Method for reducing immunogenicity of medical enzyme, medical enzyme, preparation method and application

Abstract

The invention belongs to the field of biological agents, and particularly relates to a method for reducing immunogenicity of a medical enzyme, the medical enzyme, a preparation method and application. The invention relates to a method for reducing immunogenicity of a medical enzyme. A zwitter-ion motif segment is used for modifying a C terminal of a medical enzyme gene segment. The antigenic epitope of the enzyme can be modified in a targeted manner through a green, environment-friendly and controllable biosynthesis method, so that the immunogenicity of the medical enzyme is reduced. According to the method, on the premise of basically retaining the catalytic activity and stability of the therapeutic enzyme preparation, the therapeutic enzyme preparation is not easily recognized and cleared by an immune system, and the immunogenicity of the therapeutic enzyme preparation can be remarkably reduced, so that the in-vivo circulation time of the therapeutic enzyme preparation is prolonged, and the curative effect is improved.

Description

Technical Field

[0001] The present invention belongs to the field of biological agents, and particularly relates to a method for reducing the immunogenicity of a medical enzyme, a medical enzyme, and a preparation method and application thereof. Background Art

[0002] As an important class of biocatalysts, enzymes are widely used in the fields of biomedicine, food, chemical engineering, etc. Especially in the field of biomedicine, by participating in various biochemical reactions, they play a crucial role both in vivo and in vitro. However, problems such as the high immunogenicity of natural enzymes and their too low molecular weight being easily filtered and cleared by the glomerulus have greatly limited their application in clinical practice. Especially when exogenous enzymes enter the human body, they may trigger immune reactions, resulting in reduced efficacy or side effects. For therapeutic enzyme preparations, immunogenicity not only affects the efficacy of the drug, but may also cause problems such as allergic reactions and antibody production, limiting their application in clinical practice. Therefore, reducing the immunological activity of enzymes has become an important research direction in the field of enzyme engineering.

[0003] The immunogenicity of enzymes mainly stems from specific regions (i.e., antigenic epitopes) in their protein structures, which can be recognized by the immune system and trigger immune reactions. To solve the immunogenicity problem of enzymes, a variety of enzyme modification techniques have been developed at present, mainly including:

[0004] Modifying the amino acid residues on the surface of the enzyme molecule by chemical methods, such as polyethylene glycol (PEG) modification. PEGylation can shield the antigenic epitopes of the enzyme and reduce the recognition by the immune system; modifying the amino acid sequence of the enzyme by genetic engineering techniques, such as mutating or deleting antigenic epitopes, or introducing humanized sequences to reduce immunogenicity; changing the glycosylation pattern of the enzyme to mask antigenic epitopes or change the immunological properties of the enzyme.

[0005] Although the above modification methods have reduced the immunogenicity of enzymes to a certain extent, there are still limitations: chemical modification has limited control over the coupling sites and stoichiometry, low yield, and may affect the activity or stability of the enzyme; genetic engineering modification has high costs and complex techniques; and the effect of glycosylation modification depends on the specificity of the host cell. Summary of the Invention

[0006] The purpose of the present invention is to overcome the shortcomings in the prior art and provide a method for reducing the immunogenicity of a medical enzyme, a medical enzyme, and an application.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is:

[0008] A method for reducing the immunogenicity of a medical enzyme, using an amphoteric ion motif segment to modify the C-terminus of a medical enzyme gene fragment.

[0009] The zwitterionic motif segment is multiple repeated ionic motif segments (VPKEG)m, where 20 ≤ m ≤ 60 and m is an integer.

[0010] Preferably, m is 40, and the sequence of the zwitterionic motif segment is as shown in SEQ ID NO:2.

[0011] The zwitterionic motif segment is connected to the C-terminus of the medical enzyme through a flexible linker or a rigid linker.

[0012] The flexible linker is GGGGS, and the sequence of the flexible linker is as shown in SEQ ID NO:3; the rigid linker is EAAAK, and the sequence of the rigid linker is as shown in SEQ ID NO:4.

