A multi-effect protein mel3 and application thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a pleiotropic protein MEL3 and application thereof. The amino acid sequence of the pleiotropic protein MEL3 or homologous protein thereof provided by the application has the following general formula: X1GAX2LX3VLX4GLX5ALISWIKRKRX6; X1 is M or L; X2 is one of V, SI and AI; X3 is one of K, T, KI and KR; X4 is one of KK, TT, SS and VK; X5 is one of P, K, A and T; and X6 is QQ or no amino acid. The pleiotropic protein MEL3 or homologous protein thereof provided by the application has broad-spectrum antibacterial activity, and can achieve the effects of anti-inflammation and anti-virus, thereby providing a new idea for preparing anti-pathogenic microorganism or anti-inflammation products.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a pleiotropic protein MEL3 and its applications. Background Technology

[0002] In the traditional field of antibacterial agents, common antibacterial components include antibiotics and inorganic salts, such as penicillin, alcohol, iodine, and silver ions. The antibacterial mechanism of antibiotics mainly utilizes biochemical means to interfere with one or more metabolic functions of bacteria, specifically by inhibiting bacterial cell wall synthesis, increasing cell membrane permeability, interfering with protein synthesis, and hindering nucleic acid replication and transcription. However, antibiotics have many drawbacks, such as causing adverse reactions, disrupting the body's normal flora balance, and leading to increased bacterial resistance. The mechanism of action of silver ion-based antibacterial agents mainly includes interfering with cell wall synthesis, damaging cell membranes, inhibiting protein synthesis, and interfering with nucleic acid synthesis. However, silver ion-based antibacterial agents also have drawbacks: after absorption by the human body, they may accumulate in liver cells, leading to liver damage; silver-based antibacterial agents are prone to discoloration, are difficult to manufacture, and have complex application processes in materials; their antifungal and antifungal effects are poor, and they easily cause pigmentation on the skin surface. In comparison, biological defense proteins are an ideal alternative to antibiotics in the future. Biological defense proteins are important components of the immune system in animals and plants, possessing wide distribution, broad antibacterial spectrum, and immune-enhancing effects. Their antibacterial mechanisms differ from traditional antibiotics, and they are less likely to induce drug-resistant strains during use, thus being regarded as antibiotic alternatives with great potential and application prospects.

[0003] In the field of antiviral therapy, biodefense proteins exhibit significant advantages. Their mechanisms of action are diverse: they can directly recognize and bind to viruses, preventing viral adsorption and invasion; they can interfere with viral replication; and they can regulate immune responses, enhancing the body's antiviral immune response. They possess broad-spectrum antiviral activity, inhibiting viruses from multiple viral families. Furthermore, because they act on conserved viral structures or key antiviral pathways, they remain effective even when viruses mutate. They are characterized by low toxicity and side effects, minimal impact on host cells, reduced interference with normal physiological functions, and low immunogenicity, making them less likely to trigger strong immune responses in vivo, thus facilitating long-term efficacy. Simultaneously, biodefense proteins are less prone to drug resistance; their multi-target action makes it difficult for viruses to evade through a few gene mutations, and the complex defense network formed by their synergistic effects with other immune components makes it difficult for viruses to break through, reducing the likelihood of drug resistance.

[0004] Biological defense proteins are composed of more than twenty amino acids and possess excellent physicochemical properties, including good water solubility, stability, colorlessness, odorlessness, and resistance to acids, alkalis, and high temperatures. They have shown effectiveness in both antibacterial and antiviral applications. Patent CN114262363B provides a biological defense protein KY23, which modifies the amino acid sequence of a natural bioactive peptide to reduce its hydrophobicity, increase its charge, and improve its stability, thus providing a biological defense protein with low cytotoxicity and strong bactericidal activity, showing promising market prospects. Patent CN117024604B provides a recombinant protein with high antibacterial and antiviral activity, showing good application prospects. However, the biological defense proteins of the above inventions only exhibit antibacterial activity against specific strains, resulting in a narrow antibacterial spectrum.

[0005] Therefore, providing a multifunctional protein, MEL3, or its homologs that possesses broad-spectrum antibacterial activity while also exhibiting anti-inflammatory and antiviral effects, is a top priority in current research. Summary of the Invention

[0006] To address the aforementioned shortcomings, this invention provides a pleiotropic protein MEL3 and its applications. The amino acid sequence of the pleiotropic protein MEL3 or its homologs provided by this invention has the following general formula: X1GAX2LX3VLX4GLX5ALISWIKRKRX6; where X1 is M or L; X2 is one of V, SI, and AI; X3 is one of K, T, KI, and KR; X4 is one of KK, TT, SS, and VK; X5 is one of P, K, A, and T; and X6 is QQ or no amino acid. The pleiotropic protein MEL3 provided by this invention possesses broad-spectrum antibacterial activity and can also achieve anti-inflammatory and antiviral effects, providing a new approach for the preparation of antimicrobial or anti-inflammatory products.

[0007] The meanings of the letters for amino acids in this invention are as follows:

[0008] A represents alanine; C represents cysteine; D represents aspartic acid; E represents glutamic acid; F represents phenylalanine; G represents glycine; H represents histidine; I represents isoleucine; K represents lysine; L represents leucine; M represents methionine; N represents asparagine; P represents proline; Q represents glutamine; R represents arginine; S represents serine; T represents threonine; V represents valine; W represents tryptophan; Y represents tyrosine.

[0009] In this invention, "codon degeneracy" refers to the phenomenon that the same amino acid has two or more codons. In particular, the degeneracy of cytosine and uracil, or guanine and adenine, at the third position of the codon is often equivalent.

[0010] In this invention, an "expression vector" refers to a vector constructed by inserting nucleic acid molecules containing the desired protein into a vector backbone, thereby enabling the expression of that protein. Typically, the vector backbone is a plasmid, but other forms of vector backbones that serve the same purpose can also be used. The "expression vector" can be used to transfect cells and express proteins through the cells.

