A neutral homogeneous polysaccharide from *Prickly pear* fruit, its preparation method and application

Abstract

This invention discloses a bioactive neutral homogeneous polysaccharide from *Prickly Pear* fruit, its preparation method, and its applications. Specifically, this invention isolates and identifies a structurally well-defined neutral homogeneous polysaccharide from *Prickly Pear* fruit (PURP-A1) and elucidates its molecular structural characteristics. Experimental studies show that this polysaccharide can significantly inhibit substance P-induced skin inflammation, demonstrating promising application prospects in the treatment of pruritic dermatitis, neurogenic inflammation, and immune-mediated dermatitis. Furthermore, this polysaccharide also promotes the proliferation and migration of human keratinocytes, significantly accelerating wound healing and skin repair. Based on its multiple pharmacological effects, the neutral homogeneous polysaccharide from *Prickly Pear* fruit provided by this invention has significant application value in the development of wound repair products, anti-inflammatory and antipruritic drugs, and in addressing the problems of itching and stinging in sensitive skin.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to a neutral homogeneous polysaccharide from the fruit of *Cyprinus pungens*, its preparation method, and its applications. Background Technology

[0002] Skin itching is a core symptom of many skin diseases, causing distress beyond just physical discomfort; it also profoundly impacts patients' psychological well-being, social life, and quality of life. Prolonged scratching can damage the skin barrier, further increasing the penetration of irritants and nerve exposure, exacerbating skin sensitivity, and creating a vicious cycle of sensitivity and itching. Therefore, there is an urgent need to find a safe, non-irritating, and highly effective antipruritic agent.

[0003] Substance P is a neuropeptide widely distributed in the central and peripheral nervous systems. In skin diseases, substance P participates in the pathological processes of various diseases by activating neurogenic inflammatory pathways. In chronic pruritus diseases such as atopic dermatitis and psoriasis, substance P can enhance the transmission of pruritus signals and promote inflammation; in addition, substance P can stimulate immune cells, promote the release of inflammatory factors, and aggravate allergic reactions. Therefore, substance P-induced skin disease models are widely used in research on chronic pruritus, neurogenic inflammation, and allergic skin.

[0004] Plant polysaccharides are a class of macromolecular compounds composed of monosaccharide molecules linked by glycosidic bonds. Due to their excellent efficacy and high safety profile, they have received increasing attention in the health product field. However, the complex and diverse structures of plant polysaccharides pose significant research challenges. Nevertheless, the structure of polysaccharides is closely related to their biological activity, and changes in chain conformation inevitably affect their efficacy.

[0005] Prinsepia utilis Royle is a traditional folk medicinal plant with pharmacological activities such as antioxidant and immune-enhancing effects, and has significant development value. CN104510668A discloses a moisturizing composition whose moisturizing active ingredients include at least Prinsepia utilis oil and Prinsepia utilis polysaccharide, which is a crude polysaccharide obtained after ethanol precipitation. The polysaccharide structure is closely related to its biological activity. To promote better industrial applications, developing a structurally clear, neutral, and homogeneous Prinsepia utilis polysaccharide that can address skin itching and barrier damage can drive the upgrading of the industrial chain and provide a more reliable material basis and technical support for industrial applications in the pharmaceutical, cosmetic, and other fields. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a neutral homogeneous polysaccharide from *Cyprinus pungens*, its preparation method, and its application. The neutral homogeneous polysaccharide from *Cyprinus pungens* has a clear structure and can soothe skin itching symptoms while also possessing skin barrier repair function, thus solving skin problems from the perspectives of inhibiting itching and repairing the skin barrier.

[0007] To achieve this objective, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a neutral homogeneous polysaccharide from *Prickly pear* fruit, the structure of which is as follows:

[0009]

[0010] Preferably, the neutral homogeneous polysaccharide of the prickly pear fruit is composed of linked sugar residues, including →4)-α-D-Glcp-(1→, →5)-α-L-Araf-(1→, α-L-Araf-(1→, →4,6)-α-D-Glcp-(1→ and →6)-α-D-Glcp-(1→).

[0011] Preferably, the molecular weight of the neutral homogeneous polysaccharide from the prickly pear fruit is 15kDa-20kDa (e.g., 15kDa, 16kDa, 17kDa, 18kDa, 19kDa, 20kDa, etc.).