[0013] The medical enzyme gene fragment is an asparaginase or a metabolic enzyme gene fragment; the sequence of the asparaginase gene fragment is as shown in SEQ ID NO:5.

[0014] The N-terminus of the medical enzyme gene fragment is modified with a 6xHis tag segment. The 6xHis tag is HHHHHH, and the sequence of the 6xHis tag is as shown in SEQ ID NO:1.

[0015] The present invention also includes a zwitterion-modified medical enzyme obtained by the method for reducing the immunogenicity of a medical enzyme described above.

[0016] The synthesis method of the zwitterion-modified medical enzyme specifically includes the following steps: (1) Synthesize the nucleotide sequence encoding the medical enzyme modified with the zwitterionic compound; (2) Connect the gene with a vector / plasmid, transform Escherichia coli, and construct a recombinant genetic engineering bacterium; (3) Expand the culture of the constructed recombinant genetic engineering bacterium, induce the expression of the fusion protein, collect the bacterial cells and break them to obtain a crude enzyme solution, and purify to obtain the medical enzyme modified with the zwitterionic compound.

[0017] The present invention also includes an application of the zwitterion-modified medical enzyme, which is characterized in that it is applied to the preparation of biological preparations, drug delivery, or protein modification.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] Zwitterionic polymers are a class of polymers with a pair of opposite charges carried on the repeating units, which can form a hydrated layer on the surface of fusion proteins through ionic solvation. Zwitterionic polymers render the overall surface neutral, shield the surface charges, reduce non-specific protein adsorption such as electrostatic interactions, and possess properties such as hydrophilicity and biocompatibility. In addition, this class of polymers can form a physical barrier on the surface of fusion proteins, with a steric hindrance effect, reducing immunogenicity. This "stealth" property of zwitterionic polymers makes fusion proteins less likely to be recognized and cleared by the immune system, thereby prolonging their circulation time in the body and enhancing the therapeutic effect.

[0020] VPKEG is a pentapeptide repeat sequence in which the zwitterionic dipeptide EK (glutamic acid and lysine) is incorporated into the intrinsically disordered polypeptide motif of elastin-like polypeptides (ELPs). It utilizes both the biodegradability, good biocompatibility, and low immunogenicity of ELPs and the "stealth" behavior conferred by zwitterions. The VPKEG pentapeptide repeat sequence can precisely control the sequence and chain length at the gene level and can more accurately control the synthesis, with an accuracy that cannot be achieved by synthetic polymers. By fusing VPKEG with enzyme-based therapeutic agents, the plasma circulation of the therapeutic enzyme agents can be increased, and the half-life and bioavailability can be improved.

[0021] This application can modify the antigenic epitopes of enzymes specifically through a green, environmentally friendly, and controllable biosynthesis method to reduce the immunogenicity of medical enzymes. This method can render them less likely to be recognized and cleared by the immune system while basically retaining the catalytic activity and stability of the therapeutic enzyme agents, significantly reducing their immunogenicity, thereby prolonging their circulation time in the body and enhancing the therapeutic effect.

[0022] The technical method of this application can be widely applied to the development of therapeutic enzyme agents, providing a new solution for the application of enzyme drugs in the fields of tumor treatment, metabolic disease treatment, etc. It is expected to promote the further development of the enzyme engineering field, providing an efficient, economical, and general method for reducing enzyme immunogenicity, and improving the safety and effectiveness in clinical applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 . Schematic diagram of gene synthesis in the embodiments of the present invention;

[0024] Figure 2 . pET-28a(+) plasmid sequence map;

[0025] Figure 3 . SDS-PAGE electrophoresis diagrams of the crude enzyme solution of the control group and the purified one;

[0026] Figure 4 . SDS-PAGE electrophoresis diagrams of the crude enzyme solution of the flexible linker of the experimental group and the purified one;

[0027] Figure 5 . SDS-PAGE electrophoresis patterns of the crude enzyme solution of the flexible linker in the experimental group and the purified one;

[0028] Figure 6 . Circular dichroism spectra of the three groups of proteins;

[0029] Figure 7 . Percentage of the secondary structure of the three groups of proteins;

[0030] Figure 8 . Percentage of DC cells maintained in the immature state. Detailed implementation manners

[0031] To enable those skilled in the art of the present technology to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and the best embodiments.