[0011] In this invention, "genetically engineered cell" refers to a cell modified through genetic engineering methods, such as plasmid transformation or cell fusion.

[0012] In this invention, "Gram-negative bacteria" and "Gram-positive bacteria" refer to bacteria stained with crystal violet solution and iodine solution, then decolorized with alcohol, and finally stained with diluted fuchsin solution. After this treatment, bacteria stained purple are Gram-positive bacteria, and those stained red are Gram-negative bacteria.

[0013] The technical solution of the present invention includes:

[0014] In a first aspect, the present invention provides a pleiotropic protein MEL3 or its homologous protein, wherein the amino acid sequence of the pleiotropic protein MEL3 or its homologous protein has the following general formula:

[0015] X1GAX2LX3VLX4GLX5ALISWIKRKRX6;

[0016] X1 is M or L; X2 is one of V, SI, and AI; X3 is one of K, T, KI, and KR; X4 is one of KK, TT, SS, and VK; X5 is one of P, K, A, and T; and X6 is QQ or has no amino acids.

[0017] Specifically, the pleiotropic protein MEL3 or its homologous protein comprises an amino acid sequence as shown in any one of SEQ ID NO. 1-20; or comprises a partial segment of any one or more of the amino acid sequences shown in SEQ ID NO. 1-20; or a sequence having more than 30% homology with any one of the amino acid sequences in SEQ ID NO. 1-20.

[0018] More specifically, the homologous proteins include pleiotropic proteins MEL1, MEL2, MEL4, MEL5, MEL6, MEL7, MEL8, MEL9, MEL10, MEL11, MEL12, MEL13, MEL14, MEL15, MEL16, MEL17, MEL18, MEL19, and MEL20.

[0019] Preferably, the pleiotropic protein MEL1 has the amino acid sequence shown in SED ID NO.1.

[0020] SEQ ID NO. 1: MGAVLKVLKKGLPALISWIKRKR.

[0021] Preferably, the pleiotropic protein MEL2 has an amino acid sequence as shown in SED ID NO.2.

[0022] SEQ ID NO. 2: LGAVLKVLTTGLPALISKIKRKR.

[0023] Preferably, the pleiotropic protein MEL3 has an amino acid sequence as shown in SED ID NO.3.

[0024] SEQ ID NO. 3: MGAVLKVLTTGLPALISWIKRKR.

[0025] Preferably, the pleiotropic protein MEL4 has an amino acid sequence as shown in SED ID NO.4.

[0026] SEQ ID NO.4: MGAVLKVLTTGLKALISWIKRKR.

[0027] Preferably, the pleiotropic protein MEL5 has an amino acid sequence as shown in SED ID NO.5.

[0028] SEQ ID NO. 5: LGAVLTVLKKGLPALISWIKRKRQQ.

[0029] Preferably, the pleiotropic protein MEL6 has an amino acid sequence as shown in SED ID NO. 6.

[0030] SEQ ID NO.6: MGAVLKVLSSGLAALISWIKRKR.

[0031] Preferably, the pleiotropic protein MEL7 has an amino acid sequence as shown in SED ID NO.7.

[0032] SEQ ID NO.7: LGAVLKVLKKGLPALISWIKRKR.

[0033] Preferably, the pleiotropic protein MEL8 has an amino acid sequence as shown in SED ID NO.8.

[0034] SEQ ID NO. 8: LGAVLKVLTTGLAALISKIKRKRQQ.

[0035] Preferably, the pleiotropic protein MEL9 has an amino acid sequence as shown in SED ID NO.9.

[0036] SEQ ID NO.9: MGAVLTVLTTGLAALISWIKRKR.

[0037] Preferably, the pleiotropic protein MEL10 has the amino acid sequence shown in SED ID NO.10.

[0038] SEQ ID NO. 10: MGAVLTVLSSGLPALISWIKRKR.

[0039] Preferably, the pleiotropic protein MEL11 has the amino acid sequence shown in SED ID NO.11.

[0040] SEQ ID NO. 11: LGAVLTVLSSGLKALISWIKRKR.

[0041] Preferably, the pleiotropic protein MEL12 has the amino acid sequence shown in SED ID NO.12.

[0042] SEQ ID NO. 12: LGAVLTVLSSGLAALISWIKRKR.

[0043] Preferably, the pleiotropic protein MEL13 has the amino acid sequence shown in SED ID NO.13.

[0044] SEQ ID NO. 13: LGAVLKVLKKGLAALISWIKRKR.

[0045] Preferably, the pleiotropic protein MEL14 has the amino acid sequence shown in SED ID NO.14.

[0046] SEQ ID NO. 14: MGASILKIVLVKGLTALISWIKRKR.

[0047] Preferably, the pleiotropic protein MEL15 has the amino acid sequence shown in SED ID NO.15.

[0048] SEQ ID NO. 15: MGASILKRVLKKGLTALISWIKRKR.

[0049] Preferably, the pleiotropic protein MEL16 has the amino acid sequence shown in SED ID NO.16.

[0050] SEQ ID NO. 16: MGASILKVLKKGLPALISWIKRKR.

[0051] Preferably, the pleiotropic protein MEL17 has the amino acid sequence shown in SED ID NO.17.

[0052] SEQ ID NO. 17: MGAAILTVLVKGLTALISWIKRKR.

[0053] Preferably, the pleiotropic protein MEL18 has the amino acid sequence shown in SED ID NO.18.

[0054] SEQ ID NO. 18: LGASILKRVLSSGLAALISWIKRKR.

[0055] Preferably, the pleiotropic protein MEL19 has the amino acid sequence shown in SED ID NO.19.

[0056] SEQ ID NO. 19: LGAVLKRVLVKGLAALISWIKRKR.

[0057] Preferably, the pleiotropic protein MEL20 has the amino acid sequence shown in SED ID NO.20.

[0058] SEQ ID NO. 20: MGAAILTVLTTGLPALISWIKRKRQQ.