[0012] Preferably, the total sugar content of the neutral homogeneous polysaccharide of the prickly pear fruit is >90% (e.g., it can be 91%, 92%, 93%, 94%, 95%, 96%, 98%, etc.).

[0013] In a second aspect, the present invention provides a method for preparing a neutral homogeneous polysaccharide from *Prickly pear* fruit according to the first aspect, the preparation method comprising the following steps:

[0014] (1) Heat and reflux the fruit of the Chinese prickly pear to extract the extract. Concentrate the extract and add ethanol for alcohol precipitation to obtain crude polysaccharide of the Chinese prickly pear.

[0015] (2) The crude polysaccharide of the prickly pear fruit obtained in step (1) was separated and eluted using an ion-exchange cellulose chromatography column to obtain the neutral polysaccharide component of the prickly pear fruit.

[0016] (3) The neutral polysaccharide component of the prickly pear fruit obtained in step (2) is separated and eluted using a dextran gel chromatography column, and the eluent is collected to obtain the neutral homogeneous polysaccharide of the prickly pear fruit.

[0017] Preferably, in step (1), the operation before extraction further includes pressing the prickly pear fruit for oil, and the prickly pear oil meal obtained after pressing is subjected to heating and reflux extraction.

[0018] Preferably, in step (1), the solvent used for extraction includes water.

[0019] Preferably, in step (1), the extraction material-to-liquid ratio is 1g:(5-15)mL, for example, it can be 1g:7mL, 1g:9mL, 1g:11mL, 1g:13mL, etc.

[0020] Preferably, in step (1), the number of extractions is 1-3 times, for example, 1 time, 2 times, or 3 times, and the extraction time for each extraction is 1-3 hours, for example, 1.2 hours, 1.5 hours, 2 hours, 2.5 hours, or 2.8 hours.

[0021] Preferably, the ethanol is added to a volume concentration of 75-85%, for example, 76%, 78%, 80%, 82%, 84%, etc.

[0022] Preferably, the process of adding ethanol further includes cooling for precipitation and centrifugation.

[0023] Preferably, the temperature for the cooling precipitation is 2-8℃, for example, it can be 3℃, 4℃, 5℃, 6℃, 7℃, etc.

[0024] Preferably, the centrifugation speed is 3000-4000 r / min, for example, it can be 3100 r / min, 3200 r / min, 3400 r / min, 3600 r / min, 3800 r / min, 3900 r / min, etc., and the centrifugation time is 10-20 min, for example, it can be 12 min, 14 min, 16 min, 18 min, etc.

[0025] Preferably, in step (2), the anion exchange gel column includes anion exchange gel DEAE-52 column.

[0026] Preferably, in step (2), the solvent used for elution includes water.

[0027] Preferably, in step (3), the dextran gel chromatography column includes a dextran gel G-100 chromatography column.

[0028] Preferably, in step (3), the solvent used for elution includes water.

[0029] Preferably, the preparation method includes the following steps:

[0030] (1) The oil meal of the prickly pear fruit after oil extraction was heated and refluxed. The extraction solvent was distilled water. The mixture was concentrated under reduced pressure and ethanol was added for precipitation. The final volume concentration of ethanol was 85%. The mixture was stirred and allowed to precipitate overnight. The precipitate was collected by centrifugation to obtain crude polysaccharide from the prickly pear fruit.

[0031] (2) The crude polysaccharide of the prickly pear fruit obtained in step (1) was reconstituted with distilled water, centrifuged, and the supernatant was collected and loaded onto anion exchange gel DEAE-52 packing material. Distilled water was used as the elution solvent, and a total of 4 BV was eluted. The sulfuric acid-phenol method was used for detection. The absorbance was measured at 490 nm and the elution curve was plotted. The eluents corresponding to the elution peaks were combined and freeze-dried to obtain the neutral polysaccharide component of the prickly pear fruit.