[0032] Example 1

[0033] Preparation method of asparaginase ASNase: Synthesize the DNA fragment of the asparaginase ASNase, as Figure 1 shown in a. The 6xHis tag sequence is HHHHHH, and the sequence is shown in SEQ ID NO:1; the asparaginase ASNase sequence is shown in SEQ ID NO:5.

[0034] Then design the nucleotide sequence encoding the above-mentioned asparaginase. Among them, the nucleotide sequence of the 6xHis tag is shown in SEQ ID NO:9, and the nucleotide sequence of the asparaginase is shown in SEQ ID NO:13.

[0035] Example 2

[0036] Preparation method of the recombinant asparaginase ASNase-(VPKEG) 40 in the experimental group:

[0037] Respectively use a flexible linker and a rigid linker to synthesize the DNA fragment of the recombinant asparaginase ASNase-(VPKEG) 40 , as Figure 1 shown in b and 1c. The 6xHis tag sequence is HHHHHH, and the sequence is shown in SEQ ID NO:1;

[0038] The zwitterionic repeat peptide segment is Val-Pro-Lys-Glu-Gly (VPKEG) m , 20 ≤ m ≤ 60, and m is an integer; preferably, m is 40, and the sequence of the pentapeptide zwitterionic motif segment is shown in SEQ ID NO:2;

[0039] The flexible linker sequence is GGGGS, and the sequence is shown as SEQ ID NO:3; the rigid linker sequence is EAAAK, and the sequence is shown as SEQ ID NO:4;

[0040] The asparaginase sequence is shown as SEQ ID NO:5.

[0041] A method for reducing the immunogenicity of a medical enzyme includes the following steps:

[0042] (1) Synthesize a nucleotide sequence encoding the zwitterionic polymer-modified medical enzyme; the nucleotide sequence encoding the above recombinant asparaginase, wherein the nucleotide sequence of the 6xHis tag is shown as SEQ ID NO:9, the nucleotide sequence of the repeating pentapeptide is shown as SEQ ID NO:10, the nucleotide sequence of the flexible linker is shown as SEQ ID NO:11, the nucleotide sequence of the rigid linker is shown as SEQ ID NO:12, and the nucleotide sequence of asparaginase is shown as SEQ ID NO:13.

[0043] (2) Connect the gene with a vector / plasmid, transform Escherichia coli, and construct a recombinant genetic engineering bacterium; the plasmid vector for gene expression is selected as pET-28(+), and the sequence map of plasmid pET-28a(+) is as Figure 2 shown. The pET series vectors are a very widely used class of prokaryotic expression vectors with a high copy number and are often used to construct high-level expression of target genes. This plasmid vector has a T7 promoter system, and T7 RNA polymerase has strong transcriptional activity, and the gene expression level can be regulated by adding an inducer (such as IPTG).

[0044] The host for gene expression is selected as BL21(DE3) competent Escherichia coli. BL21 is suitable for the recombinant protein induction expression system driven by the T7 promoter. This strain is an Escherichia coli B strain lacking endogenous proteases, which can effectively avoid the degradation of recombinant expressed proteins and is widely used for the expression of recombinant proteins. BL21(DE3) is a BL21-derived strain lysogenized by the λ phage DE3. The T7 RNA polymerase in the phage DE3 is controlled by the lacUV5 promoter, and exogenous addition of IPTG can induce the rapid expression of T7 RNA polymerase in the BL21(DE3) strain. T7 RNA polymerase recognizes the T7 promoter on the pET-28(+) vector, thereby driving the high-level expression of recombinant proteins.