[0059] Secondly, the present invention provides a nucleic acid molecule that encodes the aforementioned pleiotropic protein MEL3 or its homologous protein.

[0060] Specifically, the nucleic acid molecule encodes the pleiotropic protein MEL3.

[0061] Preferably, the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO. 21; or a portion of a nucleotide sequence as shown in SEQ ID NO. 21; or a nucleotide sequence after base substitutions of SEQ ID NO. 21 according to codon degeneracy.

[0062] SEQ ID NO.21:

[0063] ATGGGAGCTGTATTAAAAGTTCTAACTACAGGTTTGCCGGCGCTGATCAGCTGGATTAAACGTAAGCGCTAA.

[0064] Thirdly, the present invention provides an expression vector comprising the above-mentioned nucleic acid molecule.

[0065] Specifically, the expression vector also includes a promoter that drives the expression of the nucleic acid molecule.

[0066] Preferably, the promoter is a T7 promoter.

[0067] Specifically, the backbone of the expression vector includes, but is not limited to: pET-28a vector, pRSFDuet-1 vector, pETDuet-1 vector, pACYCDuet-1 vector, or pTrc99a vector.

[0068] Preferably, the backbone of the expression vector is the pET-28a vector.

[0069] Preferably, the expression vector is located between the NcoI restriction site and the XhoI restriction site of the pET-28a vector.

[0070] Fourthly, the present invention provides a genetically engineered cell that expresses the above-mentioned recombinant vector.

[0071] Specifically, the host cells of the genetically engineered cells include Escherichia coli.

[0072] Preferably, the genetically engineered cell is BL21(DE3)Plys Escherichia coli.

[0073] Fifthly, the present invention provides the application of the above-mentioned pleiotropic protein MEL3 or its homologous proteins, nucleic acid molecules, expression vectors or genetically engineered cells in the preparation of antimicrobial products or anti-inflammatory products.

[0074] Specifically, the antimicrobial products include one or more of the following: antibacterial products, antifungal products, antiviral products, and antimycoplasma products.

[0075] Preferably, the antibacterial product targets one or more of the following: Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Propionibacterium acnes, and Porphyromonas gingivalis.

[0076] Preferably, the antifungal product targets one or more of Candida albicans and Candida crus-galli.

[0077] Preferably, the antiviral product targets one or more of HPV viruses, coronaviruses, and influenza A viruses.

[0078] Preferably, the anti-mycoplasma product includes an anti-mycoplasma pneumoniae product.

[0079] Specifically, the anti-inflammatory product inhibits the secretion of pro-inflammatory factors by blocking the binding of LPS and Toll-like receptors.

[0080] Preferably, the pro-inflammatory factors include one or more of TNF-α, IL-6, and NO.

[0081] In a sixth aspect, the present invention provides products comprising the above-mentioned pleiotropic protein MEL3 or its homologous proteins, nucleic acid molecules, expression vectors or genetically engineered cells, wherein the products include one or more of the following: pharmaceuticals, medical devices, cosmetics, preservatives, and disinfectants.

[0082] Specifically, the dosage form of the drug includes non-gastrointestinal dosage forms or gastrointestinal dosage forms.

[0083] Preferably, the gastrointestinal dosage forms include, but are not limited to, tablets, powders, granules, solutions, capsules, emulsions, suspensions, and oils.

[0084] Preferably, the non-gastrointestinal dosage forms include, but are not limited to, injectable dosage forms, respiratory dosage forms, skin dosage forms, mucosal dosage forms, and cavity dosage forms.

[0085] Preferably, the drug further includes one or more pharmaceutically acceptable excipients.

[0086] More preferably, the pharmaceutically acceptable excipients include, but are not limited to: solvents, diluents, disintegrants, precipitation inhibitors, surfactants, flow aids, binders, lubricants, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavorings, sweeteners, ion exchangers, release agents, coating agents, flavoring agents, or antioxidants.

[0087] Preferably, the medical device includes medical equipment and medical consumables.

[0088] Specifically, the cosmetics mentioned include, but are not limited to, facial cleansers, toners, lotions, creams, serums, masks, foundations, concealers, sunscreens, sunscreen sprays, shampoos, conditioners, shower gels, foaming agents, patches, cosmetic powders, cotton pads, eye serums, eye masks, eyeshadows, eye gels, or eye creams.

[0089] Specifically, the cosmetics also include cosmetically acceptable additives.

[0090] Preferably, the additives include, but are not limited to, one or more of the following: diluents, excipients, fillers, binders, wetting agents, disintegrants, emulsifiers, cosolvents, solubilizers, osmotic pressure regulators, surfactants, coating materials, colorants, pH adjusters, antioxidants, and buffers.

[0091] Specifically, the preservatives mentioned include food preservatives or cosmetic preservatives.

[0092] Preferably, the food preservative is used in human or animal food.

[0093] Preferably, the food includes, but is not limited to, candies, soy milk, yogurt, canned goods, biscuits, chocolate, pastries, cream, cheese, dairy products, milk powder, ice cream, popsicles, jam, fruit puree, candied fruit, preserved fruit, dried fruit, bread, egg rolls, protein drinks, solid beverages, lactic acid bacteria drinks, plant protein drinks, carbonated drinks, coffee, or puffed foods.

[0094] Preferably, the cosmetics include, but are not limited to, facial cleansers, toners, lotions, creams, serums, masks, foundations, concealers, sunscreens, sunscreen sprays, shampoos, conditioners, shower gels, foaming agents, patches, cosmetic powders, cotton pads, eye serums, eye masks, eyeshadows, eye gels, or eye creams.

[0095] The beneficial effects of this invention are as follows:

[0096] The multi-effect protein MEL3 or its homologous protein provided by this invention has broad-spectrum antibacterial activity, and can also achieve anti-inflammatory and antiviral effects, providing a new approach for the preparation of anti-pathogenic microorganism or anti-inflammatory products. Attached Figure Description

[0097] Figure 1 The half-effective dose EC 50 Schematic diagram of sample loading.