[0032] (3) The neutral polysaccharide component of the prickly pear fruit obtained in step (2) was reconstituted with distilled water, filtered, and Sephadex G100 was used as the separation packing material. Distilled water was used as the eluent. The sulfuric acid-phenol method was used for detection. The absorbance was measured at 490 nm and the elution curve was plotted. The eluents corresponding to the elution peaks were combined and freeze-dried to obtain the neutral homogeneous polysaccharide of the prickly pear fruit.

[0033] Thirdly, the present invention provides the application of the neutral homogeneous polysaccharide of *Cynanchum paniculatum* as described in the first aspect in the preparation of a skin antipruritic product.

[0034] Preferably, the antipruritic agent is used to prepare medicines for treating atopic dermatitis, psoriasis, and neurogenic dermatitis.

[0035] Fourthly, the present invention provides the application of the neutral homogeneous polysaccharide from the prickly pear fruit as described in the first aspect in the preparation of products that promote wound healing.

[0036] Fifthly, the present invention provides the application of the neutral homogeneous polysaccharide from the fruit of *Cypripedium spp.* as described in the first aspect in the preparation of cosmetics.

[0037] Preferably, the cosmetic includes a skin protectant that soothes itching and stinging symptoms of sensitive skin and promotes skin barrier repair, wherein the skin protectant includes neutral homogeneous polysaccharide from the prickly pear fruit as described in the first aspect.

[0038] Compared with the prior art, the present invention has at least the following beneficial effects:

[0039] (1) This invention provides a neutral homogeneous polysaccharide from *Prickly Pear* fruit, its structure, and its applications. This polysaccharide is composed of specific glycosidic bonds and can inhibit substance P-induced pruritus symptoms. It has good therapeutic potential for pruritus, neurogenic inflammation, and immune-mediated skin diseases. Simultaneously, it can promote the proliferation and migration of human keratinocytes, making it highly valuable for the preparation of products related to promoting wound healing and skin repair. Furthermore, the neutral homogeneous polysaccharide from *Prickly Pear* fruit provided by this invention can be applied to sensitive skin pruritus and barrier damage symptoms, providing a treatment solution from the perspective of inhibiting pruritus and strengthening the skin barrier.

[0040] (2) The method for preparing neutral homogeneous polysaccharides from *Prickly pear* provided by this invention employs multiple separation and purification processes using ion-exchange cellulose and dextran gels, with zero organic reagents throughout the process, making it more environmentally friendly and safer. Furthermore, the preparation method is simple, possessing strong versatility and promising application prospects. Moreover, the technical means provided by this invention can yield neutral homogeneous polysaccharides from *Prickly pear* with a narrow distribution, facilitating the structural elucidation of active polysaccharides from *Prickly pear*. Attached Figure Description

[0041] Figure 1 This is a chromatogram of the monosaccharide composition of PURP-A1, a neutral homogeneous polysaccharide from the fruit of the Chinese prickly pear.

[0042] Figure 2 This is the Fourier transform infrared spectrum of PURP-A1, a neutral homogeneous polysaccharide from the fruit of the Chinese prickly pear.

[0043] Figure 3 This is a molecular weight distribution diagram of PURP-A1, a neutral homogeneous polysaccharide from the fruit of the Chinese prickly pear.

[0044] Figure 4 This is the GC-MS total ion chromatogram of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cyprinus sativus*.

[0045] Figure 5 The one-dimensional NMR of PURP-A1, a neutral homogeneous polysaccharide from the prickly pear fruit in Example 2. 1 H spectrum.

[0046] Figure 6 The one-dimensional NMR of PURP-A1, a neutral homogeneous polysaccharide from the prickly pear fruit in Example 2. 13 C-spectrum.

[0047] Figure 7 This is a two-dimensional COSY NMR spectrum of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cypripedium sarmentosum*, in Example 2.

[0048] Figure 8 This is the two-dimensional HMBC NMR spectrum of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cypripedium sarmentosum*, in Example 2.

[0049] Figure 9 This is a two-dimensional NMR HSQC spectrum of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cypripedium sarmentosum*, in Example 2.

[0050] Figure 10 This is a two-dimensional NMR NOESY spectrum of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cypripedium sarmentosum*, in Example 2.

[0051] Figure 11 This is a graph showing the inhibitory effect of the neutral homogeneous polysaccharide PURP-A1 from the fruit of *Cypripedium sarmentosum* on substance P-induced TNF-α in Example 3.