[0045] The full-length gene fragments of the control group and the experimental group were introduced into the pET-28(+) plasmid, and then the plasmid was transferred into BL21(DE3) competent cells by heat shock transformation. The single colonies were picked for culture by dilution gradient coating on solid medium, the plasmid was extracted and PCR amplified, and finally agarose gel electrophoresis was performed to verify the consistency between the gene length and the theoretical length.

[0046] (3) The constructed recombinant genetic engineering bacteria were expanded in culture, the fusion protein was induced to express, the bacterial cells were collected and lysed to obtain a crude enzyme solution, and the zwitterionic modified medical enzyme was purified.

[0047] After obtaining the target gene, it was cultured overnight for 16 h in 5 ml of LB liquid medium, then inoculated into YT liquid medium at an inoculation amount of 0.5% for expansion culture for 8 - 10 h, isopropyl-β-D-thiogalactoside (IPTG) with a final concentration of 1 mM was added for culture for 16 - 20 h, the bacterial cells were collected by centrifugation, and the crude enzyme solution was obtained by ultrasonic disruption.

[0048] During the above-mentioned Escherichia coli culture process, the culture temperature was 37°C and the rotation speed was 220 rpm; based on the resistance of pET-28a(+), kanamycin was selected as the antibiotic with a final concentration of 50 μg / ml.

[0049] Based on the protein containing a 6xHis tag, affinity chromatography was performed using a gravity column to obtain the corresponding protein. Then, the purity was determined by SDS-PAGE gel electrophoresis, and the SDS-PAGE gel electrophoresis results are as Figures 3 - 5 shown.

[0050] The yield of the crude enzyme solution in Example 1 was 16.81 mg / L, the yield of the crude enzyme solution in the flexible linker group of Example 2 was 80.13 mg / L (compared with the same molecular weight), and the yield of the crude enzyme solution in the rigid linker group of Example 2 was 51.87 mg / L (compared with the same molecular weight).

[0051] The proteins obtained in Example 1 and Example 2 were used for property studies;

[0052] 1. In vitro enzyme activity: The asparaginase solutions obtained in Example 1 and Example 2 were assayed for in vitro enzyme activity, and Nessler's reagent was used to detect the ammonium produced.

[0053] In a 1.5 ml centrifuge tube, phosphate buffer (90 μL, pH 7.4), sample solution (10 μL), and L-asparagine solution (20 μL, 40 mM) were mixed and reacted at 37 °C for 10 min. Centrifuge at 1000 g for 5 min with trichloroacetic acid solution (TCA, 20 μL, 1.5 M). Add the supernatant (20 μL) to a transparent 96-well plate (containing Nessler's reagent (20 μL), phosphate buffer (160 μL, pH 7.4)). Then measure the absorbance at 410 nm using an enzyme-linked immunosorbent assay detector. A standard working curve for calculating the ASNase concentration was prepared with a series of ammonium at known concentrations. One unit of ASNase was defined as the amount of enzyme required to produce 1.0 μmol of ammonia per minute at pH 7.4 and 37 °C.

[0054] According to the above enzyme activity assay method, the enzyme activity of Example 1 was 120.78 U / mg, the enzyme activity of the flexible linker group in Example 2 was 103.8 U / mg (comparing the same molecular weight), and that of the rigid linker group in Example 2 was 23.7 mg / L (comparing the same molecular weight).

[0055] 2. Circular dichroism: The asparaginase solutions obtained in Example 1 and Example 2 were prepared into a 1 mg / ml solution, and a 0.1 mm cuvette was used for full-wavelength scanning of circular dichroism at room temperature. The wavelength ranged from 180 nm to 260 nm, with a wavelength interval of 1 nm and a residence time of 2 s at each wavelength. The results are as Figure 6 shown. Clear negative absorption peaks characteristic of α-helices appeared at 208 nm and 222 nm, which is in line with the secondary structure of asparaginase, indicating that the modification of VPKEG did not significantly affect the secondary structure of asparaginase.