[0098] Figure 2 The half-maximal cytotoxic concentration (CC) 50 Schematic diagram of sample loading.

[0099] Figure 3 The results are from experiments on the anti-HPV16 activity of the pleiotropic protein MEL3.

[0100] Figure 4 The results are from experiments on the anti-HPV18 activity of the multi-effect protein MEL3.

[0101] Figure 5 The results are from the cytotoxicity assay of the pleiotropic protein MEL3.

[0102] Figure 6The effect of pleiotropic protein MEL3 on the viability of THP-1 cells is shown in the figure; unsti represents the untreated group.

[0103] Figure 7 The effect of pleiotropic protein MEL3 on nitric oxide production in THP-1 cells; unsti in the figure represents the untreated group.

[0104] Figure 8 The effect of pleiotropic protein MEL3 on TNF-α secretion in THP-1 cells is shown in the figure; unsti represents the untreated group; ns represents no significant difference; **** represents P<0.0001.

[0105] Figure 9 The effect of pleiotropic protein MEL3 on IL-6 secretion in THP-1 cells; ns in the figure represent no statistically significant difference; **** represents P<0.0001.

[0106] Figure 10 The effect of the pleiotropic protein MEL3 on the viability of DS-1 cells.

[0107] Figure 11 The inhibitory effect of pleiotropic protein MEL3 on DS-1 cell viability. Detailed Implementation

[0108] To make the technical means, creative features, and achieved objectives and effects of this invention easier to understand, the invention is further illustrated below with specific embodiments. However, the following embodiments are merely preferred embodiments of this invention and not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments described herein without creative effort are all within the protection scope of this invention. Unless otherwise specified, the operating methods and equipment used in the following embodiments are conventional operating methods, and the materials and equipment used in each embodiment are the same.

[0109] Example 1 Synthesis of pleiotropic proteins

[0110] 1. Chemical Synthesis Methods

[0111] The polyfunctional proteins MEL1-MEL20 with the amino acid sequences shown in SEQ ID NO.1-20 were synthesized by chemical synthesis (Shanghai Ketai Synthesis, purity ≥95%). Detailed information on the polyfunctional proteins is shown in Table 1.

[0112] Table 1

[0113]

[0114] 2. Biosynthetic methods

[0115] The nucleotide sequence of the pleiotropic protein MEL3 is shown in SEQ ID NO.21. A gene fragment was synthesized using whole-genome synthesis technology to express the pleiotropic protein MEL3. The synthesized gene fragment was then ligated to the pET-28a vector after double digestion with NcoI and XhoI enzymes, respectively. The synthesized gene fragment SEQ ID NO.13 was inserted between the NcoI and XhoI restriction sites of the pET-28a vector to obtain the vector pET-28a-MEL3.

[0116] The expression vector pET-28a-MEL3 was transformed into BL21(DE3)Plys Escherichia coli using the heat shock method. Positive clones were screened, and the resulting recombinant Escherichia coli was named BL21(DE3)Plys-MEL3.

[0117] Recombinant Escherichia coli BL21(DE3)Plys-MEL3 was seed cultured, then inoculated into LB medium for fermentation. The culture broth was centrifuged to collect the precipitated bacterial cells, which were then resuspended. The resuspended broth was ultrasonically disrupted, the supernatant was collected, and purified to obtain the pleiotropic protein MEL3.

[0118] The pleiotropic proteins MEL1, MEL2, and MEL4-MEL20DE can all be prepared using a similar biosynthesis method as described in this embodiment.

[0119] Experimental Example 1: Antibacterial Performance Verification Test

[0120] 1. Test strain

[0121] The bacterial strains used in this experiment are shown in Table 2:

[0122] Table 2

[0123]

[0124] Note: In the table, "a" represents MHIIB; "b" represents MHIIB + 5% lysed horse blood; "c" represents Brucella agar with 5 μg / ml hemin, 1 μg / ml Vitamin K1 and 5% lysed sheep blood; "d" represents RPMI 1640 + MOPs; and "e" represents ATCC 2611 Medium.

[0125] 2. Main reagents

[0126] The main reagents used in this experiment are shown in Table 3:

[0127] Table 3

[0128]

[0129] 3. Preparation of test samples and positive control drugs

[0130] Preparation of stock solution. On the day of the experiment, the test samples (MEL1-MEL20 of the example) and the positive control drugs were dissolved to prepare stock solution, as detailed in Table 4.

[0131] Table 4

[0132]

[0133] 4. MIC test

[0134] 4.1 MIC test for aerobic bacteria

[0135] Aerobic bacteria: Inoculate the bacterial strain on agar plates in advance and incubate overnight at 35°C. On the day of the experiment, adjust the bacterial concentration to a turbidity of 0.2.

[0136] The bacterial suspension was diluted with the corresponding liquid culture medium (Table 2), and then 50 µl was transferred to a 96-well round-bottom plate containing 50 µl of working solution to obtain the detection plate. The bacterial concentration was 5 × 10⁻⁶. 5 CFU / mL. The obtained 96-well circular bottom plate was placed in an incubator at 35°C and incubated for 20 h.

[0137] 4.2 MIC test for anaerobic and microaerophilic bacteria

[0138] Dispense 30 μL of the prepared 100× test sample and positive control drug working solution into a 6-well plate, then add 3 mL of the prepared test agar medium, mix thoroughly, and cool to solidify.

[0139] Anaerobic bacteria: Inoculate the required bacterial strains onto blood agar plates in advance and incubate them in an anaerobic environment. On the day of the experiment, pick some colonies from the agar plates, adjust the turbidity to 0.2, and then inoculate 2 µl onto the drug-containing blood agar plates using a workstation. 5 / spot. After the inoculum is absorbed by the plate, invert the blood plate obtained above and incubate it in an anaerobic environment at 35°C for 2 days.