[0052] Figure 12This is a graph showing the inhibitory effect of the neutral homogeneous polysaccharide PURP-A1 from the fruit of *Cypripedium sarmentosum* on substance P-induced IL-6 in Example 3.

[0053] Figure 13 This is a graph showing the inhibitory effect of the neutral homogeneous polysaccharide PURP-A1 from the fruit of *Cypripedium sarmentosum* on substance P-induced IL-8 in Example 3.

[0054] Figure 14 This is a graph showing the inhibitory effect of the neutral homogeneous polysaccharide PURP-A1 from *Cypripedium spp.* on INF-γ induced by substance P in Example 3.

[0055] Figure 15 This is a diagram showing the cell scratch repair effect of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cypripedium sarmentosum*, in Example 4. Detailed Implementation

[0056] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0057] The fruit of the Chinese prickly pear originates from Haba Snow Mountain in Yunnan;

[0058] Human keratinocytes (HaCaT) were obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences.

[0059] Example 1

[0060] This embodiment provides a neutral homogeneous polysaccharide from *Prickly pear* fruit and its preparation method, the preparation method comprising the following steps:

[0061] (1) Preparation of crude polysaccharide from sea buckthorn fruit: The oil meal of sea buckthorn fruit after oil extraction was heated and refluxed at a material-to-liquid ratio of 1:10 (g / mL). The extraction solvent was distilled water, and the extraction time was 2h. The extraction was repeated twice. The two extracts were combined and concentrated under reduced pressure until the concentrated weight was 1 / 5 of the initial weight. The obtained concentrate was slowly added to ethanol until the final ethanol concentration was 85%. The mixture was stirred for 2h to ensure that the concentrate was fully in contact with the ethanol. The mixture was then allowed to stand overnight at 4℃. After the precipitate was fully separated, it was centrifuged (3500r / min) for 10min, the precipitate was collected, and the mixture was freeze-dried to obtain crude polysaccharide from sea buckthorn fruit.

[0062] (2) Ion exchange chromatography of neutral homogeneous polysaccharide fraction of Prickly pear fruit: The crude polysaccharide of Prickly pear fruit obtained in step (1) was reconstituted with distilled water, centrifuged, and the supernatant was collected and loaded onto anion exchange gel DEAE-52 packing material at a concentration of 1:50 (g / mL). Distilled water was used as the elution solvent and a total of 4 BV was eluted. The absorbance was measured at 490 nm using the sulfuric acid-phenol method and the elution curve was plotted. The eluents corresponding to the elution peaks were combined and freeze-dried to obtain the neutral polysaccharide fraction of Prickly pear fruit.

[0063] (3) Gel purification of neutral homogeneous polysaccharide from *Prickly pear* fruit: The neutral polysaccharide component obtained in step (2) was reconstituted with distilled water, and insoluble particles were removed by passing through a 0.22 μm filter membrane. Sephadex G100 was used as the separation packing material, with a sample concentration of 10 mg / mL and a flow rate of 0.5 mL / min. Distilled water was used as the eluent, and the eluent was detected by the sulfuric acid-phenol method. The absorbance was measured at 490 nm and the elution curve was plotted. The eluents corresponding to the elution peaks were combined and freeze-dried to obtain neutral homogeneous polysaccharide from *Prickly pear* fruit (PURP-A1). The total sugar content of PURP-A1 was tested by the sulfuric acid-phenol method, and the total sugar content of the homogeneous polysaccharide was 91.18%.

[0064] Example 2

[0065] Structural characterization test

[0066] This test case involves the structural characterization of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cypripedium sarmentosum*, specifically including:

[0067] (1) Monosaccharide composition test

[0068] Test method: Take a clean chromatographic bottle, weigh an appropriate amount of neutral homogeneous polysaccharide from *Cypripedium spp.*, add 1 mL of TFA solution, heat at 121℃ for 2 h to allow for complete hydrolysis, purge with nitrogen, and dry. Dissolve in distilled water, and analyze the monosaccharide components using an ion chromatography system (ICS5000+, Thermo Fisher Scientific, USA) and an electrochemical detector.