[0056] 3. Analysis of the structural percentage of proteins: Using spectroscopic analysis software, the secondary structure was calculated for the above wavelength data. The results are as Figure 7 shown. Compared with the flexible linker, when using the rigid linker as the connection, the percentage contents of α-helix and β-turn increased significantly, while the percentage content of β-sheet decreased significantly. Combining with the enzyme activity results analysis, it may be that the introduction of the rigid linker affected the formation of dimers or even tetramers between asparaginase monomers, or the rigid linker caused the disordered chain of VPKEG to cover the active site of the enzyme, thereby affecting the enzyme activity.

[0057] 4. Immunogenicity of proteins

[0058] After freeze-drying the asparaginase solutions obtained in Example 1 and Example 2, a 1 mg / ml solution was prepared and the immunogenicity of the protein was evaluated using human DC dendritic cells. The immune response induced by the entry of exogenous proteins into the body is usually triggered by activated dendritic cells (DCs), which induce the differentiation of T cells to recognize the antigens of exogenous proteins.

[0059] 1% antibiotic / antifungal agent and 10% fetal bovine serum (FBS) were added to the cell basal medium as the cell culture medium, and two cytokines (IL-4 and GM-CSF) were added to the culture system of human dendritic cells (DC). The cells were cultured in a humidified incubator at 37 °C and 5% CO2 until they reached a semi-adherent state for the next incubation.

[0060] The DC cells were co-incubated with PBS, LPS (1 mg / ml), and the asparaginase solutions obtained in Example 1 and Example 2 for 72 hours. PBS and LPS were used as negative and positive controls respectively. After incubation, the cells were centrifuged at 300 g for 10 minutes. The harvested cells were washed twice with cold sterile PBS. The cells were labeled with FITC anti-human HLA-DR antibody and PE anti-human CD11c antibody and analyzed using a flow cytometer. The percentage of DC cells maintaining the immature state was as Figure 8 shown. Compared with LPS and native asparaginase that mimic the maturation of about 40% of DCs, about 90% of DCs of the two modified fusion proteins remained in the immature state. The reason for the slightly lower immunogenicity of the rigid linker compared to the flexible linker may be that the presence of the rigid linker allows VPKEG to better encapsulate the enzyme, masking the antigenic epitopes and resulting in lower immunogenicity.

[0061] The above results indicate that modifying asparaginase with VPKEG repeats can increase the yield and reduce the immunogenicity while maintaining its basic activity.

[0062] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

[0063] Sequence Listing

[0064] SEQ ID NO:1

[0065] His His His His His His

[0066] SEQ ID NO:2

[0067] Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val ProLys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu GlyVal Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly

[0068] SEQ ID NO:3

[0069] Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

[0070] SEQ ID NO:4

[0071] Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys Glu Ala Ala Ala Lys

[0072] SEQ ID NO:5

[0073] Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Val Gly Lys Val Gly Val Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Asn Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn Arg Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly Ile Val Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Ser ValPhe Asp Thr Leu Ala Thr Ala Ala Lys Thr Gly Thr Ala Val Val Arg Ser Ser Arg Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Gln Gln Ile Gln Gln Ile Phe Asn Gln Tyr