[0140] 4.3 Fungal MIC Test

[0141] Fungi: Inoculate the strains onto plates beforehand and incubate at 35°C. For yeast, adjust the turbidity to 0.2 on the day of the experiment and dilute with the appropriate liquid culture medium (Table 2). The yeast concentration is 1-5 × 10⁻⁵. 3 CFU / ml.

[0142] Transfer 100 µl to a 96-well circular plate containing 100 µl of working solution to obtain a detection plate. Place the 96-well circular plate obtained above in an incubator at 35°C for 24 h.

[0143] 5. Experimental Results

[0144] The minimum inhibitory concentrations (μg / mL) of the pleiotropic proteins MEL1-MEL20 against the strains are shown in Tables 5-14 (NA in the tables represents no inhibitory effect). The MICs of the positive control drugs against the quality control strains were all within the CLSI reference range. Therefore, the test data are reliable.

[0145] Table 5

[0146]

[0147] Table 6

[0148]

[0149] Table 7

[0150]

[0151] Table 8

[0152]

[0153] Table 9

[0154]

[0155] Table 10

[0156]

[0157] Table 11

[0158]

[0159] Table 12

[0160]

[0161] Table 13

[0162]

[0163] Table 14

[0164]

[0165] The results showed that the pleiotropic proteins MEL1-MEL20 exhibited activity against all tested Gram-positive (G+) bacteria (MICs ranged from 4 to 64 μg / ml). Among them, MEL3, MEL5, and MEL14 showed the best inhibitory effects against Enterococcus faecalis, with MICs reaching 8 μg / ml against Enterococcus faecalis ATCC 51559 and ATCC 700221. For Staphylococcus aureus and Staphylococcus hemolyticus, MEL3 exhibited the strongest antibacterial effect, with MICs of 4-8 μg / ml. Specifically, MEL3 achieved a MIC of 4 μg / ml against Staphylococcus aureus VRS5 and Staphylococcus hemolyticus CICC 23976. For Streptococcus pneumoniae, MEL3, MEL9, and MEL13 all showed better antibacterial effects, with MICs of 6-16 μg / ml. For Streptococcus mutans, the MICs of MEL1-MEL20 were all less than or equal to 32 μg / ml.

[0166] For anaerobic bacteria, pleiotropic proteins MEL1-MEL20 all showed certain antibacterial activity against Propionibacterium acnes ATCC 6919 (MIC 16-64 μg / ml). Among them, MEL3, MEL11, MEL19, and MEL20 showed better antibacterial effects against Propionibacterium acnes ATCC 6919 (MIC 16 μg / ml).

[0167] For yeast and Mycoplasma pneumoniae, the pleiotropic proteins MEL1-MEL20 showed good antibacterial activity against Candida albicans and Candida krusei, with MICs ranging from 16 to 128 μg / ml.

[0168] It is evident that, against all tested bacterial strains, the pleiotropic proteins MEL1-MEL20 exhibited stronger antibacterial effects compared to the control antibiotics. Among them, MEL3 demonstrated the strongest antibacterial activity against Gram-positive bacteria, anaerobes, yeasts, and Mycoplasma pneumoniae.

[0169] Experiment Example 2: Verification of Antiviral Performance

[0170] 1. Experimental Materials

[0171] The test sample in this experiment was the pleiotropic protein MEL3 from Example 1. The control compound (DAPT, also known as GSI-IX) was provided by WuXi AppTec.

[0172] HPV16 VLP and HPV18 VLP viral particles were provided by WuXi AppTec; 293FT (ATCC-CRL-3216) cells were provided by WuXi AppTec; DMEM cell culture medium was provided by CORNING.

[0173] 2. Screening procedures for anti-HPV16 and HPV18 activity

[0174] On day 1, 293FT cells were loaded at 4 × 10⁻⁶ cells per well. 4 Cells were seeded at a density of 1,000 cells per well in 96-well plates and cultured overnight in a 5% CO2, 37°C cell culture incubator.

[0175] On day 2, the virus, test samples, and control compounds were diluted separately using serum-free culture medium. 50 μL of diluted MEL3 and 50 μL of 100% TCID50 virus were used. 50 HPV16 VLP or HPV18 were added to cell wells, along with 50 µl of the control compound and 50 µl of 100 TCID. 50 HPV16 VLP or HPV18 were added to cell wells, and cell controls (cells, no test sample, control compound treatment, and virus infection) and virus controls (cells infected with virus, no test sample, and control compound treatment) were set up for antiviral experiments (see details). Figure 1 ).

[0176] The highest detection point concentration of the test sample MEL3 was 100 µg / mL. It was serially diluted to eight concentration points (100 µg / mL, 40 µg / mL, 16 µg / mL, 8 µg / mL, 4 µg / mL, 2 µg / mL, 1 µg / mL, 0.5 µg / mL) using double-duplicate detection. The control compound, GSI-IX, was serially diluted five times, with eight concentration points and double-duplicate detection. The starting and ending concentrations were 10000 nM. Cells containing the virus, test sample, and control compound were incubated at 37°C in 5% CO2 for 3 days. The antiviral activity of the test sample was expressed as the inhibition rate (%) of the virus-induced cytopathic effect at different concentrations.

[0177] 3. Cytotoxicity test procedure

[0178] On day 1, 293FT cells were loaded at 4 × 10⁻⁶ cells per well. 4 Cells were seeded at a density of 1,000 cells per well in 96-well plates and cultured overnight in a 5% CO2, 37°C cell culture incubator.

[0179] On day 2, the test sample and control compound were diluted separately using serum-free medium. 50 μL of the diluted test sample and control compound, along with 50 μL of medium, were added to virus-free cell wells (see details). Figure 2 Simultaneously, cell controls (cells, no test sample, control compound treatment, and virus infection) and culture medium controls (no cells, no test sample, control compound treatment, and virus infection) were set up for cytotoxicity experiments.

