disrupting redox balance, and inducing lipid peroxidation and ferroptosis.

[0050] Controlled drug release: In the acidic environment of lysosomes, DNA nanosponges disintegrate and release DOX and DNAzyme, achieving synergistic effects of chemotherapy and gene regulation (IC50 value reduced by 72.7%).

[0051] In a preferred embodiment, the synthesis process of ZnOov is as follows: Figure 2 As shown, the specific synthesis process of ZnOov is as follows:

[0052] 1) Zinc nitrate hexahydrate, pyridine, and polyvinylpyrrolidone (PVP) were dissolved in a mixed solvent (N,N-dimethylformamide (DMF) to anhydrous ethanol, volume ratio 3:1). Tetra(4-carboxyphenyl)porphyrin (TCPP) solution was then added to the solution. The mixture was reacted at 80°C for 24 hours. After the reaction, the product was collected by centrifugation and dried to obtain a two-dimensional zinc metal-organic framework material (2D-Zn MOF).

[0053] 2) The obtained two-dimensional zinc metal-organic framework material was calcined at 350℃ for 2 hours, and the sample was collected after natural cooling to obtain zinc oxide nanoparticles (ZnO);

[0054] 3) The zinc oxide nanoparticles obtained in step 2) are thoroughly mixed with an equal amount of thiourea and heated at 300-500℃ for 1-3 hours under an argon atmosphere. After cooling, zinc oxide nanoparticles containing oxygen vacancies (ZnOov) are finally obtained.

[0055] Example 1: Synthesis of ZnOov

[0056] 1. The synthesis process of ZnOov is as follows: Figure 2As shown, the specific steps include:

[0057] 1) Dissolve 9 mg of zinc nitrate hexahydrate, 2.4 mg of pyridine and 60 mg of polyvinylpyrrolidone (PVP) in a mixed solvent (N,N-dimethylformamide to anhydrous ethanol volume ratio of 3:1);

[0058] 2) Prepare a solution by adding 13.2 mg of tetra(4-carboxyphenyl)porphyrin (TCPP) to 12 ml of mixed solvent (DMF: anhydrous ethanol = 3:1), add it to the solution obtained in step 1), stir with a magnetic stirrer for 30 min, and react at 80 °C for 24 hours.

[0059] 3) After the reaction was completed, the product was collected by centrifugation at 10000 r / min for 10 min and dried to obtain a two-dimensional zinc metal-organic framework material (2D-Zn MOF).

[0060] 4) The obtained two-dimensional zinc metal-organic framework material was placed in a muffle furnace and calcined at 350°C for 2 hours at a heating rate of 2°C / min. After natural cooling, the sample was collected to obtain (ZnO). It was then thoroughly mixed with an equal amount of thiourea and heated at 400°C for 2 hours under an argon atmosphere. After natural cooling, zinc oxide nanoparticles (ZnOov) containing oxygen vacancies were finally obtained.

[0061] 2. Characterization of ZnOov

[0062] 1) Observe ZnOov and its precursors using electron microscopy (SEM images), such as... Figure 3 As shown, Figure 3 In the image, (a) is an electron microscope image of 2D-Zn MOF; (b) is an electron microscope image of ZnO, the corresponding oxidation product formed by Zn MOF at high temperature; and (c) is an electron microscope image of ZnOov.

[0063] 2) ZnOov was analyzed by X-ray diffraction, and the analysis spectrum is as follows: Figure 4 As shown, the standard peak chromatogram number corresponding to peaks II and III is 99-0111, indicating that the main component of ZnOov is zinc oxide.

[0064] 3) The results of electron paramagnetic resonance and X-ray photoelectron spectroscopy analysis are as follows: Figure 5 As shown. Figure 5 In the images, (a) electron paramagnetic resonance g-factor analysis (g-factor 2.004); (b) X-ray photoelectron spectroscopy (XPS) spectra, with characteristic peaks of S, C, N, O, and Zn analyzed using Avantage software; and (c) XPS analysis of the O 1s peak for oxygen vacancies. The results indicate that the prepared ZnOov contains oxygen vacancies.

[0065] Example 2: Synthesis of DNA Nanosponges

[0066] 1) Synthesis of circular DNA substrates

[0067] The synthesis of circular DNA substrates uses phosphorylated single-stranded DNA (ssDNA) as raw material, adds primers, and ligates them using T4 DNA ligase.

[0068] The ssDNA sequence is: AAAAAAAAAGCTCAACTACGTTACCTAACAGGTAAC GCTTCAACAGAGAGAGAGAGAGAGACCAGGGTATCCAAAGGATCAACTGC AAAAAAAAAAACTTCTTCGACCGGCTCGGAATTCTTTAC (SEQ ID NO: 1), where the 5' end is labeled with a phosphate group.

[0069] The primer sequence was: AACGTTGAGCTTTTTTTTTGTAAAGAATTCCGAGC CGGT (SEQ ID NO: 2). The ratio of primer to ssDNA template was 2:1. The primers were mixed in T4 DNA ligase buffer, heated to 85°C, annealed at 45°C, and then incubated at 37°C for 2 hours. T4 ligase was then added and the reaction proceeded overnight to form a circular DNA substrate.

[0070] 2) Subsequently, using the circular DNA substrate as a template, primers, dNTPs and Phi29 DNA polymerase were added, and the reaction was carried out at 30°C for 6-10 hours using rolling circle amplification (RCA) technology to finally prepare DNA nanosponges.