[0074] SEQ ID NO:6

[0075] His His His His His His Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly GlyThr Ile Ala Gly Gly Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Val Gly Lys ValGly Val Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val LysGly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Asn Val Trp Leu ThrLeu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr Asp Gly Phe Val Ile Thr HisGly Thr Asp Thr Met Glu Glu Thr Ala Tyr Phe Leu Asp Leu Thr Val Lys Cys AspLys Pro Val Val Met Val Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp GlyPro Phe Asn Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn ArgGly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val Thr Lys ThrAsn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr Gly Pro Leu Gly Tyr IleHis Asn Gly Lys Ile Asp Tyr Gln Arg Thr Pro Ala Arg Lys His Thr Ser Asp ThrPro Phe Asp Val Ser Lys Leu Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn TyrAla Asn Ala Ser Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly IleVal Ser Ala Gly Val Gly Asn GlyAsn Leu Tyr Lys Ser Val Phe Asp Thr Leu AlaThr Ala Ala Lys Thr Gly Thr Ala Val Val Arg Ser Ser Arg Val Pro Thr Gly AlaThr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys Tyr Gly Phe Val Ala Ser Gly ThrLeu Asn Pro Gln Lys Ala Arg Val Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys AspPro Gln Gln Ile Gln Gln Ile Phe Asn Gln Tyr

[0076] SEQ ID NO:7

[0077] His His His His His His Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly GlyThr Ile Ala Gly Gly Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Val Gly Lys ValGly Val Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val LysGly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Asn Val Trp Leu ThrLeu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr Asp Gly Phe Val Ile Thr HisGly Thr Asp Thr Met Glu Glu Thr Ala Tyr Phe Leu Asp Leu Thr Val Lys Cys AspLys Pro Val Val Met Val Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp GlyPro Phe Asn Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn ArgGly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val Thr Lys ThrAsn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr Gly Pro Leu Gly Tyr IleHis Asn Gly Lys Ile Asp Tyr Gln Arg Thr Pro Ala Arg Lys His Thr Ser Asp ThrPro Phe Asp Val Ser Lys Leu Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn TyrAla Asn Ala Ser Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly IleVal Ser Ala Gly Val Gly Asn GlyAsn Leu Tyr Lys Ser Val Phe Asp Thr Leu AlaThr Ala Ala Lys Thr Gly Thr Ala Val Val Arg Ser Ser Arg Val Pro Thr Gly AlaThr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys Tyr Gly Phe Val Ala Ser Gly ThrLeu Asn Pro Gln Lys Ala Arg Val Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys AspPro Gln Gln Ile Gln Gln Ile Phe Asn Gln Tyr Gly Gly Gly Gly Ser Gly Gly GlyGly Ser Gly Gly Gly Gly Ser Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val ProLys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly ValPro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu GlyVal Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys GluGly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro LysGlu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val ProLys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly ValPro Lys Glu Gly Val Pro Lys GluGly Val Pro Lys GluGly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro LysGlu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly

[0078] SEQ ID NO:8

[0079] His His His His His His Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly GlyThr Ile Ala Gly Gly Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Val Gly Lys ValGly Val Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val LysGly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Asn Val Trp Leu ThrLeu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr Asp Gly Phe Val Ile Thr HisGly Thr Asp Thr Met Glu Glu Thr Ala Tyr Phe Leu Asp Leu Thr Val Lys Cys AspLys Pro Val Val Met Val Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp GlyPro Phe Asn Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn ArgGly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val Thr Lys ThrAsn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr Gly Pro Leu Gly Tyr IleHis Asn Gly Lys Ile Asp Tyr Gln Arg Thr Pro Ala Arg Lys His Thr Ser Asp ThrPro Phe Asp Val Ser Lys Leu Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn TyrAla Asn Ala Ser Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly IleVal Ser Ala Gly Val Gly Asn GlyAsn Leu Tyr Lys Ser Val Phe Asp Thr Leu AlaThr Ala Ala Lys Thr Gly Thr Ala Val Val Arg Ser Ser Arg Val Pro Thr Gly AlaThr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys Tyr Gly Phe Val Ala Ser Gly ThrLeu Asn Pro Gln Lys Ala Arg Val Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys AspPro Gln Gln Ile Gln Gln Ile Phe Asn Gln Tyr Glu Ala Ala Ala Lys Glu Ala AlaAla Lys Glu Ala Ala Ala Lys Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val ProLys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly ValPro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu GlyVal Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys GluGly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro LysGlu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val ProLys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly ValPro Lys Glu Gly Val Pro Lys GluGly Val Pro Lys GluGly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro LysGlu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly Val Pro Lys Glu Gly

