Application of SiPHO2 protein or coding gene thereof in regulating heading time, plant height and leaf length and width of plant

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses application of SiPHO2 protein or a coding gene thereof to regulation and control of heading time, plant height and leaf length and width of plants. The invention provides application of SiPHO2 protein, a coding gene of the SiPHO2 protein or a biological material containing the coding gene of the SiPHO2 protein to regulation and control of heading time, plant height, leaf length and / or leaf width of plants. By constructing the plant with reduced SiPHO2 protein expression quantity, the heading time of the plant can still be promoted to be advanced in a low-phosphorus environment, so that the growth period of crops is shortened, and land resources are better utilized.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and specifically, to the application of SiPHO2 protein or its encoding gene in regulating the heading time, plant height, leaf length and width of plants. Background Art

[0002] Phosphorus (P) is one of the essential macronutrients for plant growth and development, playing an irreplaceable role in the process of plant growth and development. The concentration of soluble phosphorus in the soil is about 1-10 μmol / L, far lower than the phosphorus concentration in the cytoplasm (1-10 mmol / L) (Sahu et al., 2020), and the lack of available phosphorus in the soil has become an important factor affecting crop yields.

[0003] The distribution of phosphorus in different organelles is mainly completed by the phosphate transporter PHT2-5 families. The PHT3 family proteins are located on the mitochondrial membrane, and studies have shown that AtPHT3;2 and AtPHT3;3 are involved in the distribution of phosphorus in mitochondria (Hamel et al., 2004). Arabidopsis AtPHO2 interacts with AtPHT1 and mediates the degradation of AtPHT1 through the 26S proteasome (ubiquitin / 26S proteasome pathway) pathway. The degradation of rice PHT1 protein is mediated by the plasma membrane-localized E3 ubiquitin ligase NLA (nitrogen limitation adaptation) protein (Yue et al., 2017). Whether OsPHO2 directly participates in the degradation of OsPHT1 remains unclear.

[0004] PHO2 is an E2 ubiquitin conjugating enzyme initially discovered in plants, which plays a key role in regulating phosphorus homeostasis in plants. PHO affects the absorption and utilization of phosphorus in plants by participating in the ubiquitination and degradation processes of phosphorus transporters. Under phosphorus-sufficient conditions, PHO2 plays a role by degrading PHO1 protein, and PHO1 is involved in exporting phosphate to the xylem, thereby regulating the transport of phosphorus from the roots to the above-ground parts. When plants are in a phosphorus-starved state, the expression of PHO2 is inhibited, resulting in the accumulation of PHO1 protein, and thus increasing the transport and utilization of phosphorus.

[0005] In addition, PHO2 also interacts with small RNAs such as miR399 and miR827, and regulates the phosphorus signaling pathway by affecting the stability of these small RNAs. OsPHO2 in rice interacts with the OsPHT1 protein and mediates its degradation through the 26S proteasome pathway, thereby regulating the phosphorus level in plants. Under phosphorus starvation conditions, the expression of OsPHO2 is inhibited by miR399, which reduces the degradation of OsPHT1 and enhances the phosphorus uptake of rice.

[0006] As an important food crop, the study of the PHO2 gene in foxtail millet may contribute to improving its phosphorus use efficiency, especially providing a theoretical basis for the genetic improvement of efficient phosphorus use in crops under phosphorus-poor soil conditions. At present, the regulation of the heading stage of plants by foxtail millet PHO2 under low phosphorus environment has not been reported. Summary of the Invention

[0007] One of the objectives of the present invention is to provide a new method for regulating the heading time, plant height, leaf length, and / or leaf width of plants.

[0008] The present invention provides the application of the SiPHO2 protein, its encoding gene, or a biological material containing its encoding gene in regulating the heading time, plant height, leaf length, and / or leaf width of plants.

[0009] The present invention discloses a protein that promotes the early heading stage of plants and its application. This gene is an E2 ubiquitin ligase derived from foxtail millet and is called SiPHO2.

[0010] The present invention uses a bioinformatics analysis strategy to predict the gene editing sites of foxtail millet SiPHO2. After genetic transformation of mature embryos of foxtail millet, foxtail millet SiPHO2 gene-edited plants are obtained, and it is proved that after this gene is edited, it can promote the early heading stage of foxtail millet under low phosphorus environment. The ability of this gene to effectively promote the heading of plants under low phosphorus environment proves its application value in promoting the heading of organisms by using genetic engineering means.