[0069] The results of the monosaccharide composition are as follows Figure 1 As shown, PURP-A1 is mainly composed of 69.44% glucose (Glc), 23.51% arabinose (Ara), and contains small amounts of 4.94% galactose (Gal) and 2.11% xylose (Xyl).

[0070] (2) Infrared spectroscopy test

[0071] Test method: Weigh a small amount of PURP-A1 sample and mix it with 200mg of potassium bromide. Press the mixture into a 1mm thick sheet and then test it.

[0072] Test results show (see) Figure 2 The absorption band is at 3600-3200 cm⁻¹. -1 This is the absorption peak of the stretching vibration of -OH, and absorption peaks in this region are characteristic of carbohydrates. Specifically: 3370.81 cm⁻¹ -1 This is the absorption peak of the stretching vibration of OH, a characteristic peak of carbohydrates. It is located at 2931.56 cm⁻¹. -1 The absorption peak at 1659.61 cm⁻¹ is attributed to the CH stretching vibration. -1 It can be classified as water of crystallization; at 1025.56 cm⁻¹ -1 There is an absorption peak at this point, which is attributed to the stretching vibration of CO. Based on these characteristic peaks, PURP-A1 can be preliminarily identified as a polysaccharide compound.

[0073] (3) Determination of molecular weight and distribution coefficient

[0074] Test method: PURP-A1 was dissolved in 0.1M NaCl solution to a final concentration of 1 mg / mL and tested. High-performance liquid chromatography-gel permeation (HPGPC) was used for testing. The HPLC system was an Agilent 1260 Infinity II. Chromatographic conditions were: size-exclusion column PL aquagel-OH 50 (8 μM, 300 × 7.5 mm); column temperature 35℃; injection volume 50 μL; mobile phase 0.1M NaCl solution; flow rate 1 mL / min; isocratic elution; and molecular weight was calculated using GPC software.

[0075] Test results (see) Figure 3 The results showed that the homogeneous polysaccharide PURP-A1 from the fruit of *Cyprinus sativus* exhibited a uniform and symmetrical single peak, with a molecular weight of Mw = 18373 Da and a distribution coefficient PDI = 1.56, indicating that its distribution was narrow and its molecular weight distribution was uniform.

[0076] (4) Bonding structure analysis

[0077] Test Method: Accurately weigh a small amount of PURP-A1 sample, dissolve it in DMSO, add NaOH, incubate for 30 min, then add iodomethane solution and react for 1 h. Add 1 mL of water and 2 mL of dichloromethane, vortex to mix, centrifuge, and discard the aqueous phase. Repeat the washing with water 3 times, collect the lower dichloromethane phase and dry it with nitrogen, add 2M TFA, react at 121℃ for 120 min, dry it with nitrogen, add 2M ammonia, and react at room temperature for 2.5 h. Add acetic acid to terminate the reaction, dry it with nitrogen, wash twice with methanol, and dry it with nitrogen. Add acetic anhydride, vortex to mix, react at 100℃ for 2.5 h, add distilled water and let stand for 10 min. Add dichloromethane, vortex to mix, centrifuge, discard the aqueous phase, and finally collect the lower dichloromethane phase for GC-MS detection.

[0078] The methylation results are shown in Table 1, and the total ion chromatogram of methylation by GC-MS is shown in the figure below. Figure 4 As shown.

[0079] Table 1

[0080]

[0081] (5) Analysis of the core structure of PURP-A1

[0082] The freeze-dried neutral homogeneous polysaccharide PURP-A1 from *Cypripedium spp.* fruit was dissolved in 0.5 mL of D2O, and one-dimensional NMR was measured using a 500 MHz Bruker nuclear magnetic resonance spectrometer. 1 H-NMR, 13 C-NMR and two-dimensional NMR spectrometers COSY, HSQC, HMBC, and NOESY. One-dimensional NMR of PURP-A1. 1 H spectrum and 13 The C-spectrums are as follows: Figure 5 , Figure 6 As shown, the two-dimensional NMR COSY spectrum, HMBC spectrum, HSQC spectrum, and NOESY spectrum are respectively as follows: Figure 7 , Figure 8 , Figure 9 , Figure 10 As shown.