[0180] The test sample MEL3 was serially diluted to a maximum detection point concentration of 100 µg / mL, with 8 concentration points (100 µg / mL, 40 µg / mL, 16 µg / mL, 8 µg / mL, 4 µg / mL, 2 µg / mL, 1 µg / mL, 0.5 µg / mL) and detected in duplicate wells. The control compound, GSI-IX, was serially diluted 5-fold, with 8 concentration points and detected in duplicate wells, with a starting point and final concentration of 10000 nM. Cells with the test sample and control compound were cultured in a 5% CO2 incubator at 37°C for 3 days. The cytotoxicity of the test sample was expressed as the inhibition rate (%) of 293FT cell viability at different sample concentrations.

[0181] 4. Experimental Results

[0182] The anti-HPV16 viral activity of the pleiotropic protein MEL3 is shown in Table 15 and Figure 3 As shown in Table 16, the anti-HPV18 virus activity is as follows: Figure 4 As shown in Table 17. The results showed that the EC50 values ​​of MEL3 against HPV16 and HPV18 were 1.22 µg / mL and 0.76 µg / mL, respectively, indicating that MEL3 has potential antiviral capabilities. Figure 5 The results showed that MEL3 did not produce cytotoxicity at any of the tested concentrations, CC 50 >100µg / mL.

[0183] Table 15

[0184]

[0185] Table 16

[0186]

[0187] Table 17

[0188]

[0189] In summary, the MEL3 provided by this invention exhibits strong antiviral activity against both HPV16 and HPV18, with superior antiviral efficacy compared to the control compound GSI-IX. Furthermore, MEL demonstrates good safety, showing no cytotoxicity at any of the tested concentrations.

[0190] Experiment Example 3: Verification of Anti-inflammatory Properties

[0191] 1. Study on the anti-inflammatory effect of pleiotropic proteins on THP-1

[0192] 1.1 Test Sample

[0193] The test sample in this experiment was the pleiotropic protein MEL3 from Example 1.

[0194] 1.2 Experimental Methods

[0195] (1) Preparation of cell culture medium

[0196] RPMI 1640 medium was purchased from Lonza, catalog number CC-3156.

[0197] Complete medium (CM): RPMI 1640 cell culture medium containing 10% FBS and 1% penicillin / streptomycin (100×).

[0198] (2) Preparation of cell stimulants

[0199] Phlorizate (PMA) was purchased from Sigma, catalog number P1585; lipopolysaccharide (LPS) was purchased from Sigma, catalog number L3129. PMA stimulants were prepared according to the methods described in Table 18; LPS stimulants were prepared according to the methods described in Table 19.

[0200] Table 18

[0201]

[0202] Table 19

[0203]

[0204] (3) Preparation of the test drug

[0205] Prepare the pleiotropic protein MEL3 according to the method described in Table 20.

[0206] Table 20

[0207]

[0208] (4) Experimental steps

[0209] Day 1: Collect THP-1 cells, count them, and adjust the THP-1 cell density to 3 × 10⁻⁶. 6 1 ml of 3 × 10⁻⁶ cells / ml was added to a 6-well plate. 6 THP-1 cells per ml and 1 ml of 20 ng / ml (2×) PMA were incubated in a 37°C incubator for 24 hours.

[0210] Day 2: Collect THP-1 cells, count them, and adjust the cell density to 0.5 × 10⁻⁶. 6 Cells / ml; Add 200 μL of THP-1 cells to a 96-well plate and incubate overnight at 37°C.

[0211] Day 3: Discard 100 μL of cell supernatant, add 100 μL of 0.15 µg / mL (2×) LPS or LPS + test drug (2×), and incubate in a 37°C incubator for 24 hours;

[0212] Day 4: Collect 100 μL of cell supernatant for cytokine detection of TNF-α (Human TNFα Flex Set, purchased from BD, catalog number 558273), IL-6 (Human IL-6 Flex Set, purchased from BD, catalog number 558276) and nitric oxide (NOdetection kit, purchased from Beyotime, catalog number S0021S). Cells were used to detect CTG (CTG detection kit, purchased from Promega, catalog number G7572).

[0213] 1.3 Experimental Results

[0214] The effect of MEL3 on cell viability, such as Figure 6 As shown, compared with the LPS stimulation group, MEL3 at a concentration of 40 µg / mL significantly reduced the cell viability of HTP-1 cells in a dose-dependent manner.

[0215] The effect of MEL3 on nitric oxide production in THP-1 cells, such as Figure 7 As shown, compared with the LPS stimulation group, MEL3 reduced the NO content in the HTP-1 cell supernatant.

[0216] The effect of MEL3 on cellular TNF-α secretion, such as Figure 8 As shown, compared with the LPS stimulation group, MEL3 can reduce the secretion of TNF-α in THP-1 cells in a dose-dependent manner.

[0217] The effect of MEL3 on cellular IL-6 secretion, such as Figure 9 As shown, compared with the LPS stimulation group, LL-37 can reduce the secretion of IL-6 in HTP-1 cells, and MEL3 can reduce the secretion of IL-6 in HTP-1 cells at concentrations of 10 µg / mL and 40 µg / mL in a dose-dependent manner.

[0218] 2. Effects of pleiotropic proteins on DS-1 cell viability

[0219] 2.1 Test Sample

[0220] The test sample in this experiment was the pleiotropic protein MEL3 from Example 1.

[0221] 2.2 Experimental Methods

[0222] (1) Preparation of cytokines

[0223] Cytokines were prepared according to the method described in Table 21. The recombinant human IL-6 protein in the table was provided by R&D and its catalog number is 206-IL.

[0224] Table 21

[0225]

[0226] (2) Preparation of the test drug

[0227] Prepare the pleiotropic protein MEL3 according to the method described in Table 22.

[0228] Table 22

[0229]

[0230] (3) Experimental steps

[0231] Collect DS-1 cells, count them, and adjust the DS-1 cell density to 2.5 × 10⁻⁶. 5 cells / ml; 100 μL 2.5 × 10 5 Add 100 μL of DS-1 at 5 ng / mL (1×) IL-6 or IL-6+ test drug (2×) to a 96-well plate and incubate at 37°C for 72 hours. Discard 100 μL of cell supernatant and add an equal volume of CTG detection reagent (CTG detection kit, purchased from Promega, catalog number G7572). Read the values ​​using an ELISA reader.