[0011] The available phosphorus in the soil is severely insufficient. Discovering and utilizing key genes that promote heading under low phosphorus environment to shorten the growth period of crops is of great significance for better utilization of marginal land.

[0012] The present invention also provides the application of the SiPHO2 protein, its encoding gene, or a biological material containing its encoding gene in breeding transgenic plants with early heading time and / or low plant height under low phosphorus environment.

[0013] The present invention also provides the application of the SiPHO2 protein, its encoding gene, or a biological material containing its encoding gene in improving germplasm resources with early heading time and / or low plant height of plants under low phosphorus environment.

[0014] In the application of the present invention, by reducing the expression level and / or activity of the SiPHO2 protein in the plant, the heading time of the plant in a low-phosphorus environment is advanced or the plant height is reduced; Preferably, by causing the plant to express SiPHO2 a mutant gene to reduce the expression level and / or activity of the SiPHO2 protein, the SiPHO2 mutant gene uses the nucleotide sequence shown in SEQ ID NO.2 as a reference sequence, and there is an insertion of a base A (reverse complement is T) between the 211th bp and the 212th bp, or uses the nucleotide sequence shown in SEQ ID NO.2 as a reference sequence, there is a deletion of a G (reverse complement is C) base at the 211th bp, or uses the nucleotide sequence shown in SEQ ID NO.2 as a reference sequence, and there is an insertion of a base G (reverse complement is C) between the 211th bp and the 212th bp.

[0015] When the SiPHO2 gene of the plant mutates into the above SiPHO2 mutant gene, the SiPHO2 protein will no longer be expressed.

[0016] In the present invention, the "low-phosphorus environment" means that the available phosphorus content of the soil ≤ 0.01 mM.

[0017] In the application of the present invention, the SiPHO2 protein has any one of the following amino acid sequences: (1) The amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence of a protein with the same function obtained by substitution, insertion or deletion of one or more amino acids from the amino acid sequence shown in SEQ ID NO.1.

[0018] In the application of the present invention, the coding gene of the SiPHO2 protein has any one of the following nucleotide sequences: (1) The nucleotide sequence shown in SEQ ID NO.2; (2) The coding nucleotide sequence of a protein with the same function obtained by substitution, deletion or insertion of one or more nucleotides from the nucleotide sequence shown in SEQ ID NO.2; (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO.2 under stringent conditions.

[0019] In the application of the present invention, the biological material is an expression cassette, a vector or a host cell.

[0020] In the application of the present invention, the plant is foxtail millet.

[0021] The present invention also provides a method for constructing foxtail millet with an earlier heading time or reduced plant height under low phosphorus conditions, which reduces the expression level and / or activity of SiPHO2 protein in foxtail millet by means of gene knockout, hybridization, backcrossing, selfing or asexual reproduction, so that the heading time of foxtail millet is advanced or the plant height is reduced.

[0022] The beneficial effects of the present invention are at least as follows: The present invention provides a new method for regulating the heading time and plant height of plants. By reducing the expression of SiPHO2 protein, it can still promote the earlier heading time of plants under low phosphorus conditions, thereby shortening the growth period of crops and making better use of land resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 For foxtail millet SiPHO2 ( Seita.3G150400 )Gene editing type of gene-edited plants.

[0024] Figure 2 For the phenotypes of gene-edited plants of foxtail millet SiPHO2-CR and wild-type plants at the heading stage under low phosphorus stress (0.01 mM). The scale bar in the figure represents 10 cm.

[0025] Figure 3 For the physiological changes of each gene-edited plant of foxtail millet under low phosphorus stress (0.01 mM). DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] The preferred embodiments of the present invention will be described in detail below in conjunction with the examples. It should be understood that the following examples are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0027] The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources or prepared by conventional methods in the art unless otherwise specified.

[0028] Example 1 1. Materials: Plant materials: Foxtail millet Ci846 ( Setaria italica ).

[0029] Vectors: pEASY®-Blunt Simple Cloning Kit (CB111) (Beijing TransGen Biotech Co., Ltd.), pYLsgRNA-OsU6a, plant expression vector pYLCRISPR / Cas9 Pubi-H.

[0030] Strains: Escherichia coli TOP10, Agrobacterium tumefaciens EHA105.