[0083] The 1H NMR spectrum of the neutral homogeneous polysaccharide PURP-A1 from *Cynanchum aizoon* was mainly concentrated between δ 3.0 and 5.5 ppm. Multiple coupled signal peaks were identified in the 4.3–5.4 ppm anodic signal region, indicating the presence of various sugar residues in this sample. The corresponding chemical shifts of the anodic hydrogens were δ 4.86, 4.99, 5.08, 5.27, and 5.31, respectively. The non-anodic hydrogen signals were mainly concentrated in the 3.1–4.2 ppm region. Furthermore, multiple signal peaks were identified in the anodic carbon region, combined with… 13 The cross-peaks in the anodic regions of the C NMR and HSQC spectra identified the anodic signals present in the sample as: δ 5.31 / 99.5, 4.99 / 107.46, 5.08 / 106.83, 5.27 / 100.1, and 4.86 / 97.87 ppm, which were denoted as sugar residues A, B, C, D, and E, respectively. Based on the sample's bonding structure (methylation) information and anodic signals, it was deduced that sugar residue A is →4)-α-D-Glcp-(1→, sugar residue B is →5)-α-L-Araf-(1→, sugar residue C is α-L-Araf-(1→, sugar residue D is →4,6)-α-D-Glcp-(1→, sugar residue E is →6)-α-D-Glcp-(1→). Combined with the COSY spectrum, the H2-H6 chemical shifts of each sugar residue can be assigned, as shown in Table 2.

[0084] Table 2

[0085]

[0086] Based on the sugar residues in PURP-A1 13 C and 1 The chemical shift of H was analyzed, along with HMBC and NOESY spectra, to determine the structure and linkage mode of the polysaccharide. According to the HMBC spectrum, there is a cross-peak between C1 of sugar residue A and H4 of sugar residue A (δ99.5 / 3.57 ppm), a cross-peak between H1 of sugar residue B and C4 of sugar residue D (δ4.99 / 76.44 ppm), a cross-peak between H1 of sugar residue D and C4 of sugar residue A (δ5.27 / 76.52 ppm), a cross-peak between C1 of sugar residue D and H4 of sugar residue A (δ100.1 / 3.57 ppm), and a cross-peak between C1 of sugar residue D and H6 of sugar residue E (δ100.1 / 3.56 ppm). According to the NOESY spectrum, there is a cross-peak between H1 and H4 of sugar residue A at δ 5.31 / 3.57 ppm, a cross-peak between H1 of sugar residue A and H6 of sugar residue D at δ 5.31 / 3.72 ppm, a cross-peak between H1 of sugar residue A and H6 of sugar residue E at δ 5.31 / 3.56 ppm, a cross-peak between H1 of sugar residue B and H4 of sugar residue D at δ 4.99 / 3.68 ppm, a cross-peak between H1 of sugar residue C and H5 of sugar residue B at δ 5.08 / 3.77 ppm, a cross-peak between H1 of sugar residue D and H4 of sugar residue A at δ 5.27 / 3.57 ppm, and a cross-peak between H1 of sugar residue E and H4 of sugar residue A at δ 4.86 / 3.57 ppm.

[0087] Based on the PURP-A1 methylation results of the polysaccharide and the analysis of one-dimensional and two-dimensional NMR information, it can be inferred that the neutral homogeneous polysaccharide of *Cypripedium spp.* is mainly composed of interconnected main chains such as →4)-α-D-Glcp-(1→, →4,6)-α-D-Glcp-(1→ and →6)-α-D-Glcp-(1→), while the side chains are mainly composed of α-L-Araf-(1→ and →5)-α-L-Araf-(1→) linked at the O-4 positions of the sugar residue →4,6)-α-D-Glcp-(1→). Its core structural formula is as follows:

[0088]

[0089] Example 3

[0090] Activity test of neutral homogeneous polysaccharide PURP-A1 from *Cyprinus sativus* against substance P-induced pruritus.