[0080] SEQ ID NO:9

[0081] catcaccatcaccatcat

[0082] SEQ ID NO:10

[0083] gtgccgaaagagggcgtgccaaaagaaggtgtgccgaaggagggtgttccgaaggaaggtgtgccgaaggaaggcgttccgaaagaaggcgttccgaaggaaggcgtgccgaaagagggtgtgccaaaagaaggtgtgccaaaagagggcgtgccgaaggaaggcgtgccgaaggagggtgtgccgaaagagggtgttccgaaggagggcgttccgaaagaaggcgtgccgaaagaaggcgtgccgaaagagggtgttccaaaagagggcgtgccgaaagaaggtgtgccgaaagaaggcgtgccgaaagagggcgtgccaaaagaaggcgttccaaaagaaggcgtgccaaaggaaggtgttccaaaagaaggtgttccaaaggaaggcgtgccgaaagaaggcgtgccaaaagaaggcgttccaaaagagggtgttccgaaagaaggtgtgccgaaagagggcgtgccaaaggaaggcgtgccaaaagagggcgttccaaaagagggcgtgccgaaggagggcgttccgaaggaaggcgtgccgaaagaaggcgtgccgaaagagggcgtgccaaaagaaggcgttccaaaagaaggc

[0084] SEQ ID NO:11

[0085] catcaccatcaccatcat

[0086] SEQ ID NO:12

[0087] gaagcagcagccaaggaagccgcagccaaagaagcagcagcgaaa

[0088] SEQ ID NO:13

[0089] ctgccgaacattaccattctggcgaccggcggcaccattgcgggcggtggcgatagcgcgaccaaaagcaactataccgtgggcaaagtgggcgtggaaaacctggtgaacgcggtgccgcagctgaaagatattgcgaacgtgaaaggcgaacaagtggtgaacattggcagccaagatatgaacgataacgtgtggctgaccctggcgaaaaaaattaacaccgattgcgataaaaccgatggctttgtgattacgcatggcaccgatacgatggaagaaaccgcgtattttctggatctgaccgtgaaatgcgataaaccggtggtgatggtgggcgcgatgcgcccgagcacgagcatgagcgcggatggcccgtttaacctgtataacgcggtggtgaccgcggcggataaagcgagcgcgaaccgcggcgtgctggtggtgatgaacgataccgtgctggatggccgcgatgtgaccaaaaccaacaccaccgatgtggcgacctttaaaagcgtgaactatggcccgctgggctatattcataacggcaaaattgattatcagcgcaccccggcgcgcaaacatacgagcgataccccgtttgatgtgagcaaactgaacgaactgccgaaagtgggcattgtgtataactatgcgaacgcgagcgatctgccggcgaaagcgctggtggatgcgggctatgatggcattgtgagcgcgggcgtgggcaacggcaacctgtataaaagcgtgtttgatacgctggcgaccgcggcgaaaacgggcaccgcggtggtgcgcagtagccgtgtgccgaccggcgcgaccacccaagatgcggaagtggatgatgcgaaatatggctttgtggcgagcggcaccctgaacccgcagaaagcgcgcgtgctgctgcagctggcgctgacgcagaccaaagatccgcagcagattcagcagatttttaatcagtat