[0031] Kit: FastPure Gel DNA Extraction Mini Kit (vazyme # DC301-01).

[0032] Instruments: Nano Drop (ND-2000) spectrophotometer, Beckman Instruments (J2-HS) centrifuge.

[0033] 2. Selection of gene editing sites Retrieve relevant information of foxtail millet SiPHO2 ( Seita.3G150400 ) from the Phyzotome database (https: / / phytozome-next.jgi.doe.gov / info / Sitalica_v2_2), including gene number, genomic sequence, etc. According to the coding region sequence of SiPHO2 ( Seita.3G150400 ), use CRISPR-GE (http: / / skl.scau.edu.cn / ), (http: / / crispor.tefor.net / ) and Huazhong Agricultural University CRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to design 1 gRNA knockout target site (select the target site with GC% reaching 50-70% and a score greater than 0.5), and connect the target site sequence to the 5' end of the sgRNA sequence for secondary structure analysis using the online software RNA Folding Form (http: / / mfold.rna.albany.edu / ?q=mfold / RNA-Folding-Form2.3). Finally, design fragment-specific primers according to the selected target site, and the sequences are as follows (the sequences represented by lowercase letters are the target site sequences, and the italicized sequences are the reverse complementary sequences of the target site): PHO2-Pubi-F (SEQ ID No.3): aacgcgtccaagctgacctgGTTTTAGAGCTAGAAAT.

[0034] PHO2-Pubi-R (SEQ ID No.4): CAGGTCAGCTTGGACGCGTT CGGCAGCCAAGCCAGCA.

[0035] 3. Construction of recombinant expression vector: Using the pYLsgRNA-OsU6a plasmid containing sgRNA as a template, two rounds of nested amplification were performed. For the first round of amplification, 2 pairs of primers were selected, namely the universal primers U-F (5’-CTCCGTTTTACCTGTGGAATCG-3’, SEQ ID No.5) and gR-R (5’-CGGAGGAAAATTCCATCCAC-3’, SEQ ID No.6), and the above-designed target-specific primers PHO2-Pubi-F and PHO2-Pubi-R; for the second round of amplification, 1 pair of universal primers was selected: U-GAL (5’-ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGCAAAGG-3’, SEQ ID No.7) and Pgs-GA2 (5’-CAGGGAGCGGATAACAATTTCACACAGGCACATCCACTCCAAGCTCTTG-3’, SEQ ID No.8). The enzyme used was the 2 × Phanta UniFi Master Mix universal ultra-high-fidelity enzyme premix (vazyme # P516). The target was driven by U6a to function. The second-round amplified fragments (PHO2-CR) and the plant expression vector pYLCRISPR / Cas9Pubi-H were purified separately using the FastPure GelDNA Extraction Mini Kit (vazyme # DC301-01). After ligation and transformation of Escherichia coli competent TOP10, monoclonal colonies were selected for PCR identification, and positive clones were selected for sequencing and alignment. The correctly aligned one was the gene editing vector PUbi-SiPHO2.

[0036] 4. Transformation of foxtail millet mature embryos and detection of gene-edited plants Mainly referring to the genetic transformation method of foxtail millet mature embryos (Yang et al., 2020), the dried foxtail millet Ci846 seeds were placed in a tray lined with plastic sheeting, and the seeds were gently rubbed with the plastic sheeting to remove the glumes. They were sterilized in 10% NaClO containing 0.1% Tween-20 for 20 minutes. The rinsed seeds with sterile water were placed on the callus induction medium one by one. The culture dish containing the seeds was placed in the light at 28 °C for 3 days, and after germination, it was transferred to a 28 °C incubator for dark culture for 6 weeks. The milky yellow and dense embryogenic calli were selected and placed on a new callus induction medium for continued culture for 3 - 7 days. Using the above vector PUbi-SiPHO2, genetic transformation was carried out by the method of Agrobacterium-induced foxtail millet mature embryos, including infection and co-culture of callus, screening of resistant callus, differentiation culture of callus, plant regeneration, and detection of gene-edited plants.

[0037] Three editing types (all frameshift mutations) were found by hygromycin (Hyg) resistance detection and sequencing, and were respectively labeled as: SiPHO2-CR#2, SiPHO2-CR#3, and SiPHO2-CR#4. Compared with the wild-type foxtail millet Ci846, SiPHO2-CR#2 has a base A (reverse complement is T) insertion between the 211st and 212nd bases of the SiPHO2 gene, SiPHO2-CR#3 has a G (reverse complement is C) deletion at the 211st base of the SiPHO2 gene, and SiPHO2-CR#4 has a base G (reverse complement is C) insertion between the 211st and 212nd bases of the SiPHO2 gene.