[0232] 2.3 Experimental Results

[0233] The effect of MEL3 on DS-1 cell viability, such as Figure 10 As shown, the inhibitory effect on DS-1 cell viability is as follows: Figure 11 As shown. By Figures 10-11 It was found that, compared with the untreated group (IL-6 only, Medium), MEL3 reduced the viability of DS-1 cells in a concentration-dependent manner, with an IC50 of 10.22 µg / mL.

[0234] Experimental Example 4: Anti-Mycoplasma pneumoniae activity

[0235] 1. Test materials

[0236] (1) Test substance: 10µg / mL of the multi-effect protein MEL3 in Example 1.

[0237] (2) Test strain: Mycoplasma pneumoniae (ATCC15531);

[0238] (3) Culture medium: Mycoplasma broth medium, fetal bovine serum;

[0239] (4) Neutralizing agent: D / E neutralizes broth;

[0240] (5) Interfering agent: 0.3% BSA

[0241] 2. Test methods

[0242] (1) Test basis: Disinfection Technical Specifications (2002 edition) 2.1.1.7, 2.1.1.9;

[0243] (2) Ambient temperature: 22.1℃, relative humidity: 52%RH.

[0244] 3. Experimental Procedure

[0245] (1) Culture medium sensitivity test (color change unit test method)

[0246] Mycoplasma pneumoniae was inoculated into mycoplasma broth (containing phenol red) and incubated at 37°C until the broth changed color. After two blind passages, the culture was inoculated into the test medium and serially diluted 10-fold to a final volume. -9 The culture medium was inoculated into Mycoplasma arginine broth. Three tubes were inoculated for each dilution and incubated at 37°C for 7-14 days. The color change of the culture medium was observed. The highest dilution in which more than 2 / 3 of the inoculated tubes showed a color change was considered the sensitivity of the culture medium. The results are shown in Table 23.

[0247] Table 23

[0248]

[0249] (2) Mycoplasma eradication test

[0250] Take the mycoplasma stock solution that changes color in the culture medium, react with the test substance for 30 minutes, and measure the mycoplasma content using the color change method. After incubation at 37℃ for 3 days, observe the color change. Repeat the experiment three times.

[0251] 1. (Test substance + Mycoplasma) + Neutralizing agent (test group);

[0252] 2. Neutralizing agent + mycoplasma (to observe whether mycoplasma can grow normally) (control group);

[0253] 3. Diluent + Neutralizing agent + Culture medium --- Culture (blank control group).

[0254] 3. Test Results

[0255] The concentration of mycoplasma in the bacterial culture after treatment was calculated using the colorimetric method. A decrease in the logarithmic value of the mycoplasma concentration after treatment greater than 3 indicated effective eradication. The results are shown in Tables 24 and 25.

[0256] Table 24

[0257]

[0258] Table 25

[0259]

[0260] The results showed that, under the experimental conditions of this experiment, after three repeated experiments, the killing rate of MEL3 against Mycoplasma pneumoniae was 99.99% after 30 minutes of treatment.

[0261] Experimental Example 5: Anti-SARS-CoV-2 Activity

[0262] 1. Test materials

[0263] (1) Test substance: 10µg / mL of the multi-effect protein MEL3 in Example 1.

[0264] (2) Test virus strain: human coronavirus (HCoV-229E);

[0265] (3) Cell line: Huh-7 cells;

[0266] (4) Neutralizing agent: D / E neutralizes broth;

[0267] (5) Interfering agent: 0.3% BSA;

[0268] (6) Culture media: complete cell culture medium, cell maintenance culture medium, fetal bovine serum.

[0269] 2. Test methods

[0270] (1) Test basis: Refer to 2.1.1.10.5 and 2.1.1.10.7 of the "Disinfection Technical Specifications" (2002 edition);

[0271] (2) Neutralizing agent identification test: MEL3 reacts with the neutralizing agent according to the grouping in 2.1.1.10.5;

[0272] (3) Virus inactivation test: MEL3 was used as the test substance; the reaction time was 30 min, and the test was repeated 3 times;

[0273] (4) Ambient temperature: 21.8℃, relative humidity: 52%RH.

[0274] 3. Experimental Procedure

[0275] HCoV-229E virus was inoculated into Huh-7 cells, and an appropriate amount of culture medium was added. The cells were cultured at 37°C in a 5% CO2 incubator, and observed daily. When 90% of the cells showed cytopathic effects, the cells were subjected to three freeze-thaw cycles to lyse the host cells. After centrifugation at 6000 rpm for 15 min, the precipitate was removed, and the virus suspension was transferred to centrifuge tubes. A quantitative suspension assay was used to determine the TCID0 of the indicator virus in the samples before and after treatment with the test substance, using the cytopathic effect after cell infection as the diagnostic indicator. The treatment time was 30 min. The viral infection titer of each group was determined. The experiment was repeated three times, and the logarithmic value of the test substance inactivating the indicator virus was calculated to determine the inactivation rate.

[0276] 4. Test Results

[0277] The results of the neutralizing agent identification test for human coronavirus (HCoV-229E) are shown in Table 26. The results of the fire extinguishing test for human coronavirus (HCoV-229E) are shown in Table 27.

[0278] Table 26

[0279]

[0280] After three repeated experiments, the neutralizing agent identification test results showed that D / E neutralizing broth could effectively neutralize the residual effect of MEL3 on human coronavirus (HCoV-229E), and the neutralizing agent and neutralization products had no significant effect on the test virus and cell growth.

[0281] Table 27

[0282]

[0283] After three repeated experiments, the virus inactivation test results showed that the average log inactivation value of MEL3 against human coronavirus (HCoV-229E) after 30 minutes of treatment was >4.00, which meets the requirements of the "Disinfection Technical Specifications" (2002 edition). The MEL3 sample has a significant inactivation effect on human coronavirus (HCoV-229E).