[0071] The corresponding sequence of the circular DNA substrate template after RCA amplification is as follows:

[0072] GTAAAGAATTCCGAGCCGGTCGAAGAAGTTTTTTTTTTTGCAGTTG ATCCTTTGGATACCCTGGTCTCTCTCTCTCTCTCTGTTGAAGCGTTACCTGTT AGGTAACGTAGTTGAGCTTTTTTTTT (SEQ ID NO: 3). The polyT region binds to the polyA region of the drug-loaded scaffold. GTAAAGAATTCCGAGCCGGTCGAAGAAGTTTTT (SEQ ID NO: 4) is a DNA-zyme region targeting HIF-1α. GCAGTTGATCCTTTGGATACCCTGG (SEQ ID NO: 5) is the MUC1 aptamer region.

[0073] 3) Using GC-rich DNA double-stranded DNA loaded with DOX, the DNA double-stranded scaffold sequence was constructed as follows: AAAAAAAAAGCGCGCGCGCGCGCGC (SEQ ID NO: 6). The GC portion of the sequence is a palindromic structure, which can bind together to form double-stranded DNA. The polyA portion can complementarily pair with the polyT portion within the DNA nanosponges, achieving effective loading of DOX and DNA nanosponges. After annealing the scaffold sequence, it was placed at 37°C and allowed to stand. Then, DOX solution was added, and the mixture was incubated overnight on a shaker at 4°C.

[0074] Example 3: RCA Synthesis of ZnOov@DS-DOX

[0075] This embodiment loads ZnOov via rolling circle amplification. The preferred ZnOov concentration process involves setting a series of concentration gradients from low to high (0-400 ug / ml), evaluating the changes in cell viability as the concentration increases, and selecting the lowest concentration that reduces cell viability, which is 400 ug / ml. Figure 6 a).

[0076] Optimal RCA reaction time for DNA nanosponge synthesis: RCA reaction times were set from short to long (0 / 4 / 6 / 8 / 10 h), and changes in cell viability with increasing concentration were evaluated. Figure 6 As shown in b, when the dilution factor is controlled at 20 times, the product of RCA reaction time of 0-8 hours has no significant effect on cell viability, while when RCA reaction reaches 10 hours, a preliminary decrease in cell viability occurs, that is, the reaction time of 10 hours is the shortest onset time.

[0077] Example 4: The synergistic effect of ZnOov@DS-DOX on chemotherapy and gene regulation

[0078] 1) After systemic intervention, the IC50 value of ovarian cancer cells for DOX decreased.

[0079] We set up a series of DOX concentration gradients to compare the inhibitory effects of using free DOX and the DOX on cell viability in our system. Figure 7 As shown, in ovarian cancer cells SKOV3 and A2780, the IC50 value decreased after systemic intervention compared to the traditional free DOX group.

[0080] 2) The expression level of HIF-1a-related genes decreased after systemic intervention.

[0081] The expression levels of HIF-1a and its downstream inhibitors ABCB-1 and VEGF in ovarian cancer cells after systemic intervention were assessed using RT-PCR. Figure 8 As shown, the expression of the three genes mentioned above decreased after systemic intervention, and the complete ZnOov@DS-DOX system was more effective than the intermediate.

[0082] 3) After systemic intervention, the expression levels of glycolysis-related genes PKM2 and LDHA decreased, and the expression level of GPX-4, a gene involved in cellular redox reactions, decreased. Furthermore, the complete ZnOov@DS-DOX system showed better inhibitory effects than the intermediate. Figure 9 ).

[0083] 4) After systemic intervention, the level of glycolytic products in ovarian cancer cells decreased, while the level of tricarboxylic acid cycle products increased. Figure 10 and Figure 11 ).

[0084] 5) After systemic intervention, the level of reactive oxygen species in ovarian cancer cells increased significantly, such as... Figure 12 As shown, the DCFH-DA probe was used to detect reactive oxygen species (ROS). It was found that after intervention with the complete ZnOov@DS-DOX system, the level of ROS in cells increased, and the increase was greater than that in other intermediate groups.

[0085] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A DNA nanosponge system characterized in that, The doxorubicin-loaded, oxygen vacancy-containing zinc oxide nanoparticles are obtained by rolling circle amplification of a circular DNA substrate and loading doxorubicin, oxygen vacancy-containing zinc oxide nanoparticles; the circular DNA substrate is obtained by amplification with a single-stranded DNA as a template, the single-stranded DNA comprising a drug-loading region, and a nucleotide sequence of a MUC1 aptamer targeting region, a DNAzyme region targeting HIF-1a; The oxygen vacancy-containing zinc oxide nanoparticles are obtained by calcining a two-dimensional zinc metal organic framework material to obtain zinc oxide, and then mixing with thiourea and reacting at 300-500 DEG C for 1-3 h to obtain the oxygen vacancy-containing zinc oxide nanoparticles after cooling; The nucleotide sequence of the single-stranded DNA is shown in SEQ ID NO: 1; The nucleotide sequence of the amplification primer for the single-stranded DNA and the primer for rolling circle amplification is shown in SEQ ID NO: 2; The doxorubicin loading process uses a double-stranded DNA rich in GC sequences, which is constructed based on the nucleotide sequence shown in SEQ ID NO:

6.

2. The DNA nanosponge system of claim 1, wherein, The concentration of the oxygen vacancy-containing zinc oxide nanoparticles in the loading process is 50-400 ug / ml.

3. The DNA nanosponge system of claim 1, wherein, The rolling circle amplification time is 1-10 h.

4. A pharmaceutical composition, characterized by, The DNA nanosponge system of any one of claims 1-3, and a pharmaceutically acceptable carrier.

5. Use of the DNA nanosponge system of any one of claims 1-3 in the preparation of a drug for treating ovarian cancer.

Images