[0038] For the specific editing types, see Figure 1 , since the editing sites were designed according to the complementary strand, the editing sites are shown according to the complementary strand.

[0039] 5. Gene-edited foxtail millet plants promote heading under low-phosphorus conditions After harvesting the seeds of the above-obtained gene-edited foxtail millet (editing types are SiPHO2-CR#2, SiPHO2-CR#3, and SiPHO2-CR#4) and the seeds of wild-type foxtail millet Ci846, they were respectively cultured in pure vermiculite (soilless) and liquid medium in the greenhouse (phosphorus concentration is 0.01 mM). The greenhouse environment was 24°C, with 12 h of light / 12 h of darkness. The plant height, heading time, and the length and width of the second-to-last leaf of mature foxtail millet were observed for each gene-edited foxtail millet in the low-phosphorus environment.

[0040] There are multiple biological replicates for wild-type and various editing types, and the specific results are shown in Tables 1 to 4. At the heading stage, the plant height of gene-edited foxtail millet was much lower than that of wild-type plants ( Figure 2 , SiPHO2-CR#2 and SiPHO2-CR#4 had similar phenotypes), and the average height was 41.4% lower than that of wild-type plants.

[0041] In addition, the leaf length and width of each gene-edited foxtail millet at maturity were also affected and decreased compared with wild-type plants. The heading stage of each gene-edited foxtail millet was also earlier than that of wild-type plants ( Figure 3 ).

[0042] Table 1 Statistical results of plant height (cm)

[0043] Table 2 Statistical results of heading time (days)

[0044] Table 3 Statistical results of the length of the second-to-last leaf (cm)

[0045] Table 4 Statistical Results of the Width of the Second-to-Last Leaf (cm)

[0046] Although the present invention has been described in detail with general descriptions and specific embodiments above, modifications or improvements can be made based on the present invention, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention fall within the scope of the present invention claimed.

Claims

1. Application of SiPHO2 protein, its encoding gene or biological materials containing its encoding gene in regulating heading time, plant height, leaf length and / or leaf width of plants.

2. Application of SiPHO2 protein, its encoding gene or biological materials containing its encoding gene in breeding transgenic plants with early heading time and / or low plant height under low phosphorus environment.

3. Application of SiPHO2 protein, its encoding gene or biological materials containing its encoding gene in improving plant heading time and / or low plant height germplasm resources under low phosphorus environment.

4. The use according to any one of claims 1 to 3, characterized in that: By reducing the expression level and / or activity of the SiPHO2 protein in the plant, the heading time of the plant is advanced or the plant height is reduced in a low-phosphorus environment.

5. The use according to claim 4, characterized in that: By causing the plant to express SiPHO2 The mutant gene reduces the expression level and / or activity of the SiPHO2 protein, SiPHO2 The mutant gene uses the nucleotide sequence shown in SEQ ID NO.2 as a reference sequence, and there is an insertion of base A between the 211th bp and the 212th bp base, or uses the nucleotide sequence shown in SEQ ID NO.2 as a reference sequence, and there is a deletion of base G at the 211th bp base, or uses the nucleotide sequence shown in SEQ ID NO.2 as a reference sequence, and there is an insertion of base G between the 211th bp and the 212th bp base.

6. The use according to any one of claims 1 to 3, characterized in that: The SiPHO2 protein has any of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids, and having the same functional protein.

7. The use according to any one of claims 1 to 3, characterized in that: The coding gene of the SiPHO2 protein has any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) A nucleotide sequence encoding a protein with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.2; (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions.

8. The use according to any one of claims 1 to 3, characterized in that: The biological material is an expression cassette, a vector or a host cell.

9. The use according to any one of claims 1 to 3, characterized in that: The plant is millet.

10. A method for constructing millet with an early heading time or reduced plant height under a low-phosphorus environment, characterized in that: The expression level and / or activity of SiPHO2 protein in millet is reduced by gene knockout, hybridization, backcrossing, selfing or asexual reproduction, so that the heading time of millet is advanced or the plant height is reduced.

Images