[0284] Experimental Example 6: Anti-porphyromonas gingivalis activity

[0285] 1. Test sample

[0286] The test sample in this experiment was the pleiotropic protein MEL3 from Example 1, with a concentration of 10 µg / mL.

[0287] 2. Test methods

[0288] Test basis and method: QB / T 2738-2023 "Evaluation method for antibacterial and bacteriostatic effects of daily chemical products" 7.3 Test method for antibacterial effect of daily chemical products (suspension quantitative method);

[0289] Evaluation basis: QB / T 2738-2023 "Evaluation method for antibacterial and bacteriostatic effects of daily chemical products";

[0290] Test item: Antibacterial rate: Porphyromonas gingivalis GIM1.1464.

[0291] 3. Test Results

[0292] The inhibitory effect of MEL3 on Porphyromonas gingivalis is shown in Table 28.

[0293] Table 28

[0294]

[0295] Note: Inhibition rate (%) = .

[0296] QB / T 2738-2023, "Evaluation Method for Antibacterial and Bacteriostatic Effects of Daily Chemical Products," stipulates that: a bacteriostatic rate ≥90% indicates a product with a strong bacteriostatic effect; a bacteriostatic rate ≥50% but less than 90% indicates a product with a bacteriostatic effect. The above results indicate that MEL3, after 30 minutes of action, has a strong bacteriostatic effect against *Porphyromonas gingivalis*.

[0297] Experimental Example 7: Anti-H1N1 Virus Activity

[0298] 1. Test sample

[0299] The test sample in this experiment was the pleiotropic protein MEL3 from Example 1, with a concentration of 10 µg / mL.

[0300] 2. Test methods

[0301] Testing basis and methods: Virus inactivation test, 2.1.1.10, "Disinfection Technical Specifications" (2002 edition);

[0302] Judgment basis: Virus inactivation test 2.1.1.10 of the "Disinfection Technical Specifications" (2002 edition);

[0303] Test item: Virus inactivation test (Influenza A virus A / PR / 8 / 34 HIN1).

[0304] 3. Test Results

[0305] The results of the virus inactivation test are shown in Table 29.

[0306] Table 29

[0307]

[0308] Note: Cells in the negative control group grew normally.

[0309] The infection titer of influenza A virus A / PR / 8 / 34 HIN1 in the positive control group was >10. 5 TCID 50 / mL, and the negative control group cells grew normally. The sample was reacted with the virus for 30 min, and the average log inactivation value of influenza A virus A / PR / 8 / 34 HIN1 was >4.00, which meets the requirements of virus inactivation test 2.1.1.10 of the "Disinfection Technical Specifications" (2002 edition). This indicates that sample MEL3 has a certain inactivation effect on influenza A virus A / PR / 8 / 34 HIN1.

[0310] The above detailed description is a specific illustration of one feasible embodiment of the present invention, and this embodiment is not intended to limit the patent scope of the present invention. It should be noted that all equivalent implementations or modifications made without departing from the present invention should be included within the scope of the technical solution of the present invention. Therefore, the protection scope of the present invention should be determined by the appended claims.

Claims

1. A multiplicative effect protein MEL3, characterized in that, The amino acid sequence of the multi-effect protein MEL3 is shown as SEQ ID NO.

3.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the multi-effect protein MEL3 of claim 1.

3. The nucleic acid molecule of claim 2, wherein, The nucleic acid molecule encodes the multi-effect protein MEL3; the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO. 21; or a nucleotide sequence obtained by base substitution of SEQ ID NO. 21 according to codon degeneracy.

4. An expression vector, characterized by, The expression vector comprises the nucleic acid molecule of any one of claims 2-3.

5. A genetically engineered cell, comprising, The genetically engineered cell comprises the expression vector of claim 4.

6. Use of the multi-effect protein MEL3 of claim 1, the nucleic acid molecule of any one of claims 2-3, the expression vector of claim 4, or the genetically engineered cell of claim 5 in the preparation of an anti-pathogenic microorganism product or an anti-inflammatory drug; The anti-pathogenic microorganism product is one or more of an anti-bacterial product, an anti-fungal product, an anti-viral product, and an anti-mycoplasma product; The anti-bacterial product is directed against one or more of Enterococcus faecium, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus hemolyticus, Streptococcus pneumoniae, Streptococcus mutans, Propionibacterium acnes, and Porphyromonas gingivalis; The anti-fungal product is directed against one or more of Candida albicans and Candida krusei; The anti-viral product is directed against one or more of HPV virus, coronavirus, and swine flu virus; the HPV virus is HPV16 virus and HPV18 virus; the coronavirus is HCoV-229E virus; and the swine flu virus is HIN1 virus; The anti-mycoplasma product is directed against Mycoplasma pneumoniae.

7. Products comprising the polyeffect protein MEL3 according to claim 1, the nucleic acid molecule according to any of claims 2 to 3, the expression vector according to claim 4 or the genetically engineered cell according to claim 5, characterized in that, The product is one or more of a drug, a medical device, a cosmetic, a food preservative, and a disinfectant.

8. The product of claim 7, wherein, The dosage form of the drug includes a parenteral dosage form or a gastrointestinal dosage form.

9. The product of claim 7, wherein, The drug further comprises one or more pharmaceutically acceptable excipients.

10. The product of claim 7, wherein, The medical device includes a medical equipment and a medical consumable.

11. The product of claim 7, wherein, The cosmetic includes facial cleanser, skin toner, emulsion, cream, serum, mask, foundation, concealer, sunscreen, sunscreen spray, shampoo, hair conditioner, body wash, foam, patch, cosmetic powder, cosmetic cotton, eye serum, eye mask, eye shadow, eye gel, or eye cream.

12. The product of claim 7, wherein, The food preservative is used in human food or animal food.

Images