[0091] Assay Method: The human keratinocyte cell line HaCaT was cultured in DMEM high-glucose medium (Gibco) containing 10% fetal bovine serum (Gibco). HaCaT cells in the logarithmic growth phase were harvested and cultured at 1.2 × 10⁻⁶ cells / mL. 6 Cells were seeded at a density of [number] cells / well in 6-well plates and cultured in a cell culture incubator for 24 h. After complete cell adhesion, except for the normal group which was cultured in complete medium, the model group was added with 2 μM P substance (purchased from MCE), the drug treatment group was added with 2 μM P substance and PURP-A1 neutral homogeneous polysaccharide (500 μg / mL, 1000 μg / mL) from *Cypripedium sarmentosum* and co-cultured for 24 h, and the positive control group was added with 2 μM P substance and 1 μM aprepitant (purchased from MCE). After modeling and drug administration, the cell supernatant was discarded, the cells were washed once with PBS, and RNA was extracted according to the instructions of the cell RNA extraction kit (purchased from Abclonal). The RNA was then reverse transcribed into cDNA using a reverse transcription kit (purchased from Abclonal). Finally, the expression of TNF-α, IL-6, IL-8, and IFN-γ genes was detected by real-time quantitative PCR.

[0092] Primer sequence information is shown in Table 3:

[0093] Table 3

[0094] Gene name Upstream Downstream TNF-α TTGGAGTGATCGGCCCCCAG ACAGGCTTGTCACTCGGGGTT IL-6 CTCCACAAGCGCCTTCGGTC TGTGTGGGGCGGCTACATCT IL-8 ACTGAGAGTGATTGAGAGTGGAC AACCCTCTGCACCCAGTTTTC IFN-γ TGAATGTCCAACGCAAAGCA ACTGGGATGCTCTTCGACCT

[0095] GraphPad Prism was used for plotting, and the results are expressed as Mean ± SD. The t-test was used for comparison between groups. "#", "##" and "###" indicate that the p < 0.05, p < 0.01 and p < 0.001 are compared with the normal control group, respectively; "*", "**" and "***" indicate that the p < 0.05, p < 0.01 and p < 0.001 are compared with the model group, respectively. n = 3.

[0096] Inflammatory factor inhibition effect = (relative expression level of model group - relative expression level of test group) / relative expression level of model group × 100%.

[0097] Table 4

[0098]

[0099] The experimental results are shown in Table 4 and Figures 11 to 14As shown, the experimental results of PURP-A1, a neutral homogeneous polysaccharide from *Cercis chinensis*, in a substance P-induced pruritus model indicate that this active ingredient can significantly inhibit the gene expression of inflammatory cytokines TNF-α, IL-6, IL-8, and IFN-γ in human keratinocytes induced by substance P. This finding reveals the potential molecular mechanism by which PURP-A1 exerts its anti-pruritus effect by regulating the expression pathways of inflammation-related cytokines. This suggests that PURP-A1 has significant potential as a natural anti-allergic and antipruritic active ingredient in the development of skincare products for sensitive skin or in the treatment of pruritic skin diseases such as neurogenic dermatitis, atopic dermatitis, and psoriasis.

[0100] Example 4

[0101] Wound healing efficacy potential test of neutral homogeneous polysaccharide PURP-A1 from Prickly pear fruit

[0102] HaCaT cells were seeded into 12-well plates. A cell scratching device was vertically placed in the center of each well. 70 μL of cell suspension was added to each of the two chambers of each device, and the area around the device was moistened with 200 μL of cell suspension. Cells were cultured at 37°C (5% CO2) for 24 h. The device was gently removed with sterile forceps, and the cells were gently rinsed once with 1 mL of PBS solution, after which all PBS was aspirated. A blank control group (with serum-free culture medium), a positive control group (EGF 10000 IU / mL), and a sample group (PURP-A 1500 μg / mL) were set up. Cell growth at the scratch sites was observed under a microscope at 16 h, 24 h, and 48 h, and photographs were taken. The healing area was calculated using ImageJ software.

[0103] Healing rate = (Initial scratch area (0h) - Scratch area at test time) / (Initial scratch area (0h)) × 100%.

[0104] Table 5

[0105] Group 16h 24h 48h Blank control group 7.29％ 10.11％ 13.08％ Positive control group 13.38％ 34.86％ 100％ PURP-A1 21.45％ 35.00％ 78.90％

[0106] The experimental results are shown in Table 5 and Figure 15 As shown, compared with the blank control group, at different observation time points, the healing rate of PURP-A1, a neutral homogeneous polysaccharide from the fruit of *Cypripedium sarmentosum*, was significantly improved, indicating that it has excellent scratch repair effect and has great potential for application in wound repair products or skin barrier repair cosmetics.