[0090] SEQ ID NO:14

[0091] catcaccatcaccatcatctgccgaacattaccattctggcgaccggcggcaccattgcgggcggtggcgatagcgcgaccaaaagcaactataccgtgggcaaagtgggcgtggaaaacctggtgaacgcggtgccgcagctgaaagatattgcgaacgtgaaaggcgaacaagtggtgaacattggcagccaagatatgaacgataacgtgtggctgaccctggcgaaaaaaattaacaccgattgcgataaaaccgatggctttgtgattacgcatggcaccgatacgatggaagaaaccgcgtattttctggatctgaccgtgaaatgcgataaaccggtggtgatggtgggcgcgatgcgcccgagcacgagcatgagcgcggatggcccgtttaacctgtataacgcggtggtgaccgcggcggataaagcgagcgcgaaccgcggcgtgctggtggtgatgaacgataccgtgctggatggccgcgatgtgaccaaaaccaacaccaccgatgtggcgacctttaaaagcgtgaactatggcccgctgggctatattcataacggcaaaattgattatcagcgcaccccggcgcgcaaacatacgagcgataccccgtttgatgtgagcaaactgaacgaactgccgaaagtgggcattgtgtataactatgcgaacgcgagcgatctgccggcgaaagcgctggtggatgcgggctatgatggcattgtgagcgcgggcgtgggcaacggcaacctgtataaaagcgtgtttgatacgctggcgaccgcggcgaaaacgggcaccgcggtggtgcgcagtagccgtgtgccgaccggcgcgaccacccaagatgcggaagtggatgatgcgaaatatggctttgtggcgagcggcaccctgaacccgcagaaagcgcgcgtgctgctgcagctggcgctgacgcagaccaaagatccgcagcagattcagcagatttttaatcagtat

[0092] SEQ ID NO:15

[0093]

[0094] SEQ ID NO:16

[0095]

Claims

1. A method for reducing the immunogenicity of a medical enzyme, characterized in that: The C-terminus of the medical enzyme gene fragment was modified with a zwitterionic motif segment.

2. The method for reducing the immunogenicity of a medical enzyme according to claim 1, characterized in that: The zwitterionic motif segment is a plurality of repeated ionic motif segments (VPKEG) m, 20≤m≤60, and is an integer.

3. The method for reducing the immunogenicity of a medical enzyme according to claim 2, characterized in that: The m is 40, and the sequence of the zwitterionic motif segment is shown in SEQ ID NO:

2.

4. The method for reducing the immunogenicity of a medical enzyme according to claim 1, characterized in that: The zwitterionic motif segment is connected to the C-terminus of the medical enzyme via a flexible linker or a rigid linker.

5. The method for reducing the immunogenicity of a medical enzyme according to claim 4, characterized in that: The flexible linker is GGGGS, and the flexible linker sequence is shown in SEQ ID NO:3; the rigid linker is EAAAK, and the rigid linker sequence is shown in SEQ ID NO:

4.

6. The method for reducing the immunogenicity of a medical enzyme according to claim 1, characterized in that: The medical enzyme gene fragment is an asparaginase or metabolic enzyme gene fragment; preferably, the sequence of the asparaginase gene fragment is shown in SEQ ID NO:

5.

7. The method for reducing the immunogenicity of a medical enzyme according to claim 1, characterized in that: The N-terminus of the medical enzyme gene fragment is modified with a 6xHis tag segment, the 6xHis tag is HHHHHH, and the 6xHis tag sequence is shown in SEQ ID NO:

1.

8. A zwitterion-modified medical enzyme obtained by the method for reducing the immunogenicity of a medical enzyme according to any one of claims 1 to 7.

9. The method for preparing a zwitterion-modified medical enzyme according to claim 8, characterized in that: The method specifically comprises the following steps: (1) synthesizing a nucleotide sequence encoding the medical enzyme modified by the zwitterionic compound; (2) connecting the gene to a vector / plasmid, transforming Escherichia coli, and constructing a recombinant genetically engineered bacterium; (3) expanding the culture of the constructed recombinant genetically engineered bacterium, inducing the expression of fusion protein, collecting and crushing the bacterial cells to obtain a crude enzyme solution, and purifying the zwitterionic modified medical enzyme.

10. A use of the zwitterion-modified medical enzyme according to claim 8, characterized in that: Used in the preparation of biological preparations, drug delivery or protein modification.

Images