[0107] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A neutral homogeneous polysaccharide from Prinsepia utilis Hook.f. characterized in that, The structure of the Prinsepia uniflora Batal neutral homogeneous polysaccharide is: ； The molecular weight of the Prinsepia uniflora Batal neutral homogeneous polysaccharide is 15 kDa-20 kDa.

2. The Prinsepia uniflora neutral homogeneous polysaccharide according to claim 1, characterized in that, The Prinsepia uniflora Batal neutral homogeneous polysaccharide is connected by sugar residues, and the sugar residues include →4)-α-D-Glcp-(1→, →5)-α-L-Araf-(1→, α-L-Araf-(1→, →4,6)-α-D-Glcp-(1→ and →6)-α-D-Glcp-(1→.

3. The neutral homogeneous polysaccharide of Prinsepia uniflora according to claim 1, characterized in that, The total sugar content of the Prinsepia uniflora Batal neutral homogeneous polysaccharide is > 90%.

4. A process for the preparation of neutral homogeneous polysaccharides from Prinsepia utilis according to any one of claims 1 to 3, characterized in that, The preparation method comprises the following steps: (1) heating and reflux extraction of Prinsepia uniflora Batal, concentration of the obtained extract, addition of ethanol for alcohol precipitation, and obtaining Prinsepia uniflora Batal crude polysaccharide; (2) separation and elution of the Prinsepia uniflora Batal crude polysaccharide obtained in step (1) by anion exchange gel chromatography column, and obtaining Prinsepia uniflora Batal neutral polysaccharide component; (3) separation and elution of the Prinsepia uniflora Batal neutral polysaccharide component obtained in step (2) by dextran gel chromatography column, collection of the eluate, and obtaining the Prinsepia uniflora Batal neutral homogeneous polysaccharide.

5. The production method according to claim 4, characterized by, The preparation method comprises the following steps: (1) heating and reflux extraction of Prinsepia uniflora Batal oil cake after oil extraction, extraction solvent is water, vacuum concentration, addition of ethanol for alcohol precipitation, final volume concentration of ethanol is 85%, stirring, precipitation overnight, centrifugal collection of the precipitate, and obtaining Prinsepia uniflora Batal crude polysaccharide; (2) water resolubilization of the Prinsepia uniflora Batal crude polysaccharide obtained in step (1), centrifugation, collection of the supernatant, loading of the supernatant on anion exchange gel DEAE-52 filler, use of water as elution solvent, a total of 4 BV elution, use of sulfuric acid-phenol method for detection, test of absorbance at 490 nm, and drawing of elution curve, combination of elution peak corresponding eluate, and freeze-drying to obtain Prinsepia uniflora Batal neutral polysaccharide component; (3) resolubilization of the Prinsepia uniflora Batal neutral polysaccharide component obtained in step (2) by water, filtration, use of Sephadex G100 as separation filler, use of water as eluate, use of sulfuric acid-phenol method for detection, test of absorbance at 490 nm, and drawing of elution curve, combination of elution peak corresponding eluate, and freeze-drying to obtain the Prinsepia uniflora Batal neutral homogeneous polysaccharide.

6. Use of the Prinsepia uniflora Batal neutral homogeneous polysaccharide according to any one of claims 1-3 in the preparation of a skin antipruritic agent product.

7. Use according to claim 6, characterized in that, The skin antipruritic agent is used for preparing a drug for treating atopic dermatitis, psoriasis and neurogenic dermatitis.

8. Use of the Prinsepia uniflora Batal neutral homogeneous polysaccharide according to any one of claims 1-3 in the preparation of a product for promoting wound healing.

9. Use of the Prinsepia uniflora Batal neutral homogeneous polysaccharide according to any one of claims 1-3 in the preparation of a cosmetic product; The cosmetic product comprises a skin protective agent with the functions of relieving skin itching, stinging symptoms and promoting skin barrier repair for sensitive skin, and the skin protective agent comprises the Prinsepia uniflora Batal neutral homogeneous polysaccharide according to any one of claims 1-3.

Images